CN104498509A - HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection - Google Patents
HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection Download PDFInfo
- Publication number
- CN104498509A CN104498509A CN201410755670.4A CN201410755670A CN104498509A CN 104498509 A CN104498509 A CN 104498509A CN 201410755670 A CN201410755670 A CN 201410755670A CN 104498509 A CN104498509 A CN 104498509A
- Authority
- CN
- China
- Prior art keywords
- hmg1
- primer
- silkworm
- dna
- nosema bombycis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a silkworm microsporidia HMG1 gene as well as a specific primer set used for rapidly detecting silkworm microsporidia and application thereof. The primer set comprises an upstream primer HMG1-s and a downstream primer HMG1-sR, wherein a nucleotide sequence of the upstream primer is shown in SEQ ID No.5, and a nucleotide sequence of the lower primer is shown in SEQ ID NO.6. A target gene of the detection primer is a high mobility protein gene HMG1 related to sex of the silkworm microsporidia, when the high mobility protein gene HMG1 is taken as the target gene for a silkworm tissue, especially silkworm egg microsporidia molecular detection, the characteristics of reliable detection result, easy operation, strong specificity and high sensitivity can be realized, and the high mobility protein gene HMG1 can be applied to high-sensitivity and rapid silkworm microsporidia molecular detection, especially early detection of the silkworm microsporidia, and has great significance in practical application.
Description
Technical field
The invention belongs to entomopathogen field of molecular detection.More specifically, relate to
hMG1gene and the application in nosema bombycis Molecular Detection thereof.
Background technology
The research of pebrine disease (having another name called From Nosema bombycis parasitosis) starts from the popular pebrine in the whole nation occurring in France for 1845, pasteur determines that " particulate " that he observes is the causative factor of pebrine, and Balbiani determined that it is nosema bombycis afterwards
nosema bombycis(J.V. Maddox etc., 2000).Nosema bombycis has horizontal transmission and vertical transmission two kinds of route of infection, wherein vertical transmission is produced the silkworm egg in sericultural production and is caused huge harm, very large negative impact is brought to raw cocoon production cocoon yield and quality simultaneously, have a strong impact on silk industry chain downstream expanding economy (Cai Shunfeng etc., 2011).Since the national pebrine outburst of France, nosema bombycis is the important detected object of various countries' silkworm egg production and foreign trade all the time.19 end of the centurys, in the period that Japanese sericulture is the most flourishing, " female moth Microscopical Method For Detection ", " flacherie preventive treatment " were once written into constitution (Takeshi Kawarabata, 2003), China is also classified as Imported and exported animals and is quarantined two class epidemic diseases ［ " People's Republic of China (PRC) enter the territory animal one, two class transmissible disease, parasitosis register ", No. 12nd, (1992) agriculture (quarantine) word ］.
Initial people differentiate that nosema bombycis mainly carries out visual inspection according to the characteristics of incidence of pebrine disease.After microscope invention, people carry out sediments microscope inspection according to the form of microsporidium and size, improve sensitivity and the efficiency of detection to a certain extent, and have therefore contained French pandemic pebrine, have saved the sericulture in the world.But sediments microscope inspection has obvious shortcoming, as to the technology of operator and skill requirement higher, and nosema bombycis is individual and small, conventional sediments microscope inspection detection method specificity and sensitivity lower, be difficult to distinguish microsporidium analogue, nosema bombycis particularly in silkworm seed is all generally immature spore, and ordinary optical microscope cannot be differentiated to judge at all.
