CN1635155A - Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology - Google Patents
Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology Download PDFInfo
- Publication number
- CN1635155A CN1635155A CNA2004100727050A CN200410072705A CN1635155A CN 1635155 A CN1635155 A CN 1635155A CN A2004100727050 A CNA2004100727050 A CN A2004100727050A CN 200410072705 A CN200410072705 A CN 200410072705A CN 1635155 A CN1635155 A CN 1635155A
- Authority
- CN
- China
- Prior art keywords
- sakazakii
- sequence
- probe
- hybridization
- molecular hybridization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an Enterobacter sakazakii detection method by using the molecular hybridization-enzyme linked immuno-colour technology which belongs to the bacteria detection technology, especially a pathogenicbacteria detection technology by using the molecular hybridization method. The technical scheme is that: amplifying the 16s and 23s rRNA gene spacer region sequences of the pending bacteria, labeling the PCR products with digoxigenin, hybridizing with a group of designed specific oligonucleotide probes, and judging whether there is Enterobacter sakazakii in the pending sample after enzyme linked immunity color development. The method omits the repeated culture and screening of the bacteria to save time, the molecular hybridization identification method will not be affected by the culture conditions and the physiological status of the bacteria, so the method is more precise than the physiological biochemical identification method.
Description
Technical field
The present invention relates to a kind of bacteriologic test technology, is that utilization molecular hybridization-enzyme linked immunological coloration method detects the technology of malignant bacteria, particularly E.sakazakii specifically.
Background technology
E.sakazakii (Enterobacter sakazakii) is a gram negative bacterium, belongs to the enterobacteriaceae enterobacter.This bacterium is called as product yellow pigment enterobacter cloacae before being named as E.sakazakii in 1980.Be rarely found clinically pathogenic bacteria, its meningitis that causes, septicemia, necrotizing enterocolitis all have report in worldwide.And the trend of being on the increase is arranged, and most of cases occur in the infant, and the course of disease is short, and case fatality rate reaches 80% in some cases.Though the contagium of E.sakazakii is not really clear, infant formula powder has played the effect of communication media.Particularly State General Administration for Quality Supervision's issue on November 26th, 2002 bulletin is 2002 No. 120.To the effect that suspending the inspection declaration of the formula milk of some lot number of handling the production of U.S. Wyeth is open to the custom and relevant inspection and quarantine formality, the related products of import exercised supervision destroy, reason is that FDA Food and Drug Administration (FDA) detects E.sakazakii in the said products.
Summary of the invention
China does not still have the food neutralization to detect the standard method of E.sakazakii clinically at present, and the E.sakazakii of U.S. FDA in August, 2002 issue separates method of counting, has still continued to use " three pipes " enrichment and has detected E.sakazakii.Need to detect object bacteria through before increasing the classical method of inspection such as bacterium, separation and Culture, biochemical identification.Test period is long, and it is little to handle sample size, and sensitivity and specificity are all relatively low.At above-mentioned situation, the present invention has overcome shortcoming of the prior art, provides a kind of utilization molecular hybridization to detect the method for E.sakazakii (Enterobacter sakazakii).
Technical scheme of the present invention is as follows:
1. probe design: according to the dna sequence dna of E.sakazakii 16s and 23s rRNA intergenic region, design 6 specific oligonucleotide probes, its sequence is as follows.
Probe sequence one: GCTGCTGCATTTCTCCGTAATAAGGAATGCGCGGTGTGT
Probe sequence two: CAGAGTCTCTCAAACTCGCAGCACGAA GACTTCTTC
Probe sequence three: GTAAAGAAGCAGGGTTGTCTGCGAAAGCGAAGTC
Probe sequence four: GCGAAAGCGAAGTCCCTTTCGTCTAGAGGCCCAGGACA
Probe sequence five: ACTCCGCAGGAGTTGAAGAGGTTTAACTACG
Probe sequence six: TGCAAGATACAACCCCGCAGGAGTTGAAGAGG
2.PCR the amplification of design of primers and target DNA sequence: with the 16s of whole prokaryotic micro-organisms and the dna fragmentation of 23s rRNA intergenic region in the PCR method amplification testing sample, the nucleotide sequence of PCR primer is as follows.
Primer sequence one: GCTCGTGTNGTGANATGTTGCCA
Primer sequence two: GCGATTTCYGAATGGGGRAAGGG
Wherein N represents any one in 4 kinds of bases; Y represents any one among base C or the T; R represents any one among base A or the G.
Each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/ 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.3 μ L
DIG-dUTP 1mmol/L 0.3μL
DNA sample 2 μ L
Distilled water 33.1 μ L
Cumulative volume 50 μ L
The pcr amplification program is:
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) 95 ℃ of 30s repeat 5 times
6)95℃ 30s
7)68℃ 30s
8) 95 ℃ of 30s repeat 25 times
9)72℃ 2min
3.PCR the digoxigenin labeled of amplified production:, 16s and the 23s rRNA intergenic region dna fragmentation that amplifies carried out digoxigenin labeled from testing sample according to the operation instruction of Roche company digoxigenin labeled and detection kit.
(1) design specific oligonucleotide probe is used for making nucleic acid molecular hybridization and detects;
(2) 16s of whole prokaryotic micro-organisms and the dna fragmentation of 23s rRNA intergenic region in the pcr amplification testing sample carry out digoxigenin labeled then;
4. the molecular hybridization of the PCR product of oligonucleotide probe and digoxigenin labeled: with concentration is that the oligonucleotide probe solution 0.1 μ L point of 1mmol/L is on nylon membrane, crosslinked 5-10min under long-wave ultra violet lamp, hybridize with the PCR product of digoxigenin labeled then, method is as follows.
Prehybridization: prehybridization solution is preheating to hybridization temperature (50 ℃) earlier, and the nylon membrane of clicking and entering oligonucleotide probe is put into plastics bag, adds prehybridization solution, seals mouth, 50 ℃ of prehybridization 30min.
The thermally denature of pcr amplification product: the PCR product of digoxigenin labeled is heated to 95 ℃, keeps 10min, inserts in the ice bath then and cools off.
DNA hybridization: the good nylon membrane of the prehybridization plastics bag of packing into, add the PCR product 10 μ L of the digoxigenin labeled of sex change, add the 1mL hybridization solution again, seal mouth,, hybridize 1h in 50 ℃ according to the operation instruction of Roche company digoxigenin labeled and detection kit.Results of hybridization detects by an unaided eye by the colour developing of enzyme linked immunological developing technology, can find and can demonstrate blue hybridization spot with the specific probe that E.sakazakii PCR product is hybridized.
Compared with prior art, the invention has the beneficial effects as follows: this method have detect accurately, the characteristics of high specificity, can identify special target bacteria fast and accurately.At first, avoided cultivating repeatedly, saved time; And DNA-DNA hybridization authentication method is more accurate than the authentication method of Physiology and biochemistry, is not subjected to the influence of culture condition and bacterium physiological status.The present invention has filled up and has used the dna molecule hybridize method to carry out the blank that E.sakazakii detects.
Description of drawings
The DNA results of hybridization of Fig. 1 import brand infant formula powder
The DNA results of hybridization of Fig. 2 brand outlet fish powder
The DNA results of hybridization of Fig. 3 brand import dog chewing gum
Embodiment
Embodiment 1
Sample: certain import brand infant formula powder, conventional microorganism culturing and biochemistry detection go out the doubtful bacterium colony of E.sakazakii.
1.DNA extracting
Get enrichment liquid 1mL and in ice bath, left standstill 5 minutes, 12000r/min at room temperature then, centrifugal 5min, abandoning supernatant adds 100 μ L lysozyme solns, and 37 ℃ of insulation 10min add TE damping fluid 500 μ l, the vibration mixing.Add the saturated phenol of equal-volume Tris (pH8.0), strong vibration, 12000r/min, centrifugal 3min draws supernatant liquor, repeats the phenol extracting.Draw supernatant liquor, add the sodium acetate (2mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, and stand at low temperature 30min behind the mixing is in the centrifugal 5min of 12000r/min.Supernatant discarded adds 70% ice ethanol vibration washing once, 12000r/min under the room temperature, and centrifugal 5min abandons supernatant.Add 50 μ L TE solution, put-20 ℃ of preservations.
2.PCR amplification
PCR reaction mixture composition:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/L 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 2 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.3 μ L
DIG-dUTP 1mmol/L 0.3μL
DNA sample 2 μ L
Distilled water 33.1 μ L
Cumulative volume 50 μ L
The pcr amplification condition:
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) 95 ℃ of 30s repeat 5 times
6)95℃ 30s
7)68℃ 30s
8) 95 ℃ of 30s repeat 25 times
9)72℃ 2min
3. the hybridization of probe on target DNA amplified production and the nylon membrane
Prehybridization: prehybridization solution is preheating to hybridization temperature (50 ℃) earlier, and the nylon membrane of clicking and entering sequence oligonucleotide probe one, two, three, four is respectively put into plastics bag, adds prehybridization solution, seals mouth, 50 ℃ of prehybridization 30min.
The thermally denature of pcr amplification product: the PCR product of digoxigenin labeled is heated to 95 ℃, keeps 10min, inserts in the ice bath then and cools off.
DNA hybridization: the good nylon membrane of the prehybridization plastics bag of packing into, add the PCR product 10 μ L of the digoxigenin labeled of sex change, add the 1mL hybridization solution again, seal mouth,, hybridize 1h in 50 ℃ according to the operation instruction of Roche company digoxigenin labeled and detection kit.Results of hybridization develops the color by enzyme-linked immunoassay method.The result shows that the sak1 on the nylon membrane, sak2, sak3 and sak4 place all are blue spot deeply, and this positive results of hybridization show and contain E.sakazakii in the sample, and blue spot (Fig. 1) does not appear in the negative control sample.
Each point among Fig. 1 is respectively:
(1) positive control
(2) probe sequence one
(3) probe sequence two
(4) probe sequence three
(5) probe sequence four
(6) negative control
Testing sample uses bio-chemical detector to detect through conventional microorganism culturing, and the result shows that sample 98% is E.sakazakii, one of them bacterial strain called after fps6.This explanation is believable with the detected result of E.sakazakii in one, two, three, four pairs of samples of probe sequence.
Embodiment 2
Sample: certain brand outlet fish powder, the routine biochemistry method detects the doubtful bacterium colony of E.sakazakii.
1.DNA extracting
With embodiment 1.
2.PCR amplification
The composition of PCR reaction mixture is with embodiment 1.
The pcr amplification condition:
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) 95 ℃ of 30s repeat 5 times
6)95℃ 30s
7)72℃ 30s
8) 95 ℃ of 30s repeat 25 times
9)72℃ 2min
3. the hybridization of probe on target gene amplified production and the nylon membrane
Method is with embodiment 1.Used oligonucleotide probe is a sequence three, four, five, six.Results of hybridization shows that the mazarine spot all appears in the sak3 on the nylon membrane, sak4, sak5 and sak6, and this positive results of hybridization show and contain E.sakazakii in the sample, and blue spot (Fig. 2) does not appear in the negative control sample.
Each point among Fig. 2 is respectively:
(1) positive control
(2) probe sequence three
(3) probe sequence four
(4) probe sequence five
(5) probe sequence six
(6) negative control
Testing sample uses bio-chemical detector to detect through conventional microorganism culturing, and the result shows that sample 100% is E.sakazakii, one of them bacterial strain called after fis5.This explanation is believable with the detected result of E.sakazakii in three, four, five, six pairs of samples of probe sequence.
Embodiment 3
Sample: certain brand import dog chewing gum, routine biochemistry detects the doubtful bacterium colony of E.sakazakii.
1.DNA extracting
With embodiment 1.
2.PCR amplification
The composition of PCR reaction mixture is with embodiment 1.
The pcr amplification condition is with embodiment 2.
3. the hybridization of probe on target DNA amplified production and the nylon membrane
Method is with embodiment 1.Used oligonucleotide probe is a sequence one, two, three, four.Results of hybridization shows, on the nylon membrane
Sak1, sak2, sak3, sak4 all do not have blue spot and produce, this negative results of hybridization shows and does not contain E.sakazakii (Fig. 3) in the sample.
Each point among Fig. 3 is respectively:
(1) positive control
(2) probe sequence one
(3) probe sequence two
(4) probe sequence three
(5) probe sequence four
(6) negative control
Testing sample uses bio-chemical detector to detect through conventional microorganism culturing, and the result shows that sample 100% is reunion enterobacteria, one of them bacterial strain called after dot3.This further specifies, and is believable with the detected result of E.sakazakii in one, two, three, four pairs of samples of probe sequence.
In addition, also carried out the contrast parallel laboratory test of other bacteriums in enterobacter and enterobacteriaceae road, found that enterobacter cloacae, enteroaerogen, reunion enterobacteria, intestinal bacteria, the inferior Salmonella of honeycomb Hough Buddhist nun, proteus vulgaris, Proteus mirabilis, bacillus ceylonensis A, Salmonella enteritidis, Klebsiella pneumonia etc. all do not produce hybridization spot.
Sequence list
SEQUENCE?LISTING
＜110〉Nankai University
＜120〉utilization molecular hybridization-enzyme linked immunological developing technology detects the method for E.sakazakii
<130>041106
<160>8
<170>PatentIn?version?3.1
<210>1
<211>39
<212>DNA
＜213〉synthetic
<400>1
gctgctgcat?ttctccgtaa?taaggaatgc?gcggtgtgt 39
<210>2
<211>36
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(36)
<223>
<400>2
cagagtctct?caaactcgca?gcacgaagac?ttcttc 36
<210>3
<211>34
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(34)
<223>
<400>3
gtaaagaagc?agggttgtct?gcgaaagcga?agtc 34
<210>4
<211>38
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(38)
<223>
<400>4
gcgaaagcga?agtccctttc?gtctagaggc?ccaggaca 38
<210>5
<211>31
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(31)
<223>
<400>5
actccgcagg?agttgaagag?gtttaactac?g 31
<210>6
<211>32
<212>DNA
＜213〉synthetic
<220>
<221>misc_feature
<222>(1)..(32)
<223>
<400>6
tgcaagatac?aaccccgcag?gagttgaaga?gg 32
<210>7
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(23)
<223>
<400>7
gctcgtgtag?tgacatgttg?cca 23
<210>8
<211>23
<212>DNA
＜213〉synthetic
<220>
<221>primer_bind
<222>(1)..(23)
<223>
<400>8
gcgatttctg?aatggggcaa?ggg 23
Claims (9)
1. utilization molecular hybridization-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that designed specific oligonucleotide probe sequence is as follows:
Probe sequence one: GCTGCTGCATTTCTCCGTAATAAGGAATGCGCGGTGTGT
Probe sequence two: CAGAGTCTCTCAAACTCGCAGCACGAAGACTTCTTC
Probe sequence three: GTAAAGAAGCAGGGTTGTCTGCGAAAGCGAAGTC
Probe sequence four: GCGAAAGCGAAGTCCCTTTCGTCTAGAGGCCCAGGACA
Probe sequence five: ACTCCGCAGGAGTTGAAGAGGTTTAACTACG
Probe sequence six: TGCAAGATACAACCCCGCAGGAGTTGAAGAGG
2. utilization molecular hybridization according to claim 1-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that, with the 16s of whole prokaryotic micro-organisms and the dna fragmentation of 23s rRNA intergenic region in the PCR method amplification testing sample, then amplified fragments is carried out digoxigenin labeled, the nucleotide sequence of PCR primer is as follows:
Primer sequence one: GCTCGTGTNGTGANATGTTGCCA
Primer sequence two: GCGATTTCYGAATGGGGRAAGGG
Wherein N represents any one in 4 kinds of bases; Y represents any one among base C or the T; R represents any one among base A or the G.
3. utilization molecular hybridization according to claim 1-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that, also comprise derive out by above-mentioned 6 probe sequences, difference is not more than the oligonucleotide sequence of 8 bases and the antisense complementary sequence of each sequence, or their variant, or their partial sequence, or by the sequence of all or part of splicing of above-mentioned several sequences.
4. utilization molecular hybridization according to claim 1-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that this method may further comprise the steps:
(1) design specific oligonucleotide probe is used for making nucleic acid molecular hybridization and detects;
(2) 16s of whole prokaryotic micro-organisms and the dna fragmentation of 23s rRNA intergenic region in the pcr amplification testing sample carry out digoxigenin labeled then;
(3) the PCR product with oligonucleotide probe and digoxigenin labeled carries out molecular hybridization;
(4) results of hybridization is by the colour developing of enzyme linked immunological developing technology;
(5) the colour developing result detects by an unaided eye, and can find the specific probe colour developing that E.sakazakii is hybridized.
5. utilization molecular hybridization according to claim 4-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that each component composition is as follows in the PCR reaction system:
Constituent concentration application of sample amount
10 times of 5 μ L of PCR damping fluid
MgCl
2 20mmol/ 5μL
Taq archaeal dna polymerase 5u/ μ L 0.3 μ L
Primer sequence one 10 μ mol/L 2 μ L
Primer sequence 10 μ mol/L 2 μ L
Every kind of 10mmol/L of dNTPs 0.3 μ L
DIG-dUTP 1mmol/L 0.3μL
DNA sample 2 μ L
Distilled water 33.1 μ L
Cumulative volume 50 μ L
6. utilization molecular hybridization according to claim 4-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that amplification program is in the PCR method:
1)95℃ 10min
2)95℃ 30s
3)55℃ 20s
4)72℃ 30s
5) 95 ℃ of 30s repeat 5 times
6)95℃ 30s
7)68℃ 30s
8) 95 ℃ of 30s repeat 25 times
9)72℃ 2min
7. a kind of utilization molecular hybridization according to claim 4-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that, with concentration is that the oligonucleotide probe solution 0.1 μ L point of 1mmol/L is having on the nylon membrane of positive charge crosslinked 5-10min under long-wave ultra violet lamp.
8. a kind of utilization molecular hybridization according to claim 4-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that, the digoxigenin labeled of PCR product and with the hybridization of oligonucleotide probe, method is as follows:
* prehybridization
Prehybridization solution is preheating to hybridization temperature (50 ℃) earlier, and the nylon membrane of clicking and entering oligonucleotide probe is put into plastics bag, adds prehybridization solution, seals mouth, 50 ℃ of prehybridization 30min.
* the thermally denature of pcr amplification product
The PCR product of digoxigenin labeled is heated to 95 ℃, and 10min inserts in the ice bath then and cools off.
* the target DNA molecule of digoxigenin labeled and the dna probe on nylon membrane hybridization
The good nylon membrane of the prehybridization plastics bag of packing into, add the PCR product 10 μ L of the digoxigenin labeled of sex change, add the 1mL hybridization solution again, seal mouth, 50 ℃ of hybridization 1h, the gentle stirring.
9. utilization molecular hybridization according to claim 1-enzyme linked immunological developing technology detects the method for E.sakazakii, it is characterized in that, by the application of 6 specialized oligonucleotides probes in gene chip check E.sakazakii of the present invention's design.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100727050A CN1280429C (en) | 2004-11-11 | 2004-11-11 | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100727050A CN1280429C (en) | 2004-11-11 | 2004-11-11 | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1635155A true CN1635155A (en) | 2005-07-06 |
| CN1280429C CN1280429C (en) | 2006-10-18 |
Family
ID=34846781
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100727050A Expired - Fee Related CN1280429C (en) | 2004-11-11 | 2004-11-11 | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1280429C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082624B (en) * | 2007-07-10 | 2011-05-04 | 杨捷琳 | ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof |
| CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
| CN103713104A (en) * | 2013-12-26 | 2014-04-09 | 中华人民共和国淮安出入境检验检疫局 | Double-antibody sandwich method for detecting enterobacter sakazakii in food |
| CN107385102A (en) * | 2017-09-18 | 2017-11-24 | 北京勤邦生物技术有限公司 | Enterobacter sakazakii kit for detecting nucleic acid and its application |
-
2004
- 2004-11-11 CN CNB2004100727050A patent/CN1280429C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101082624B (en) * | 2007-07-10 | 2011-05-04 | 杨捷琳 | ELISA adsorption testing method and for detecting Enterobacter sakazakii and used antibody thereof |
| CN101368204B (en) * | 2008-09-16 | 2011-08-31 | 中国计量学院 | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique |
| CN103713104A (en) * | 2013-12-26 | 2014-04-09 | 中华人民共和国淮安出入境检验检疫局 | Double-antibody sandwich method for detecting enterobacter sakazakii in food |
| CN103713104B (en) * | 2013-12-26 | 2015-02-11 | 中华人民共和国淮安出入境检验检疫局 | Double-antibody sandwich method for detecting enterobacter sakazakii in food |
| CN107385102A (en) * | 2017-09-18 | 2017-11-24 | 北京勤邦生物技术有限公司 | Enterobacter sakazakii kit for detecting nucleic acid and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1280429C (en) | 2006-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1896284A (en) | Method for identifying allelic gene type | |
| CN1539994A (en) | Infectious etiologic agent detection probe and probe set, carreir, and genetic screening method | |
| CN1140762A (en) | Methods for polymerase chain reaction premplification sterilization by exonucleases in presence of phosphorothioated primers | |
| CN1932041A (en) | The primers specific to cervus elaphus, c. nippon, c. canadensis and rangifer tarandus gene and the method to identify cervi parvum cornu species | |
| CN1274846C (en) | Assay systems, kits and methods for detecting microorganisms | |
| CN1724689A (en) | Strain specificity PCR detection method of heredity modified corn strain MON863 | |
| CN1661112A (en) | Detection reagent for shiga toxin family gene of entero-hemorrhagic escherichia coli | |
| CN1280429C (en) | Process for detecting Enterobacter sakazakii by employing molecular hybridization and enzyme-link coloration technology | |
| CN1930302A (en) | Method for detecting pathogenic mycobacteria in clinIcal specimens | |
| CN1215177C (en) | Gene chip used for identifying pathogenic bacteria in blood and its making method | |
| CN1720335A (en) | Multiplex assay detection of pathogenic organisms | |
| CN1292077C (en) | Nucleic acid primers of acid fast bacterium and method of identifying acid fast bacterium | |
| CN1724686A (en) | Target sequence used for detecting mycoplasma pnoumoniae and reagent box | |
| CN1195850C (en) | Genes for detecting bacteria and detection method by using the same | |
| CN1772922A (en) | Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit | |
| CN1831139A (en) | Molecular biological quantitative detecting method for pathogenicity paratypic hemolytic vibrio in aquatic products | |
| CN1904064A (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
| CN1852992A (en) | Primer for detecting alicyclobacillus | |
| CN1637152A (en) | Detection reagent for thermostable direct hemolysin-related hemolysin gene of vibrio parahaemolyticus | |
| CN1664112A (en) | Method for detecting Enterobacter sakazakii by using polymerase chain reaction technology | |
| CN1678754A (en) | Primer and probe for detecting vibrio vulnificus and detection method using the same | |
| CN1216894C (en) | Nucleic acid amplification using hairpin structure to produce signal and detecting method | |
| CN1754001A (en) | Method of detecting chlamydia trachomatis and kit therefor | |
| CN1564872A (en) | Method for detecting, identifying and counting vibrio parahaemolyticus by using gene (rpoD) sequence of coding RNA polymerase sigma 70 factor | |
| CN1763224A (en) | Method for detecting enterohemorrhagic Escherichia coli O157:H7 strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |