CN107034284A - Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections - Google Patents
Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections Download PDFInfo
- Publication number
- CN107034284A CN107034284A CN201710340558.8A CN201710340558A CN107034284A CN 107034284 A CN107034284 A CN 107034284A CN 201710340558 A CN201710340558 A CN 201710340558A CN 107034284 A CN107034284 A CN 107034284A
- Authority
- CN
- China
- Prior art keywords
- ball pin
- sang
- sheng ball
- primer
- sang sheng
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
Application the invention discloses Sang Sheng ball pin shells ITS sequence and its in Sang Sheng ball pin shell Molecular Detections.And devise the primer sets of three pairs of specific quick detection Sang Sheng ball pin shells.The primer sets are 1B1877F/1B2291R, 2B1802F/2B2303R, 3B1808F/3B2347R, nucleotide sequence is respectively as shown in SEQ ID NO.2~7, Sang Sheng ball pin shell bacterium can specifically be detected, especially primer sets 2B1802F/2B2303R, it is high that testing result is reliable, easy to operation, high specificity, sensitivity, especially in infecting early stage（Incubation period）Sick leaf detection, and can using a variety of samples such as mulberry leaf, branch, soil as detection object, with important practical application meaning.
Description
Technical field
The invention belongs to cause of disease field of molecular detection.More particularly, to Sang Sheng ball pin shells ITS sequence and its in mulberry
Application in raw ball pin shell Molecular Detection.
Background technology
Powdery mildew (Mulberry powdery mildew), i.e. mulberry powdery mildew in mulberry, because the mycelium of pathogen is present in
The back side of mulberry branch middle and lower part blade, therefore accurately address is generally powdery mildew in mulberry, a kind of fungal infection mulberry leaf are caused
The plant disease of big flakes patch is produced on mulberry leaf surface.Mulberry powdery mildew disease cycle can from spring end to autumn, by
In a large amount of mycelia in mulberry leaf superficial growth, deteriorate the yield reduction of mulberry leaf, quality, nutriture value value difference, this mulberry leaf of feeding
Silkworm constitution is weak, easily occurs silkworm disease, influences the quality and yield of silk, the reduction sericultural production output value (Lv Hongsheng, 2008；King
Eastwards, 2009).
Between past more than 100 years, the morphologic observation to powdery mildew pathogenic bacteria in mulberry is detailed enough, in point of kind
Do not had objection in class.The sexual generation of powdery mildew pathogenic bacteria shows as Phyllactinia (Phyllactinia) in mulberry, because of host
For mulberry tree, general address is Phyllactinia moricola, and asexual generation, to intend ovule spore category (Ovulariopsis), claims
For Ovulariopsis moricola；But not only this is a kind of for the pathogen of mulberry tree powdery mildew, hazel ball pin shell
Phyllactinia guttata can the parasitic plant more than 51 sections, include the Morus (Zheng Ruyong, 1987) of Moraceae.But, mulberry
The pathogen of powdery mildew is more single, is Phyllactinia (Phyllactinia), and the pathogen species based on Molecular Identification are then
Phyllactinia moricola, the pathogen that mulberry powdery mildew can be determined substantially is the fungi of single category.
In mulberry powdery mildew be it is a kind of can be continued until from spring winter produce sexual generation cleistocarp disease, in the whole nation
There is generation in major mulberry fields, and symptom is that vacuum side of blade has the white scab of bulk.But, in the presence of blade shows scab,
It has been not useable for production and application.Therefore, the early detection of powdery mildew and prevention have important practical significance in mulberry.
The content of the invention
The technical problem to be solved in the present invention is to overcome the early detection of powdery mildew and the defect of prevention technique in existing mulberry
With deficiency pathogen in blade can be detected there is provided one kind before mulberry leaf do not show obvious scab, disease large-scale outbreak
In the presence of and content, and then mulberry field blade etc. is handled accordingly.Specifically with powdery mildew pathogenic bacteria --- Sang Sheng ball pin shells
The upper ITS1 of rDNA design the specific detection primer of mulberry Femoral pseudoaneurysm to ITS2 target genes；Specific detection primer can be with sick leaf, bacterium
The STb gene of the extractions such as filament, scab blade, soil, branch is template, and testing result is reliable, easy to operation (simply soon
Speed), high specificity, sensitivity it is high, available for the quick detection of mulberry Femoral pseudoaneurysm, especially infect in early detection and soil,
The quick detection of pathogen on branch.
It is an object of the invention to provide a kind of Sang Sheng ball pin shells Phyllactinia moricola ITS sector sequences.
Another object of the present invention is to provide the ITS sector sequences of the Sang Sheng ball pin shells Phyllactinia moricola
Application in Sang Sheng ball pin shell Molecular Detections.
Still a further object of the present invention is to provide one group of Sang Sheng ball pin shells specific detection primer and detection kit.
Above-mentioned purpose of the present invention is achieved through the following technical solutions：
A kind of Sang Sheng ball pin shells Phyllactinia moricola ITS sector sequences, it is characterised in that nucleotides sequence
Row are as shown in SEQ ID NO.1.
The ITS sector sequences of the Sang Sheng ball pin shells Phyllactinia moricola are in Sang Sheng ball pin shell Molecular Detections
In application, and the application in Sang Sheng ball pin shell Molecular Detection reagents are prepared all should be within protection scope of the present invention.
Based on research experiment and specific aim analysis and summary of the present inventor to Sang Sheng ball pin shell ITS sector sequences, selection should
Sector sequence designs three groups of Sang Sheng ball pin shell specific detection primers as the target gene of detection, as follows respectively：
One group of Sang Sheng ball pin shell specific detection primer, including sense primer 1B1877F and anti-sense primer 1B2291R, core
Nucleotide sequence is respectively as shown in SEQ ID NO.2 and SEQ ID NO.3.
One group of Sang Sheng ball pin shell specific detection primer, including sense primer 2B1802F and anti-sense primer 2B2303R, core
Nucleotide sequence is respectively as shown in SEQ ID NO.4 and SEQ ID NO.5.
One group of Sang Sheng ball pin shell specific detection primer, including sense primer 3B1808F and anti-sense primer 3B2347R, core
Nucleotide sequence is respectively as shown in SEQ ID NO.6 and SEQ ID NO.7.
The primer is sensitive, quick, specific height, and Sang Sheng ball pin shell bacterium can be effectively examined according to this primer, especially right
The detection of early stage and the quick detection of nosema bombycis in silkworm seed are infected, is had great importance.Wherein, primer sets
2B1802F and 2B2303R are optimal.
Therefore, application of the above-mentioned Sang Sheng ball pin shells specific detection primer in Sang Sheng ball pin shell Molecular Detections or preparing
Application in Sang Sheng ball pin shell Molecular Detection products, all should be within protection scope of the present invention.
A kind of Sang Sheng ball pin shells specific detection agents box, including Sang Sheng ball pin shells specific detection described in any of the above-described group
Primer.
Preferably, described kit also includes reagent needed for reagent needed for DNA is extracted or pcr amplification reaction.
Preferably, the application method of the kit is as follows：It is special using Sang Sheng ball pin shells using sample to be tested DNA as template
Different in nature detection primer enters performing PCR reaction, and reaction terminates rear detected through gel electrophoresis amplified production, according to the size of amplification of DNA fragments
Result of determination.
Wherein, sample to be tested can be a variety of samples such as mulberry leaf, mycelium, soil, branch.
Preferably, the reaction system of the PCR reactions is：
Wherein, the component of 2 × reaction buffer is Taq archaeal dna polymerases, 160mM Tris-HCl, 40mM (NH4)2SO4,
3.0mM MgCl2, 400 μM of dNTP；
Preferably, the program of the PCR reactions is：94℃5min；94 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 32 are followed
Ring；72℃10min.
The invention has the advantages that：
Devised specifically present invention obtains the rDNA of Sang Sheng ball pin shells ITS full length sequences, and according to this ITS section
Property, the primer sets of the preferable quick detection Sang Sheng ball pin shells of sensitivity, the primer can be used for mulberry powdery mildew PCR detect, can
Whether judgement sample contains Sang Sheng ball pin shells exactly, and can provide guarantee with the utilization of resources for the health production of mulberry leaf.
In addition, primer of the present invention and related reagent can be assembled into kit, it is easy to use.And applicable PCR amplification moulds
Plate is very various, applied widely, can be the DNA of several samples, and sick leaf, mycelium, scab blade, soil, branch etc. is carried
The STb gene taken is template, considerably increases the scope of detection object.
Importantly, the present invention specific detection primer and kit can pathogen infection early stage just can be special
Property detect, the early detection for the dirty leaf disease of mulberry provides a kind of simple and quick method.
Brief description of the drawings
Fig. 1 is that primer 1B1877F/1B2291R is used for the detection of Sang Sheng ball pin shells.Note：M：TaKaRa
DL1000Marker；Primer sets are 1B1877F/1B2291R；Swimming lane 1-14 DNA masterplates are respectively：1 is Cladosporium
Belong to (branch spore is mould)；2 be Penicillium verruculosum (penicillium verruculosum)；3 be Aspergillus category (aspergillus)；4 are
Lecanicillium psalliotae (knife spore Verticillium dahliae)；5 be Phanerina mellea (honey color wax bacterium)；6 are
.Schizophyllum commune (schizophyllum commune)；7 be Candida mucifera (Candida)；8 be Lasiodiplodia
Theobromae (mulberry Pathogens Causing Root Rot Disease)；9 be that the sick leaf of the dirty leaf disease of mulberry extracts DNA；10 be powdery mildew scab mycelium in mulberry；11
For Ciboria carunculoides (mulberry sclerotiniose pathogen-caruncula shape cup cup fungi)；12 be mulberry powdery mildew pathogen DNA (sun
Property control)；13 be mulberry tree DNA (negative control)；14 water (blank control).
Fig. 2 is detections of the primer 2 B1802F/2B2303R for Sang Sheng ball pin shells.Note：M：TaKaRa
DL1000Marker；Primer sets are 2B18032F/2B2303R；Swimming lane 1-14 DNA masterplates are respectively：1 is Cladosporium
Belong to (branch spore is mould)；2 be Penicillium verruculosum (penicillium verruculosum)；3 be Aspergillus category (aspergillus)；4 are
Lecanicillium psalliotae (knife spore Verticillium dahliae)；5 be Phanerina mellea (honey color wax bacterium)；6 are
.Schizophyllum commune (schizophyllum commune)；7 be Candida mucifera (Candida)；8 be Lasiodiplodia
Theobromae (mulberry Pathogens Causing Root Rot Disease)；9 be that the sick leaf of the dirty leaf disease of mulberry extracts DNA；10 be powdery mildew scab mycelium in mulberry；11
For Ciboria carunculoides (mulberry sclerotiniose pathogen-caruncula shape cup cup fungi)；12 be mulberry powdery mildew pathogen DNA (sun
Property control)；13 be mulberry tree DNA (negative control)；14 water (blank control).
Fig. 3 is detections of the primer 3B1808F/3B2347R for Sang Sheng ball pin shells.Note：M：TaKaRa
DL1000Marker；Primer sets are 3B1808F/3B2347R；Swimming lane 1-14 DNA masterplates are respectively：1 is Cladosporium
Belong to (branch spore is mould)；2 be Penicillium verruculosum (penicillium verruculosum)；3 be Aspergillus category (aspergillus)；4 are
Lecanicillium psalliotae (knife spore Verticillium dahliae)；5 be Phanerina mellea (honey color wax bacterium)；6 are
.Schizophyllum commune (schizophyllum commune)；7 be Candida mucifera (Candida)；8 be Lasiodiplodia
Theobromae (mulberry Pathogens Causing Root Rot Disease)；9 be that the sick leaf of the dirty leaf disease of mulberry extracts DNA；10 be powdery mildew scab mycelium in mulberry；11
For Ciboria carunculoides (mulberry sclerotiniose pathogen-caruncula shape cup cup fungi)；12 be mulberry powdery mildew pathogen DNA (sun
Property control)；13 be mulberry tree DNA (negative control)；14 water (blank control).
Fig. 4 is special primer 1B1877F/1B2291R sensitivity test.Note：M：TaKaRa DL1000Marker；Swimming
Road 1-6 is sensitivity testses；Swimming lane 1-6 is the pathogen DNA of gradient dilution；Concentration is respectively：1 is 10ng/ μ L；2 are
1ng/μL；3 be 1 × 10-1ng/μL；4 be 1 × 10-2ng/μL；5 be 1 × 10-3ng/μL；6 be 1 × 10-4ng/μL。
Fig. 5 is special primer 2B1802F/2B2303R sensitivity test.Note：M：TaKaRa DL1000Marker；Swimming
Road 1-6 is sensitivity testses；Swimming lane 1-6 is the pathogen DNA of gradient dilution；Concentration is respectively：1 is 10ng/ μ L；2 are
1ng/μL；3 be 1 × 10-1ng/μL；4 be 1 × 10-2ng/μL；5 be 1 × 10-3ng/μL；6 be 1 × 10-4ng/μL。
Fig. 6 is special primer 3B1808F/3B2347R sensitivity test.Note：M：TaKaRa DL1000Marker；Swimming
Road 1-6 is sensitivity testses；Swimming lane 1-6 is the pathogen DNA of gradient dilution；Concentration is respectively：1 is 10ng/ μ L；2 are
1ng/μL；3 be 1 × 10-1ng/μL；4 be 1 × 10-2ng/μL；5 be 1 × 10-3ng/μL；6 be 1 × 10-4ng/μL。
Fig. 7 is the ITS sections that fungi universal primer expands mulberry powdery mildew pathogen DNA.Note：M:Takara
DL5000Marker；Swimming lane 1. primer I TS1 and ITS4；Swimming lane 2. primer I TS4 and ITS5.
Fig. 8 is detections of the 2B1802F/2B2303R for Sang Sheng ball pin shells.Note：M：TaKaRa
DL2000Marker；Primer sets are 2B18032F/2B2303R；Swimming lane 1-14 DNA masterplates are respectively：1.2 be mulberry tree DNA；
3.4 be the sick leaf DNA of the dirty leaf disease of mulberry；5.6 be mulberry sclerotiniose disease fruit DNA；7.8 be the sick leaf DNA of mulberry powdery mildew；9.10 be dirty leaf disease
Mulberry branch；11,12 be the soil in the dirty leaf disease breaking-out area of mulberry；13 be positive control (Powdery Mildew filament DNA)；14 be negative right
According to (pseudomonas aeruginosa, bacterium)；15 be blank control (water).
Embodiment
The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention
Limit in any form.Unless stated otherwise, the reagent of the invention used, method and apparatus routinely try for the art
Agent, method and apparatus.
Unless stated otherwise, following examples agents useful for same and material are purchased in market.
The rDNA of the Sang Sheng ball pin shells of embodiment 1 ITS full length sequences are obtained
1st, using the method for high-flux sequence, mulberry powdery mildew pathogen is obtained --- the rDNA of Sang Sheng ball pin shells ITS
Total length, as shown in SEQ ID NO.1.
2nd, according to the multiple confirmation of sequencing result, rDNA sequences complete to Sang Sheng ball pin shells are annotated, as shown in table 1,
Determine each constant gene segment Cs of rDNA of Sang Sheng ball pin shells and the nucleotide sequence of transcribed spacer (ITS) and its position on rDNA
Put, ITS sections are ITS1,5.8S rRNA, ITS2, length is 1801 to 2340.
The full rDNA Sequence annotations of the Sang Sheng ball pin shells of table 1
The design of the detection primer of embodiment 2 and the foundation of PCR amplification method
1st, design of primers
On the basis of mulberry ball pin shell bacterium rDNA sequence ITS section total lengths are obtained, using NCBI Primer Blast softwares
Design, devises multipair primer, is detected by substantial amounts of specificity and sensitivity, finally have chosen 3 pairs of representational primers
Group, primer sequence is as follows：
1B1877F/1B2291R primer sets
Sense primer 1B1877F (SEQ ID NO.2)：5’CTCCCACCCGTGTCGATAAA3’
Anti-sense primer 1B2291R (SEQ ID NO.3)：5’GACTACACGGAGAGCACCAC 3’
2B1802F/2B2303R primer sets
Sense primer 2B1802F (SEQ ID NO.4)：5’-TGAGCGTGAAGACTCTCGGT-3’
Anti-sense primer 2B2303R (SEQ ID NO.5)：5’-TCGCGAGAACGTGACTACAC-3’
3B1808F/3B2347R primer sets
Sense primer 3B1808F (SEQ ID NO.6)：5’-TGAAGACTCTCGGTCCCCC-3’
Anti-sense primer 3B2347R (SEQ ID NO.7)：5’-ACAGACGCACAGGTTGTCTT-3’
2nd, the foundation of PCR amplification method
Using sick leaf, branch, soil STb gene as template, with the primer described in embodiment 1 enter performing PCR expand.
The PCR reaction systems (the μ L of cumulative volume 20)：
Wherein, 2 × Taq Master Mix (reaction buffer) component is Taq archaeal dna polymerases, 160mM Tris-
HCl, 40mM (NH4)2SO4, 3.0mM MgCl2, 400 μM of dNTP.
PCR reaction program be：94℃5min；94 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 30 circulations；72℃10min.
3rd, result judges
Pair of primers 1B1877F/1B2291R：PCR reactions terminate laggard row agarose gel electrophoresis, according to whether expanding
Increase the DNA fragmentation judgement to 415bp.When 415bp DNA fragmentation product can be amplified, you can there is Sang Qiuzhen in judgement sample
Shell bacterium.
Second couple of primer 2 B1802F/2B2303R：PCR reactions terminate laggard row agarose gel electrophoresis, according to whether expanding
The DNA fragmentation increased to 502bp judges whether exist in sample containing mulberry ball pin shell bacterium.When can specifically amplify 502bp's
DNA fragmentation product, you can there is mulberry ball pin shell bacterium in judgement sample.
3rd couple of primer 3B1808F/3B2347R：PCR reactions terminate laggard row agarose gel electrophoresis, according to whether expanding
The DNA fragmentation increased to 540bp judges whether exist in sample containing mulberry ball pin shell bacterium.When can specifically amplify 540bp's
DNA fragmentation product, you can whether exist in judgement sample containing mulberry ball pin shell bacterium.
The primer specificity of embodiment 3 is detected
1st, fungi and bacterium respectively to be separated in a variety of scab mycelium from powdery mildew, and be all that mulberry tree cause of disease is true
The dirty leaf disease pathogen (Pseudocercospora mori) of the mulberry of bacterium and mulberry sclerotiniose pathogen (Ciboria
Carunculoides) as a control group, performing PCR amplification is entered in the method for embodiment 2, amplification terminates rear agarose gel electrophoresis
Testing result.
2nd, primer 1B1877F/1B2291R amplification is distinguished as shown in Figure 1.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (415bp).
3rd, primer 2 B1802F/2B2303R amplification is distinguished as shown in Figure 2.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (502bp).
4th, primer 3B1808F/3B2347R amplification is distinguished as shown in Figure 3.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (540bp).
As a result show, primer 1B1877F/1B2291R, 2B1802F/2B2303R, 3B1808F/3B2347R can be special
The different presence for detecting mulberry ball pin shell bacterium.And be of moderate size according to test strip, primer specificity (specific band etc. nothing but)
Principle, primer 2 B1802F/2B2303R and the PCR method set up can preferably be used for the quick detection of mulberry Femoral pseudoaneurysm.
The primer sensitivity of embodiment 4 is detected
1st, the DNA of mulberry Femoral pseudoaneurysm is extracted, original concentration is 10ng/ μ L.
Above-mentioned DNA is diluted with 1 × TE, 10,10 are diluted respectively2、103、104、105、106Times.Obtain using DNA
Concentration gradient is 10,1,1.0 × 10-1、1.0×10-2、1.0×10-3、1.0×10-4ng/μL。
2nd, the DNA using above-mentioned each concentration with primer, performing PCR amplification is entered in the method for embodiment 2, amplification terminates as template
Agarose gel electrophoresis testing result afterwards.
3rd, the amplification of 1B1877F/1B2291R primers is distinguished as shown in Figure 4.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (415bp), and detection DNA concentration is up to 1.0 × 10-3ng/μL。
4th, the amplification of 2B1802F/2B2303R primers is distinguished as shown in Figure 5.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (502bp), and detection DNA concentration is up to 1.0 × 10-3ng/μL。
5th, the amplification of 3B1808F/3B2347R primers is distinguished as shown in Figure 6.As a result show, only the dirty leaf disease of mulberry
Pathogen DNA has band at target location (540bp), and detection DNA concentration is up to 1.0 × 10-2ng/μL。
Therefore, in summary, from the point of view of specificity and sensitivity, primer 2 B1802F/2B2303R can either be special
The detection mulberry Femoral pseudoaneurysm of the opposite sex, has good detection sensitivity again.
Following examples are further tested primer 2 B1802F/2B2303R detection applicability and sensitivity.
The detection of pathogens of the mulberry leaf and ill mulberry leaf of the infection mulberry ball pin shell of embodiment 5
1st, material is selected
The experiment material of selection, includes the branch in ill mulberry field, with disease-free fresh paper slip；Returning in sense experiment mesophyll has bacterium
The blade of silk growth, and the material such as the blade with scab.
2nd, the material Genome DNA extraction comprising mulberry tree composition
Use ancient cooking vessel state plant genome DNA extracts kit (LOT：69700110) DNA extraction is carried out, step is as follows：
Choose and contain plant tissue materials, be fully ground using liquid nitrogen to powder；Add 800 μ L's in 1.5mL centrifuge tubes
Lysis Buffer, and beta -mercaptoethanol is added to final concentration 0.1%；The powder sample added after liquid nitrogen grinding, 65 DEG C of constant temperature
Metal bath 30 minutes to 2 hours；First mixed 5 minutes using 500 μ L phenol/chloroform/isoamyl alcohol vibration, rear 12000r/min centrifugations 10
Minute, take supernatant；500 μ L chloroforms are added, vibration is mixed 5 minutes, and rear 12000r/min is centrifuged 10 minutes, takes supernatant；Add 700
μ L Binding Buffer, are mixed；Mixed liquor is drawn in centrifugal column, 12000r/min is centrifuged 1 minute, abandons filtrate；Add
700 μ L Washing Buffer A, 12000r/min centrifugation 1 minute, abandons filtrate；Add 700 μ L Washing Buffer
B, 12000r/min are centrifuged 1 minute, abandon filtrate；500 μ L Washing Buffer B, 12000r/min is added, 1 point is centrifuged
Clock, abandons filtrate；12000r/min is centrifuged 2 minutes again, is abandoned filtrate and is abandoned collecting pipe；Centrifugal column is fitted into 1.5mL centrifuge tubes, plus
Enter 50 μ L TE Buffer, room temperature is placed 3 minutes, and 12000r/min is centrifuged 2 minutes；Repeat previous step, that is, obtain purity compared with
High STb gene.
3rd, PCR is detected
Using the STb gene of sick leaf as template, enter performing PCR with the primer described in embodiment 1 and expand.Control group using mulberry field other
Disease material
The PCR reaction systems (the μ L of cumulative volume 20)：
Wherein, 2 × Taq Master Mix (reaction buffer) component is Taq archaeal dna polymerases, 160mM Tris-
HCl, 40mM (NH4)2SO4, 3.0mM MgCl2, 400 μM of dNTP.
PCR reaction program be：94℃5min；94 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 30 circulations；72℃10min.
4th, result
First with existing fungi universal primer to ITS1 and ITS4, and primer pair ITS4 and ITS5, to extraction
Sick leaf STb gene verified, as a result as shown in Figure 7, it is known that DNA of more than two kinds is included in STb gene.
Related mulberry tree disease material is detected using primer 2 B1802F/2B2303R, as a result as shown in figure 8, table
The band for the 502bp sizes being consistent with positive control size is can detect in the sick leaf of bright mulberry powdery mildew.
SEQUENCE LISTING
<110>Agricultural University Of South China
<120>Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections
<130>
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 540
<212> DNA
<213>Sang Sheng ball pin shell Phyllactinia moricola ITS sequence
<400> 1
ctgagcgtga agactctcgg tcccccgccc cattggtgca agccagtgcg aggggggagc 60
atggccggag tcgaccctcc cacccgtgtc gataaaaacg tctgttgctt tggtaggccg 120
gggcccgcct ggcggatccc gctggccttt gatggctgga gcgtgcctgc cagagaaagt 180
tggacaactc gtgtgattga tgaagtctga gcaaccaagt gggaaattag ttaaaacttt 240
caacaacgga tctcttggct ctggcatcga tgaagaacgc agcgaaatgc gataagtaat 300
gtgaattgca gaatctagtg aatcatcgaa tctttgaacg cacattgcgc cccttggtat 360
tccgaggggc atgcctgttc gagcgtcaaa acaacccctc aagtcgctct ggcttggtct 420
tggggcccgc ccgcgacagc gtggcggccc ttaaatctag tggcggtgcc ggtggtgctc 480
tccgtgtagt cacgttctcg cgacagggca gcactggacc cagccaaaag acaacctgtg 540
<210> 2
<211> 20
<212> DNA
<213>Sense primer 1B1877F
<400> 2
ctcccacccg tgtcgataaa 20
<210> 3
<211> 20
<212> DNA
<213>Anti-sense primer 1B2291R
<400> 3
gactacacgg agagcaccac 20
<210> 4
<211> 20
<212> DNA
<213>Sense primer 2B1802F
<400> 4
tgagcgtgaa gactctcggt 20
<210> 5
<211> 20
<212> DNA
<213>Anti-sense primer 2B2303R
<400> 5
tcgcgagaac gtgactacac 20
<210> 6
<211> 19
<212> DNA
<213>Sense primer 3B1808F
<400> 6
tgaagactct cggtccccc 19
<210> 7
<211> 20
<212> DNA
<213>Anti-sense primer 3B2347R
<400> 7
acagacgcac aggttgtctt 20
Claims (10)
1. a kind of Sang Sheng ball pin shellsPhyllactinia moricolaITS sector sequences, it is characterised in that nucleotide sequence
As shown in SEQ ID NO.1.
2. Sang Sheng ball pin shells described in claim 1Phyllactinia moricolaITS sector sequences in Sang Sheng ball pin shells
Application in Molecular Detection.
3. Sang Sheng ball pin shells described in claim 1Phyllactinia moricolaITS sector sequences prepare Sang Shengqiu
Application in pin shell Molecular Detection reagent.
4. one group of Sang Sheng ball pin shell specific detection primer, it is characterised in that including sense primer 1B1877F and anti-sense primer
1B2291R, nucleotide sequence is respectively as shown in SEQ ID NO.2 and SEQ ID NO.3.
5. one group of Sang Sheng ball pin shell specific detection primer, it is characterised in that including sense primer 2B1802F and anti-sense primer
2B2303R, nucleotide sequence is respectively as shown in SEQ ID NO.4 and SEQ ID NO.5.
6. one group of Sang Sheng ball pin shell specific detection primer, it is characterised in that including sense primer 3B1808F and anti-sense primer
3B2347R, nucleotide sequence is respectively as shown in SEQ ID NO.6 and SEQ ID NO.7.
7. any Sang Sheng ball pin shells specific detection primer of claim 4,5,6 answering in Sang Sheng ball pin shell Molecular Detections
With or preparing application in Sang Sheng ball pin shell Molecular Detection products.
8. a kind of Sang Sheng ball pin shells specific detection agents box, it is characterised in that including claim 4, claim 5 and/or
Sang Sheng ball pin shells specific detection primer described in claim 6.
9. kit according to claim 8, it is characterised in that reagent or pcr amplification reaction needed for also being extracted including DNA
Required reagent.
10. kit according to claim 8, it is characterised in that the application method of the kit is as follows：To treat test sample
This DNA is template, and performing PCR reaction is entered using Sang Sheng ball pin shell specific detection primers, and reaction terminates rear detected through gel electrophoresis and expanded
Increase production thing, according to the size result of determination of amplification of DNA fragments；
The reaction system of PCR reaction is：
The μ L of 2 × reaction buffer 10
10 μM of μ L of sense primer 2B1802F 0.5
10 μM of μ L of anti-sense primer 2B2303R 0.5
The μ L of template DNA 1
ddH2O is mended to 20 μ L；
Wherein, the component of 2 × reaction buffer isTaqArchaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH4)2SO4, 3.0
mM MgCl2, 400 μM of dNTP；
The program of PCR reaction is：94℃ 5 min；94 DEG C of 30 s, 57 DEG C of 30 s, 72 DEG C of 1min, 32 circulations；72
℃ 10 min。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340558.8A CN107034284A (en) | 2017-05-15 | 2017-05-15 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710340558.8A CN107034284A (en) | 2017-05-15 | 2017-05-15 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107034284A true CN107034284A (en) | 2017-08-11 |
Family
ID=59537575
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710340558.8A Pending CN107034284A (en) | 2017-05-15 | 2017-05-15 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107034284A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498509A (en) * | 2014-12-11 | 2015-04-08 | 华南农业大学 | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection |
| CN104498599A (en) * | 2014-12-11 | 2015-04-08 | 华南农业大学 | Microsporidium molecule universal detection primers and kit thereof |
| CN106222291A (en) * | 2016-08-19 | 2016-12-14 | 福建农林大学 | A kind of Molecular Detection and the test kit identifying the Caulis Sacchari sinensis different strain of red streak bacterium |
| CN106801053A (en) * | 2017-01-24 | 2017-06-06 | 华南农业大学 | The ribosomal RNA sequences of mulberry tree powdery mildew pathogenic bacteria Phyllactinia mori and its application |
-
2017
- 2017-05-15 CN CN201710340558.8A patent/CN107034284A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498509A (en) * | 2014-12-11 | 2015-04-08 | 华南农业大学 | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection |
| CN104498599A (en) * | 2014-12-11 | 2015-04-08 | 华南农业大学 | Microsporidium molecule universal detection primers and kit thereof |
| CN106222291A (en) * | 2016-08-19 | 2016-12-14 | 福建农林大学 | A kind of Molecular Detection and the test kit identifying the Caulis Sacchari sinensis different strain of red streak bacterium |
| CN106801053A (en) * | 2017-01-24 | 2017-06-06 | 华南农业大学 | The ribosomal RNA sequences of mulberry tree powdery mildew pathogenic bacteria Phyllactinia mori and its application |
Non-Patent Citations (2)
| Title |
|---|
| TAKAMATSU S.等: "Phyllactinia moricola genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2，28S rRNA, partial and complete sequence, isolate: SMK17215", 《GENBANK》 * |
| 洪秀华等: "《临床微生物学检验》", 31 August 2015, 中国医药科技出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ioos et al. | Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction using dual-labeled probe chemistry | |
| Chilvers et al. | A real-time, quantitative PCR seed assay for Botrytis spp. that cause neck rot of onion | |
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN105063219B (en) | Guava anthrax bacteria specific PCR detection primer and its detection method | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| CN107119048A (en) | Mulberry Femoral pseudoaneurysm rDNA and its application in mulberry Femoral pseudoaneurysm Molecular Detection | |
| CN104498599A (en) | Microsporidium molecule universal detection primers and kit thereof | |
| CN104593504B (en) | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci | |
| CN105063226B (en) | The specific PCR detection primer and its detection method of tack anthrax-bacilus in Fresh edible soybean | |
| Keriö et al. | Safe DNA-extraction protocol suitable for studying tree-fungus interactions | |
| Gomes et al. | Mycosphaerella musicola identified as the only pathogen of the sigatoka disease complex present in Minas Gerais State, Brazil | |
| Fernandez-Molina et al. | Rapid and specific detection of section Fumigati and Aspergillus fumigatus in human samples using a new multiplex real-time PCR | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| Madihah et al. | Comparison of DNA extraction and detection of Ganoderma, causal of basal stem rot disease in oil palm using loop-mediated isothermal amplification | |
| CN107034284A (en) | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections | |
| JP6413122B2 (en) | Mushroom identification method and identification kit | |
| CN104120170B (en) | Target bacterium detection kit and detection method | |
| CN100392103C (en) | Molecular detection method for Fusarium circinatum | |
| CN106434879B (en) | Rapidly and efficiently detect the method for Cordyceps militaris different strain mating type | |
| CN104498509B (en) | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection | |
| CN105039560B (en) | A kind of lichee anthrax-bacilus LAMP primer and its quick determination method and application | |
| Tiago et al. | Polymorphism in Metarhizium anisopliae var. anisopliae (Hypocreales: Clavicipitaceae) based on internal transcribed spacer-RFLP, ISSR and intron markers | |
| CN106701970A (en) | Molecular biological method for identifying three Botryosphaeria on apples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170811 |
|
| RJ01 | Rejection of invention patent application after publication |