Along with popularizing of round pcr, people bring into use PCR method to detect nosema bombycis and to reach higher sensitivity." molecular clock " is the effective means during molecular level analysis of biological system is evolved, SSU rRNA(16S rDNA) be conventional " molecular clock " (Pei A Y, et al., 2010) in microbial evolution research.Primer designed in the research of pebrine disease PCR detection technique for target gene majority be also SSUrRNA, the primer for other microsporidium gene design is less or sensitivity is poor, is thus seldom in the news.Baker et al(1995) and Terry et al(1999) according to the PCR primer V1f/530r of close kind microsporidium SSU rRNA high conservative region design, can differentiate that the DNA profiling of the microsporidium of multiple kind increases the special object band of about 450bp, but not there is specificity to nosema bombycis, and the present inventor studies discovery, this primer is used to detect silkworm seed microsporidium, the sensitivity detected is extremely low, may there is certain restraining factors and disturb pcr amplification to nosema bombycis (N.b) DNA in hint silkworm seed extract.On the other hand, microsporidium parasitizes in silkworm seed, and silkworm seed content is apparently higher than the microsporidium that will detect, extracting in the DNA sample obtained, both DNA exist simultaneously, and Eggs of Silkworm DNA causes serious interference to detection, therefore, if want directly to carry out the detection of microsporidium with silkworm seed DNA for template, detection is had higher requirement.
Summary of the invention
The technical problem to be solved in the present invention is the deficiency overcoming existing nosema bombycis detection technique, with nosema bombycis
hMG1gene detects primer for target gene designs, this primer can with silkworm DNA/cDNA, Eggs of Silkworm DNA/cDNA or Midgut of Silkworm, Bombyx Mori DNA/cDNA etc. for template, and detected result is reliable, easy handling (simple and quick), high specificity, highly sensitive, can be used for the rapid detection of nosema bombycis, especially infect the rapid detection of nosema bombycis in early detection and silkworm seed.
The object of this invention is to provide a kind of nosema bombycis
hMG1gene.
Another object of the present invention is to provide one group with nosema bombycis
hMG1gene is target gene, the primer sets of rapid detection nosema bombycis and the application in preparation nosema bombycis detection kit thereof.
Another object of the present invention is to provide a kind of nosema bombycis detection kit.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
The invention discloses a kind of nosema bombycis
hMG1gene, its DNA full length nucleotide sequence is as shown in SEQ ID NO.1, and its cDNA full length nucleotide sequence is as shown in SEQ ID NO.2.
Present invention also offers one group with
hMG1gene is the primer sets of the rapid detection nosema bombycis of target gene, described primer sets comprises upstream primer HMG1-sF and downstream primer HMG1-sR, the nucleotide sequence of upstream primer HMG1-sF is as shown in SEQ ID NO.5, and the nucleotide sequence of downstream primer HMG1-sR is as shown in SEQ ID NO.6.
Based on the present inventor to nosema bombycis
hMG1the research experiment of gene and specific aim analysis and summary, select nosema bombycis
hMG1the target gene that gene order detects as PCR of the present invention, described primer is sensitive, quick, specificity is high, effectively can detect nosema bombycis according to this primer, especially to the rapid detection infecting nosema bombycis in early stage detection and silkworm seed, have great importance.
The present invention also provides the application of the primer sets of described rapid detection nosema bombycis in preparation nosema bombycis detection kit.Provide a kind of nosema bombycis detection kit, comprise upstream primer HMG1-sF and downstream primer HMG1-sR, the nucleotide sequence of upstream primer HMG1-sF is as shown in SEQ ID NO.5, and the nucleotide sequence of downstream primer HMG1-sR is as shown in SEQ ID NO.6.
Preferably, the using method of described test kit is as follows:
With silkworm DNA/cDNA, Eggs of Silkworm DNA/cDNA or Midgut of Silkworm, Bombyx Mori DNA/cDNA for template, utilize primer HMG1-sF and HMG1-sR to carry out PCR reaction, reaction terminates rear detected through gel electrophoresis amplified production, according to the size result of determination of amplification of DNA fragments.The standard of described result of determination is: DNA fragmentation product sepharose occurring 684 bp specifically, namely this silkworm or silkworm seed have infected nosema bombycis.
Preferably, the reaction system of described PCR reaction is:
2 × reaction buffer 10 μ L
10 μMs of primer HMG1-sF 0.5 μ L
10 μMs of primer HMG1-sR 0.5 μ L
Template DNA 1 μ L
DdH
2o mends to 20 μ L;
Wherein, the component of 2 × reaction buffer is Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
Preferably, the program of described PCR reaction is: 94 DEG C of 5 min; 94 DEG C of 30 s, 50 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
The present invention has following beneficial effect:
The present invention has cloned nosema bombycis first
hMG1dNA and the cDNA full length sequence of gene, and on this basis, design obtains the primer sets of a group-specific, the extraordinary rapid detection nosema bombycis of susceptibility, the PCR that this primer can be used for From Nosema bombycis parasitosis detects, can exactly judgement sample whether containing nosema bombycis, and can be silkworm egg produce in the detection of " poisonous " silkworm seed (namely infecting the silkworm seed of microsporidium) and safety send out and kind to give security.
In addition, primer of the present invention and related reagent can be assembled into test kit, easy to use.And the pcr amplification template be suitable for is very various, applied widely, if pcr template can be silkworm DNA/cDNA, Eggs of Silkworm DNA/cDNA, Midgut of Silkworm, Bombyx Mori DNA/cDNA etc., considerably increases the scope of detected object.
Importantly, detection primer of the present invention and test kit can infect nosema bombycis and just can specificly detect in early days, and can directly with silkworm seed DNA for template carries out the rapid detection of nosema bombycis, the early detection for From Nosema bombycis parasitosis provides a kind of simple and quick method.
Accompanying drawing explanation
Fig. 1 is the detected result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 2 is the detected result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 3 is the detected result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 4 is the specific detection result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 5 is the specific detection result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 6 is the specific detection result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 7 is the susceptibility detected result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Fig. 8 is the susceptibility detected result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Fig. 9 is the susceptibility detected result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Embodiment
Further illustrate the present invention below in conjunction with Figure of description and specific embodiment, but embodiment does not limit in any form to the present invention.Unless stated otherwise, the present invention adopts reagent, method and apparatus are the art conventional reagent, method and apparatus.
Unless stated otherwise, following examples agents useful for same and material are commercial.
embodiment 1 nosema bombycis
hMG 1gene
1, according to the method for DNA homolog clone in molecular biological gene clone technology, clone obtains nosema bombycis
hMG 1cDNA and the DNA full length sequence of gene.
2, the acquisition of cDNA total length, concrete grammar is as follows:
(1) use Primer premier 5.0 software, in conjunction with comprehensively analyzing, devise primer HMG1F/ HMG1R, sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.4.
Upstream primer HMG1F(SEQ ID NO.3):
5’ ATGACTGCTCAAAAAGACGATAC 3’
Downstream primer HMG1R(SEQ ID NO.4):
5’ TTATTCATCACTATCTCCTACTTCT 3’。
(2) with the nosema bombycis of purifying (N.b) spore DNA for template, carry out pcr amplification with primer HMG1F/ HMG1R.
(3) PCR primer is through purifying, is connected in pMD19T, and is transformed into E, cultivates in coli DH-5 α.
(4) extract recombinant plasmid, and check order, obtain
hMG1the cDNA total length of gene, as shown in SEQ ID NO.2.
3, the acquisition of DNA total length
Utilize the method for genome high-flux sequence, and through a large amount of predictive genes comparative analyses, finally by PCR sequence verification, obtain nosema bombycis
hMG 1the DNA full length sequence of gene, as shown in SEQ ID NO.1.
4, according to the repeatedly confirmation of sequencing result, nosema bombycis is drawn
hMG 1the DNA full length sequence of gene, as shown in SEQ ID NO.1, its cDNA full length nucleotide sequence is as shown in SEQ ID NO.2.
embodiment 2 detects the foundation of design of primers and PCR amplification method
1, design of primers
Acquisition nosema bombycis
hMG 1on the basis of gene, application Primer premier 5.0 software design, is devised multipair primer, is detected, finally have chosen 3 pairs of representational primer sets of primer by a large amount of resistance, specificity and susceptibility, and each group primer sequence is as follows:
(1) first is right:
Upstream primer HMG1F(SEQ ID NO.3):
5’ ATGACTGCTCAAAAAGACGATAC 3’
Downstream primer HMG1R(SEQ ID NO.4):
5’ TTATTCATCACTATCTCCTACTTCT 3’。
(2) second is right:
Upstream primer HMG1-sF(SEQ ID NO.5):
TTCCGAAATAATCTTCTTTTAATTG
Downstream primer HMG1-sR(SEQ ID NO.6):
TTGTGCACCGAATCGTAAATAG
(3) the 3rd is right:
Upstream primer HMG1-xF(SEQ ID NO.7):
TCCCTAGGAACTTTTAAAGAGAAG
Downstream primer HMG1-xR(SEQ ID NO.8):
TCCTTTTATTCATCACTATCTCCT
2, the foundation of PCR amplification method
(1) extraction of the STb gene of silkworm or Eggs of Silkworm
Adopt the little extraction reagent kit of DNA of plants (DNeasy Plant mini kit test kit) the extracting silkworm seed genomic dna that QIAGEN company produces, step following (carrying out to specifications):
Get 20 silkworm seeds and put into mortar, liquid nitrogen fully grinds, by the powder collection after grinding in the centrifuge tube of 1.5mL.Add 400 μ L lysis buffer AP1 and 4 μ L Rnase A, vortex mixing (400 μ L lysis buffer AP1 and 4 μ L Rnase A do not mix before use); Solution after mixing, 65 DEG C, turn upside down during hatching 10 min(test tube 2 ~ 3 times); Add 130 μ L buffer A P2, ice bath 5 min after mixing; Then 14,000 rpm, centrifugal 5 min; Draw the collection tube of supernatant in Filter column (QIAshredder spin column), 14,000rpm, centrifugal 2min; Supernatant liquor in centrifuge tube is moved to new pipe (not stirring the residue of appearance), add the AP3/E of 1.5 times of volumes, pipettor mixes; 650 μ L mixed solutions are moved in adsorption column (DNeasy Mini spin column), 4200 rpm, centrifugal 1 min; Remaining liquid repeats this step; Adsorption column is put into new collection tube, adds 500 μ L buffer A W, 4200 rpm, centrifugal 1 min; Abandon supernatant; Add 500 μ L buffer A W again, 14000 rpm, centrifugal 2 min(ensure that collection tube does not touch bottom supernatant); Move in collection tube to 1.5 mL or 2 mL centrifuge tubes; Add 40 μ L buffer A E wash-outs, room temperature places 5 min; Centrifugal 1 min of 4200 rpm; Repeat previous step (namely add 40 μ L buffer A E wash-outs, room temperature places 5 min, centrifugal 1 min of 4200 rpm); The STb gene extracted is placed in-20 DEG C of Refrigerator stores for subsequent use.
(2) PCR amplification method
With the STb gene of silkworm or Eggs of Silkworm for template, carry out pcr amplification with three pairs of primers described in embodiment 1.
Described PCR reaction system (cumulative volume 20 μ L):
2 × Taq Master Mix(reaction buffer) 10 μ L
10 μMs of upstream primer HMG1F 0.5 μ L
10 μMs of downstream primer HMG1R 0.5 μ L
Template DNA 1 μ L;
DdH
2o mends to 20 μ L.
Wherein, 2 × Taq Master Mix(reaction buffer) component be Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
The program of PCR reaction is: 94 DEG C of 5 min; 94 DEG C of 30 s, 50 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
(3) result judges
Pair of primers HMG1F/HMG1R:PCR reacts and terminates laggard row agarose gel electrophoresis, judges whether silkworm seed sample has infected nosema bombycis according to the DNA fragmentation of 561 bp that whether increase.When the DNA fragmentation product of 561 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
The second couple of primer HMG1-sF/HMG1-sR:PCR reacts and terminates laggard row agarose gel electrophoresis, and the DNA fragmentation according to 684 bp that whether increase judges whether silkworm seed sample has infected nosema bombycis.When the DNA fragmentation product of 684 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
The 3rd couple of primer HMG1-xF/HMG1-xR:PCR reacts and terminates laggard row agarose gel electrophoresis, and the DNA fragmentation according to 251 bp that whether increase judges whether silkworm seed sample has infected nosema bombycis.When the DNA fragmentation product of 251 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
(4) get the nosema bombycis sample of 50 " poisonous " silkworm seeds (i.e. the silkworm of infected silkworm microsporidium produce silkworm seed), healthy silkworm seed and purifying respectively, extract DNA respectively, carry out pcr amplification according to above-mentioned PCR method.
Agarose gel electrophoresis detected result is respectively as shown in accompanying drawing 1 ~ 3, and the three pairs of primers all can detect specific DNA fragmentation in the nosema bombycis of " poisonous " silkworm seed and purifying, and do not detect specific fragment in healthy silkworm seed.Show that the PCR method of three pairs of primers and foundation all can well be used for the rapid detection of nosema bombycis.
embodiment 3 primer specificity detects
1, respectively with the DNA of nosema bombycis (N.b), Nosema antheraeae worm (N.a), Pyrausta nubilalis (Hubern). microsporidium (N.f) for template, with primer HMG1F/ HMG1R, HMG1-sF/ HMG1-sR, HMG1-xF/ HMG1-xR, carry out pcr amplification with the method for embodiment 2, amplification terminates rear agarose gel electrophoresis detected result.
2, the amplification of three pairs of primers is respectively as shown in accompanying drawing 4 ~ 6.Result shows, only has the detection nosema bombycis that primer HMG1-sF/ HMG1-sR energy is special, and primer HMG1F/ HMG1R and primer HMG1-xF/ HMG1-xR all can detect all microsporidiums, there is good general detection, but not there is the specificity to nosema bombycis.
embodiment 4 primer susceptibility detects
1, extract the DNA of nosema bombycis (N.b), original concentration is 5.0 ng/ μ L.
By above-mentioned N.b DNA ddH
2o dilutes, and dilutes 10 respectively
0, 10
1, 10
2, 10
3, 10
4, 10
5, 10
6doubly.Namely obtaining concentration gradient is 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6ng/ μ L.
2, with the N.b DNA of above-mentioned each concentration for template, with primer HMG1F/ HMG1R, HMG1-sF/ HMG1-sR, HMG1-xF/ HMG1-xR, carries out pcr amplification with the method for embodiment 2, amplification terminate rear agarose gel electrophoresis detected result.
3, the amplification of three pairs of primers is respectively as shown in accompanying drawing 7 ~ 9.Result shows, and primer HMG1F/ HMG1R and primer HMG1-sF/ HMG1-sR all can detect 5.0 × 10
-4the N.b DNA of ng/ μ L concentration, has good detection sensitivity.And the susceptibility of primer HMG1-xF/ HMG1-xR has differed from 1 order of magnitude, can 5.0 × 10 be detected
-3the N.b DNA of ng/ μ L concentration.
Therefore, in sum, consider from the angle of specificity and susceptibility, only have primer HMG1-sF/ HMG1-sR can either specific detection nosema bombycis, there is again good detection sensitivity, especially detect silkworm seed nosema bombycis, for silkworm egg produce in the detection of " poisonous " silkworm egg and safety send out and kind provide guarantee, whether infected in the detection application of nosema bombycis having great importance in the actual detection of nosema bombycis and early stage silkworm seed.Experimental result also shows,
hMG1gene is a molecular target well detecting nosema bombycis.
SEQUENCE LISTING
<110> Agricultural University Of South China
<120> HMG1 gene and the application in nosema bombycis Molecular Detection thereof
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 1136
<212> DNA
<213> HMG1 gene DNA sequence
<400> 1
ttccgaaata atcttctttt aattgattta aattattttt gaccttttgt gaattagatc 60
ttaaattttc atcatccttg tatttttcct gtaaaaaatc agaccatttc tttaacggtt 120
tgatttcaaa accgttttta attaaaagct tgataatttt ggttggagct tcgtaaaatt 180
ttctataatt ggcgtctttg ttcattttta aggaaggagg ggggaggggc attctataag 240
aaaaattctt ataacgggcg tcttgcatat tattatttga aataacgggc acacgaacag 300
taggataatg aaggagttta taaaaacaac cgacaaaaat attactgcct tttttaagtt 360
aaataacata cattcgggtc ttcttataag attcgtttaa atctactctt cctacctttt 420
ttgttatatt ttttcttact acgtatttgt ttcatctctt tttattaacc aatcctttta 480
ctctaattct tttactttcc ccatacacat ctttttatta cttcattcgt cattttttta 540
actgtttttc agattttttt tctcccctaa atgactgctc aaaaagacga tacggctatt 600
aagaagagac agacggccaa aaagccaaag gacaaaaatg caccaaaacc cccattaacc 660
ccctatttac gattcggtgc acaacaaagg gcagccgata aaactataac agctcttcct 720
gttgctaaac aagggaaagt tcttgctgaa atgtggagta aattaagtga tgaagcaaaa 780
aataaattta aagaagaata cactgaagag aaagcgattt atgataaaaa ttatgaagaa 840
tacaagaaga cggatgatta taaaaagtat caagaccttc ttaaatccct aggaactttt 900
aaagagaaga aaaccaaaag acaatcagct tataatgtgt attataaaga acagtacggg 960
ataatagcca gtaaaactaa aggacttgag atgaaagata taacggctat tattgtaaaa 1020
aactggaagg agattgatga accaaccaaa aagatttatg ctgaaaaagc gaaaaaagct 1080
aatgatctta ataaggaaaa taaaggagaa gtaggagata gtgatgaata aaagga 1136
<210> 2
<211> 561
<212> DNA
<213> HMG1 gene cDNA sequence
<400> 2
atgactgctc aaaaagacga tacggctatt aagaagagac agacggccaa aaagccaaag 60
gacaaaaatg caccaaaacc cccattaacc ccctatttac gattcggtgc acaacaaagg 120
gcagccgata aaactataac agctcttcct gttgctaaac aagggaaagt tcttgctgaa 180
atgtggagta aattaagtga tgaagcaaaa aataaattta aagaagaata cactgaagag 240
aaagcgattt atgataaaaa ttatgaagaa tacaagaaga cggatgatta taaaaagtat 300
caagaccttc ttaaatccct aggaactttt aaagagaaga aaaccaaaag acaatcagct 360
tataatgtgt attataaaga acagtacggg ataatagcca gtaaaactaa aggacttgag 420
atgaaagata taacggctat tattgtaaaa aactggaagg agattgatga accaaccaaa 480
aagatttatg ctgaaaaagc gaaaaaagct aatgatctta ataaggaaaa taaaggagaa 540
gtaggagata gtgatgaata a 561
<210> 3
<211> 23
<212> DNA
<213> upstream primer HMG1F
<400> 3
atgactgctc aaaaagacga tac 23
<210> 4
<211> 25
<212> DNA
<213> downstream primer HMG1R
<400> 4
ttattcatca ctatctccta cttct 25
<210> 5
<211> 25
<212> DNA
<213> upstream primer HMG1-sF
<400> 5
ttccgaaata atcttctttt aattg 25
<210> 6
<211> 22
<212> DNA
<213> downstream primer HMG1-sR
<400> 6
ttgtgcaccg aatcgtaaat ag 22
<210> 7
<211> 24
<212> DNA
<213> upstream primer HMG1-xF
<400> 7
tccctaggaa cttttaaaga gaag 24
<210> 8
<211> 24
<212> DNA
<213> downstream primer HMG1-xR
<400> 8
tccttttatt catcactatc tcct 24
Claims (8)
1. a nosema bombycis
hMG1gene, is characterized in that, its DNA full length nucleotide sequence is as shown in SEQ ID NO.1, and its cDNA full length nucleotide sequence is as shown in SEQ ID NO.2.
2. the primer sets of one group of rapid detection nosema bombycis, it is characterized in that, described primer sets comprises upstream primer HMG1-sF and downstream primer HMG1-sR, the nucleotide sequence of upstream primer HMG1-sF is as shown in SEQ ID NO.5, and the nucleotide sequence of downstream primer HMG1-sR is as shown in SEQ ID NO.6.
3. the application of primer sets in preparation nosema bombycis detection kit of rapid detection nosema bombycis described in claim 2.
4. a nosema bombycis detection kit, it is characterized in that, comprise upstream primer HMG1-sF and downstream primer HMG1-sR, the nucleotide sequence of upstream primer HMG1-sF is as shown in SEQ ID NO.5, and the nucleotide sequence of downstream primer HMG1-sR is as shown in SEQ ID NO.6.
5. test kit according to claim 4, it is characterized in that, the using method of described test kit is as follows:
With silkworm DNA/cDNA or Eggs of Silkworm DNA/cDNA for template, utilize primer HMG1-sF and HMG1-sR to carry out PCR reaction, reaction terminates rear detected through gel electrophoresis amplified production, according to the size result of determination of amplification of DNA fragments.
6. test kit according to claim 5, is characterized in that, the reaction system of described PCR reaction is:
2 × reaction buffer 10 μ L
10 μMs of primer HMG1-sF 0.5 μ L
10 μMs of primer HMG1-sR 0.5 μ L
Template DNA 1 μ L
DdH
2o mends to 20 μ L;
Wherein, the component of 2 × reaction buffer is Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
7. test kit according to claim 5, is characterized in that, the program of described PCR reaction is: 94 DEG C of 5 min; 94 DEG C of 30 s, 50 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
8. test kit according to claim 5, it is characterized in that, the standard of described result of determination is: DNA fragmentation product sepharose occurring 684 bp specifically, namely this silkworm or silkworm seed have infected nosema bombycis.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410755670.4A CN104498509B (en) | 2014-12-11 | 2014-12-11 | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection |
| US15/310,783 US10435759B2 (en) | 2014-12-11 | 2015-08-28 | HMG1 gene and uses thereof in microsporidium molecular detection |
| PCT/CN2015/088443 WO2016090965A1 (en) | 2014-12-11 | 2015-08-28 | Hmg1 gene and uses thereof in microsporidium molecular detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410755670.4A CN104498509B (en) | 2014-12-11 | 2014-12-11 | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104498509A true CN104498509A (en) | 2015-04-08 |
| CN104498509B CN104498509B (en) | 2017-04-12 |
Family
ID=52939960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410755670.4A Active CN104498509B (en) | 2014-12-11 | 2014-12-11 | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104498509B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016090965A1 (en) * | 2014-12-11 | 2016-06-16 | 华南农业大学 | Hmg1 gene and uses thereof in microsporidium molecular detection |
| CN107034284A (en) * | 2017-05-15 | 2017-08-11 | 华南农业大学 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3449961B2 (en) * | 2000-02-25 | 2003-09-22 | 独立行政法人農業生物資源研究所 | Pathogen detection by multi-primer PCR |
| CN101935707A (en) * | 2010-09-03 | 2011-01-05 | 浙江省检验检疫科学技术研究院 | Nosema bombycis SYBT Green fluorescence quantitative PCR (Polymerase Chain Reaction) detection method as well as kit and specific primer thereof |
| CN102260737A (en) * | 2011-05-30 | 2011-11-30 | 华南农业大学 | Primers and application thereof in quick detection of nosema bombycis |
| WO2012162161A1 (en) * | 2011-05-20 | 2012-11-29 | Phthisis Diagnostics | Microsporidia detection system and method |
| CN104017890A (en) * | 2014-06-20 | 2014-09-03 | 华南农业大学 | Application of EB1 gene to detection of nosema bombycis |
-
2014
- 2014-12-11 CN CN201410755670.4A patent/CN104498509B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3449961B2 (en) * | 2000-02-25 | 2003-09-22 | 独立行政法人農業生物資源研究所 | Pathogen detection by multi-primer PCR |
| CN101935707A (en) * | 2010-09-03 | 2011-01-05 | 浙江省检验检疫科学技术研究院 | Nosema bombycis SYBT Green fluorescence quantitative PCR (Polymerase Chain Reaction) detection method as well as kit and specific primer thereof |
| WO2012162161A1 (en) * | 2011-05-20 | 2012-11-29 | Phthisis Diagnostics | Microsporidia detection system and method |
| CN102260737A (en) * | 2011-05-30 | 2011-11-30 | 华南农业大学 | Primers and application thereof in quick detection of nosema bombycis |
| CN104017890A (en) * | 2014-06-20 | 2014-09-03 | 华南农业大学 | Application of EB1 gene to detection of nosema bombycis |
Non-Patent Citations (4)
| Title |
|---|
| GUOQING PAN等: "Comparative genomics of parasitic silkworm microsporidia reveal an association between genome expansion and host adaptation", 《BMC GENOMICS》 * |
| PAN,G.等: "KB909325.1", 《GENBANK》 * |
| 刘骏 等: "家蚕微粒子病PCR快速检测技术研究及诊断试剂盒的研制", 《中国动物检疫》 * |
| 向恒 等: "微孢子虫系统进化研究的变迁与展望", 《微生物学通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016090965A1 (en) * | 2014-12-11 | 2016-06-16 | 华南农业大学 | Hmg1 gene and uses thereof in microsporidium molecular detection |
| US10435759B2 (en) | 2014-12-11 | 2019-10-08 | South China Agricultural University | HMG1 gene and uses thereof in microsporidium molecular detection |
| CN107034284A (en) * | 2017-05-15 | 2017-08-11 | 华南农业大学 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104498509B (en) | 2017-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104498599B (en) | One group of microsporidian molecule universal detector primer and kit thereof | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN105316412B (en) | A kind of method and its dedicated kit for identifying or assisting identification pig to reach 100kg weight age in days | |
| CN101624636B (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN104017890B (en) | The application in detection nosema bombycis of the EB1 gene | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN103382507A (en) | One-step dual RT-PCR detection kit of 1-type and 3-type duck hepatitis A virus, primer pairs and method thereof | |
| WO2016065983A1 (en) | Lamp detection primer set and reagent kit for silkworm egg microsporidium | |
| CN103525913B (en) | Phytophthora capsici LAMP (Loop-mediated isothermal Amplification) primer and rapid detection method thereof | |
| CN104745730A (en) | Fluorescent PCR (Polymerase Chain Reaction) detection reagent for African swine fever virus CP204L genes and preparation method and application thereof | |
| WO2016065982A1 (en) | Lamp detection primers for silkworm egg microsporidium and applications of the primers | |
| CN104498509A (en) | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection | |
| CN104232755A (en) | Tobacco phytophthora LAMP detection primer and rapid detection method thereof | |
| CN107043830A (en) | It is a kind of while detecting double PCR primer and the application of grouper NNV and SGIV virus | |
| CN104004835A (en) | Multiplex PCR detection method of rabbit skin fungi | |
| CN105821159A (en) | Nested RT-PCR detection method for differentiating variant strains and classic strains of PEDV | |
| CN107365766B (en) | Method for extracting RNA of mould spore by mechanical crushing method | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application | |
| CN104651375B (en) | Nosema bombycis Met AP2 genes and its application | |
| CN108315391A (en) | It is a kind of to be used for the Primer composition and its application that pomegranate dry rot germ LAMP is quickly detected | |
| US20170101689A1 (en) | HMG1 Gene and Uses Thereof in Microsporidium Molecular Detection | |
| CN102827931B (en) | Detection primer for detecting listeria monocytogenes by PCR-pyrophosphate method, kit and detection method | |
| CN104313176B (en) | LAMP (loop-mediated isothermal amplification) detection primer combination for phytophthora palmivora, and LAMP detection kit and LAMP detection method thereof | |
| CN104404157A (en) | LAMP detection primer composition for detecting phytophthora drechsler tucker, LAMP detection kit, and LAMP detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |