CN1575336A - Systems and methods for delivering interferon to a subject - Google Patents

Abstract

Systems and methods for providing supplemental interferon to a subject. One disclosed system includes a viral vector capable of infecting a plant and expressing interferon therein and the plant, which is edible. Another disclosed system includes a DNA capable of expressing an interferon gene in a plant and the plant, which is edible and susceptible to transformation by the DNA sequence. Further disclosed is a method including causing a plant to express at least a portion of an interferon gene and feeding at least a portion of the plant to the subject.

Description

Send the system and method for passing Interferon, rabbit to the experimenter

Invention field and background

The present invention relates to provides the system and method that replenishes Interferon, rabbit to the experimenter, more particularly, relates to the system and method for using Interferon, rabbit by edible plant.The invention still further relates to the experimenter provides oral biological effectiveness proteinic general method.

In last decade, use plant virus to be used for most proteinic genetic expressions and be subjected to paying attention to and having developed greatly some rna virus vectors (Takamatsu etc., 1987 as carrier; Chapman etc., 1992; Dolja etc., 1992; Kumagai etc., 1993; Rommens etc., 1995; Porta and Lomonossoff, 1996; Scholthof etc., 1996; Arazi etc., 2001).These carriers have been successfully used to plant gene (Hammond-Kosack etc., 1995; Sablowski etc., 1995; Kumagai etc., 2000) and heterology gene (Hamamoto etc., 1993; Hendy etc., 1999; McCormick etc., 1999; Gopinath etc., 2000; Zhang etc., 2000) expression in plant.Regrettably, reduce because most of known plants viruses cause the host plant significant yield, therefore use these plant viral vector to be used to produce to have the agronomy character of improvement or have have additional nutrients or the commercial crops of pharmaceutical use still infeasible.

In addition, virus infects to other plant (Matthews, 1991) by its open-air natural carrier.This consequence causes using the serious worry of plant viral vector in the open air.

Shagreen bush pumpkin yellow mosaic virus (ZYMV) is such as cucumber, pumpkin, one of destructive disease of tool (Desbiez and Lecoq, 1997) in the whole world cucurbit kind of muskmelon and watermelon.ZYMV is a ptyviridae section, i.e. a member (Shukla etc., 1994) in the maximum colony of plant infection venereal disease poison.The same with all marmor upsilon groups, the ZYMV genome is by single courier's polarity RNA molecular composition of about 10kb, be wrapped to form the filamentous particle (Gal-On etc., 1992 J.Gen.Virol.73:2183-2187) of a bending by the single coat protein (CP) of multiple copied.Viral RNA is translated into large-scale polyprotein, and this polyprotein is by the proteolytic enzyme of 3 encoding virals: PI, and HC-Pro and NIa are processed into 8-9 functional protein (Riechmann etc., 1992, Revers etc., 1999) through proteolysis.PI (Verchot etc., 1991) and HC-Pro (Carrington etc., 1989) proteolytic enzyme are to be positioned at first and second protein of polyprotein N '-end regions and the catalysis autoproteolytic cleavage at himself C '-end.Nia proteolytic enzyme is responsible for cis and remaining viral polyprotein (Carrington etc., 1988 of trans proteolysis; Riechmann etc., 1992).

In theory, the marmor upsilon group is an expression vector likely, because the proteolysis Processing Strategies of its genetic expression need produce as a part of synthetic foreign protein of viral polyprotein (Riechmann etc., 1992 with equimolar amount with all viral proteins; Revers etc., 1999).In addition, consider the spiral type form of virion, expectation is inserted not packing restriction (Dolja etc., 1992 for quite large-scale genome; Scholthof etc., 1996).In tobacco etch virus (TEV) (DoLja etc., 1992), plum poxvirus (PPV) (Guo etc., 1998), lactuca virus 1 (LMV) (Choi etc., 2000; German-Retana etc., 2000) verified marmor upsilon group expression alien gene in.In these researchs, foreign gene inserts between P1 and HC-Pro gene, and as expressing with the insertion syzygy of HC-Pro gene N-end.As selection, non-pattern of fusion exogenous gene expression (Dolja etc., 1997 have been set up by add suitable proteolysis site at the end of exogenous gene sequence; Guo etc., 1998; Choi etc., 2000; Masuta etc., 2000).Yet, in the research of these prior aries, cause the genetic instability of construct to limit practicality (Dolja etc., 1993 owing to reject the RNA recombination event of exogenous array rapidly; Guo etc., 1998; Choi etc., 2000).This is the serious latent defect of this system seemingly.

Recently, Masuta etc. have confirmed that the foreign gene by the yellow vein expressing viral of trifolium is stable (Masuta etc., 2000) in beans in heredity.Yet, as what Masuta admitted, " ... the present form of CIYVV carrier is that it has kept it and induces the ability of the withered spot of lethality of host plant ".It is useless for the instruction of commercial production protein Masuta in edible legume crop that in fact this defective provides.This problem is the typical problem of the marmor upsilon group carrier of the prior art that produces so far.

Because its curative properties, Interferon, rabbit has quite big potentiality as the medicine of the many medical conditions of treatment.Interferon, rabbit is naturally occurring protein with immunomodulatory and ntiviral characteristic, and it produces (seeing Walter etc., 1998 summary) in the people's cell cultivated or intestinal bacteria as medicine.Interferon-' alpha ' or interferon-beta all are I type Interferon, rabbit.I type Interferon, rabbit is the naturally occurring cytokine of a big class, and it comprises IFN-α, adds 16 subclass that surpass of IFN-β and IFN-ω.I type Interferon, rabbit combines with the individual cells surface receptor, and stimulates complicated successive signal transduction incident, finally causes antiviral, anti-hyperplasia and other immunomodulatory effect, cytokine induction and HLA I type and II type are regulated (Pestka etc., Annu.Rev.Biochem., 1987 56:727).Alpha-interferon is widely used in the various hematologic malignancies of treatment, comprise hairy cell leukemia, chronic myeloid leukemia, rudimentary lymphoma, skin T-cell lymphoma, and noumenal tumour, renal cell carcinoma for example, melanoma, carcinoid tumor and AIDS-dependency Kaposi sarcoma (Gutterman, J.U., Proc.Natl.Acad.Sci.USA, 1994 91:1198-1205).Anti-tumour effect is usually in the high dosage level through parenteral injection administration interferon alpha, when usually being the rank of ten million unit as seen.Type multiple sclerosis and the chronic viral hepatitis B and third liver are recurred-alleviated to clinical being used for the treatment of in the interferon-beta approval.

Commodity interferon alpha 2a (Roferon-A; See Http:// www.rocheusa. Com/products/roferon) claim normalizing Serum ALT in suffering from the patient of chronic hepatitis C, improve liver histological and reduce viral load.This product is also pointed out to be used among the patient more than 18 years old and is treated chronic hepatitis C, hairy cell leukemia and AIDS-dependency Kaposi sarcoma.In addition, it points out to be used to accept the chronic situation of minimum pretreat, the patient of Philadelphia chromosome positive chronic myeloid leukemia (CML) (in diagnosing 1 year).Although the statement of manufacturer can be used for setting up the needs to interferon alpha, they do not provide the method for producing Interferon, rabbit, do not provide to need not expensive and the complicated medicine purifying just can send the method for passing IFN safely yet.

Although comprise intravenously, subcutaneous, intramuscular, many medicine-feeding ways of part and intralesional injection are generally used for the administration of I type Interferon, rabbit, generally do not use oral by way of because Interferon, rabbit is that think can be by the protein of proteolysis enzyme-deactivating.

Generally believe in order to obtain maximum hospital benefit, should use the Interferon, rabbit of the highest possibility dosage.Although it is feasible that the validity of recombined material means high dosage level, find that in practice the side effect of Interferon, rabbit administration has seriously limited spendable Interferon, rabbit dosage and treatment time length.These side effects comprise and seriously do not accommodate depression, in some case even cause committing suiside.The comment of Hoofnagle in New England Journal of Medicine recently summed up these problems (Hoofnagle, J.H., and Lau, D., New Eng.J.Medicine 1996,334,1470-1471).Intermediate analysis (Meta-analysis) to the interferon alpha result of treatment in suffering from the patient of chronic viral hepatitis B shows that have 25% to 40% remission rate with 500 million international units (IU) or 3 to 6 months typical chronic viral hepatitis B patient of inferior on every Wendesdays 1,000 ten thousand IU treatment every day.Yet these results do not reach healing, because most patient keeps the hepatitis surface antigen positive and contain viral DNA when detecting by the polymerase chain reaction.And these Interferon, rabbit dosage are difficult to tolerance, because the patient of intolerable side effect 10% to 40% need reduce dosage.Yet, with every days 100 ten thousand IU well-tolerated dosage the time, remission rate only 17% (Perrillo etc., New Eng.J.Medicine, 1990,323,295-301).Chronic hepatitis C patient confirms to have secular improvement relevant with losing of HCV RNA, it have only 10 to 20% weekly with 6 months the patient of dosage treatment of 300 ten thousand IU three times in generation (Hoofnagle and Lau, op.cit.).In cancer patient, common only visible significantly reactivity under the interferon alpha of maximum tolerated dose.Therefore, for example, in the myelomatosis multiplex people, it is 50% that the patient reaction who treats with 20 to 3,000 ten thousand IU every day leads, and only is 15 to 20% among the patient with 300 ten thousand IU treatment.Yet, seldom have patient can tolerate high dosage therapy above the short-term time (Ahre etc., Eur.J.Hematol., 1988,41,123-130).Therefore, clearly needing in this area can the administered with high dose Interferon, rabbit and do not induce the method for serious side effects.

In treatment various viral situations, particularly influenza as nasal spray or use the report of the existing many hearsays of effect of the Interferon, rabbit of low dosage as the oral liquid preparation.Placebo-controlled trial with the nose internal interference extract for treating rhinovirus infection of suitable high dosage shows that treatment is effectively, but a large amount of side effect incidences (Hayden etc., J.Infect.Dis., 1983 148:914-921 are arranged; Douglas etc., New Engl.J.Med., 1986 314:65-80; Hayden etc., New Engl.J.Med., 1986 314:71-75).

Nearest a series of patent specification has been described and has been used the Interferon, rabbit of the oral administration allos source of species of low dosage to be used for the treatment of infectious bovine rhinotrachetis (" transporting hot (shippingfever) ") and cat leukemia, also is useful on the enhancing vaccine potency; Improve the treatment of foods using efficient and piroplasmotic other situation of prevention Niu Taile formula.Respectively referring to U.S. Patent number 4,462,985, Australian Patent numbers 608519, Australian Patent numbers 583332 and U.S. Patent number 5,215,741.In addition, U.S. Patent number 5,017,371 disclose and use Interferon, rabbit to be used for the treatment of the side effect of cancer chemotherapy or radiotherapy by this way.In these specification sheetss, the Interferon, rabbit of use is the human interferon-alpha with the preparation of the method for Cantell, in phosphate buffered saline buffer whenever to weigh oneself 0.01 to 5IU dosed administration.Although these specification sheetss advise that the Interferon, rabbit of this low dosage is administered to mucous membrane of oropharynx, preferably be applicable to the form administration of oral mucosa Long contact time may be effective for the treatment of the various situations that comprise cancer, but for except transporting hot, the cat leukemia, the experimental evidence of the situation that canine parvovirus and Taylor's formula piroplasmosis are outer is hearsay mostly.Specifically, do not provide the suitable controlled trial of this treatment in any animal model of human cancer.

The existing summary of nearest research (Bocci, Clin.Pharmacokinet., 1991 21:411-417 for the effect of using the very low dose Interferon, rabbit by oral cavity or mucous membrane of oropharynx; Critic.Rev.Therap.Drug Carrier Systems, 1992 9:91-133; Cummins and Georgiades, Archivum Immun.Therap.Exp., 1993 41:169-172).The treatment that the treatment of existing this type of suggestion is infected for HIV is particularly useful and can improve AIDS patient's quality of life (Kaiser etc., AIDS, 1992 6:563-569 at least; Koech etc., Mol.Biol.Ther., 1990 2:91-95).Yet other report shows that this treatment does not provide clinical benefit.The I phase that use contains the oral lozenge treatment hepatitis B of low doses of interferon is studied and report is also arranged (Zielinska etc., Archiv.Immunol.Therap.Exp., 1993 41:241-252).

The United States Patent (USP) 6,207,145 of Tovey has been instructed the Interferon, rabbit mouth mucosa drug administration of high dosage.The instruction of this patent does not comprise the method for producing Interferon, rabbit, also not from, for example, the method for purifying alpha-interferon in the culture of Escherichia coli.

A series of U.S. Patent applications ( 5,817307 5,824,300 5,830,456 5,846,526 5,882,640 5,910,304With 6,036,949) relate to the various uses of Orally administered Interferon, rabbit.United States Patent (USP) 5,817,307Instruction be confined to the saliva soluble solid medicament form of Interferon, rabbit.United States Patent (USP) 5,824,300 5,830,456 5,846,526With 5,882,640Instruction similar limitation is arranged.This is because prior art has instructed the environment in the Mammals digestive tube to cause the Interferon, rabbit inactivation.Therefore, these patents have been instructed anti-interferon sending in digestive tube have been passed, for example, and as the saliva insoluble plant cell that contains Interferon, rabbit at the vegetable cell cellulose wall.United States Patent (USP) 5,910,304Instruction require to use Interferon, rabbit in the solution.United States Patent (USP) 6,036,949Instruction require Interferon, rabbit with " medicinal acceptable " solid or liquid form administration.Instructed the saliva solubility equally.Do not have one piece of instruction to use in these patents to need not the purifying medicine and need not with its Interferon, rabbit of the way of restraint " preparation ".Therefore, all these instructions all need expensive industrial process, and the present invention who states with this paper completely contradicts.

Present production technology is not suitable for satisfying the requirement of these prevailing disease of treatment to Interferon, rabbit.In addition, purifying alpha-interferon makes that the cost of interferon therapy is higher from cultured cells.And a large amount of present available commodity available interference elements are injection types.The United States Patent (USP) 5,766,885 of Carrington etc. has been instructed the marmor upsilon group carrier that is used for expression alien gene.Carrington specifically instructed " a kind ofly in plant or vegetable cell, express at least a method of protein; described method comprises with described marmor upsilon group and infects plant or vegetable cell to the marmor upsilon group susceptible that produces polyprotein; express described marmor upsilon group to produce described polyprotein; at least one is non-natural protein for the marmor upsilon group for wherein said marmor upsilon group coding, and wherein said non-natural protein process by proteolysis from described polyprotein, discharge ".Yet these instructions do not comprise such hint or suggestion, and promptly this non-natural protein can be that oral biology is effective.

In addition, the instruction of Carrington comprises supposition production Regular Insulin, hGH, and interleukin, EPO, G-CSF, GM-CSF, hPG-CSF, M-CSF, Factor IX, factors IX, and tPA be not although provide the support that can implement in its specification sheets.Because the potential source biomolecule of these compounds is learned active, the embodiment of the reporter gene that uses from Carrington does not know whether produce medicine plant feasible.Carrington oneself (embodiment 3) limits its requirement to insulin production and is " expection ".This instruction has constituted the contriver and has admitted not grasp in applying date fashion.

On other purposes of the Orally administered Interferon, rabbit of exploitation, very big interest (Bocci1999 is arranged at present; Cummins etc., 1999; Fleischmann etc., 1999; Ship etc., 1999 and Tompkins, 1999).This interest has strengthened the importance of disclosed the present invention in the effective ways that the effective Interferon, rabbit of the oral biology of production and supply is provided.

Therefore for being provided to the experimenter, additional Interferon, rabbit and other oral biology effective protein proteins matter avoid the system and method for above-mentioned restriction to have generally acknowledged demand and very favourable.

Summary of the invention

According to an aspect of the present invention, provide the system that additional Interferon, rabbit is provided to the experimenter.This system comprises: (a) virus vector, and this carrier design and be built into can infection plant and express at least a portion of interferon gene and (b) plant therein, at least a portion of this plant is that the experimenter is edible.The gene product of at least a portion of interferon gene is that biology is effective for the experimenter of at least a portion of the described plant of consumption.

According to a further aspect in the invention, provide the system that additional Interferon, rabbit is provided to the experimenter.This system comprises: (a) design and be built into the dna sequence dna that can express at least a portion of interferon gene in plant; (b) plant, at least a portion of this plant are the conversion susceptible of edible and this plant of experimenter for this dna sequence dna.The gene product of at least a portion of interferon gene is that biology is effective for the experimenter of at least a portion of the described plant of consumption.

According to a further aspect in the invention, provide a kind of method of replenishing Interferon, rabbit of supplying to the experimenter.The method comprising the steps of: (a) cause plant and express at least a portion of interferon gene in its at least some cells; (b) at least a portion of edible this plant of experimenter.

According to a further aspect in the invention, provide the method for supplying oral biology effective protein proteins matter to the experimenter.The method comprising the steps of: (a) cause plant is expressed oral biology effective protein proteins matter in its at least some cells at least a portion; (b) at least a portion of edible this plant of experimenter.

According to the another feature in the preferred embodiments of the invention described below, this virus vector is a marmor upsilon group carrier.

According to the another feature in the described preferred embodiment, this marmor upsilon group is a shagreen bush pumpkin yellow mosaic virus (ZYMV).

According to the another feature in the described preferred embodiment, ZYMV is the attenuated strain of listed sudden change in a kind of SEQ of containing IDNOs.:7 and 8.

According to the another feature in the described preferred embodiment, at least a portion of interferon gene comprises Mammals interferon gene sequence.

According to the another feature in the described preferred embodiment, this Mammals interferon gene sequence comprises at least a portion of human interferon gene's sequence.

According to the another feature in the described preferred embodiment, human interferon gene's sequence is to be selected from by interferon alpha 2a (SEQ ID NO.:1) and the group of arbitrary genomic constitution of at least 85% homology is arranged with it with the FastA programanalysis.FASTA program family (FastA, TFastA, FastX, TFastXAnd SSearch) write by University of Virginia's department of biochemistry professor WilliamPearson that (USA 85 for Pearson and Lipman, Proc.Natl.Acad.Sci.; 2444-2448 (1988)).With doctor's Pearson cooperation in, Mary Schultz and Irv Edelman file with this red tape operation and with GCG distribution Version 6.1, Sue 0lson files with Versions 8 to 10.The analysis that " with the FastA programanalysis " used herein expression uses usually the default parameters of specified this program to carry out.

According to the another feature in the described preferred embodiment, this vector expression is selected from a kind of proteinic at least a portion in the group of being made up of arbitrary protein of at least 85% homology by interferon alpha 2a gene product (SEQ ID NO.:2) with FastA programanalysis and its.

According to the another feature in the described preferred embodiment, virus vector is stoped by one in virus vector sudden change from the infectivity of this plant to second plant.

According to the another feature in the described preferred embodiment, this system also comprises at least one cell that dna sequence dna is imported plant, thereby transforms the method for this cell.

According to the another feature in the described preferred embodiment, this dna sequence dna comprises edaphic bacillus T-DNA left border and right side boundary.

According to the another feature in the described preferred embodiment, causing step finishes by being selected from following behavior: (i) with at least one cell of this plant of viral vector infection, this virus vector designs and is built into can express at least a portion of interferon gene therein; (ii) with designing and be built at least one cell that the dna sequence dna that can express at least a portion of interferon gene therein transforms this plant.

According to the another feature in the described preferred embodiment, causing step finishes by being selected from following behavior: (i) with at least one cell of this plant of viral vector infection, this virus vector designs and is built at least a portion of the gene that can express the oral biology effective protein proteins matter of coding therein; (ii) transform at least one cell of this plant with the dna sequence dna of at least a portion that designs and be built into the gene that to express the oral biology effective protein proteins matter of coding therein.

According to the another feature in the described preferred embodiment, human interferon gene's sequence is selected from by interferon beta (SEQ ID NO.:11), interferon-gamma (SEQ ID NO.:13) and having with one of FastA programanalysis and two interferon genes in the group of arbitrary genomic constitution of at least 85% homology.

According to the another feature in the described preferred embodiment, this vector expression is selected from by interferon beta gene product (SEQ ID NO.:12), a kind of proteinic at least a portion in interferon-gamma gene product (SEQ ID NO.:14) and the group be made up of arbitrary protein of at least 85% homology with one of FastA programanalysis and two interferon gene products.

The present invention supplies additional Interferon, rabbit by offering the experimenter, or the system and method for other oral biology effective protein proteins matter has successfully overcome the shortcoming of present known configurations.

Accompanying drawing is briefly described

This paper has only described the present invention by way of example with reference to accompanying drawing and photo.Now specifically with reference to drawings in detail, details shown in having emphasized is to be used for purpose that the illustrative of the preferred embodiments of the invention is discussed by way of example and only, and owing to believing that they are that the description to principle of the present invention and notion aspect of the most useful and easy understanding is provided.In this, plan to show the required more detailed CONSTRUCTED SPECIFICATION of the present invention of comparison basic comprehension of the present invention, the description of carrying out with accompanying drawing makes that how to implement forms more of the present invention in practice apparent to one skilled in the art.

Figure 1A and B have described the virus vector that is used in combination with system according to the present invention;

Fig. 2 A and B have shown stability and the accumulation of reorganization AGII in plant by means of immunoblotting and histogram;

Fig. 3 A-D is by means of photo, and histogram and RT pcr analysis have shown that AGII-Intederon Alpha-2a (AGII-IFN) does not influence cucumber and grows or output, and stable in plant;

Fig. 4 A-C has shown that by means of histogram and immunoblotting the IFN of AGII-IFN-mediation in pumpkin and cucumber leaves is synthetic;

Fig. 5 A-D has shown that with histogram the IFN of AGII-IFN mediation in pumpkin and cucumber fruits and fruit part is synthetic; With

Fig. 6 A-H has shown that foreign protein is by the expression of AGII carrier in each plant part.

Excellent description of washing embodiment

The present invention relates to provides the system and method that replenishes Interferon, rabbit to the experimenter.Specifically, the present invention can be used for the part as edible plant, and for example such as cucumber, the cucurbit fruit of pumpkin or muskmelon send by the oral cavity and passs Interferon, rabbit.The invention still further relates to the general method that oral biology effective protein proteins matter is provided to the experimenter.

Principle and operation according to the system and method that the invention provides additional Interferon, rabbit (with other oral biology effective protein proteins matter) are better understood with reference to accompanying drawing and appended explanation.

Before in detail explaining at least a embodiment of the present invention, should understand the structure of the composition that shows in that the present invention proposes in being not limited to hereinafter describe or the accompanying drawing and arrange details in it is used.The present invention can be other embodiment or be implemented in every way or realize.In addition, should understand that wording that this paper adopts and term are to be used for purpose of description and should not think restriction.

The present invention partly is embodied in a kind of system that is used for providing additional Interferon, rabbit to the experimenter.Referring now to accompanying drawing, Figure 1A and B have shown the virus vector that is used as according to the part of system of the present invention.Specifically, shown that the IFN gene inserts the AGII strain of its genomic ZYMV.Figure 1A is the genomic synoptic diagram of AGII.Show AGII non-coding region (drawing top shadow) and comprised the coding region (hollow frame) of the foreign gene (FG) of insertion.Arrow represents to participate in the NIa proteolytic enzyme of exogenous genes products proteolysis.The NIa cracking site with/expression.Shown the Restriction Enzyme site that is used for subclone.Inserting the Nucleotide of specified limit endonuclease recognition site represents with boldface type in Figure 1B to produce polylinker and its amino acids coding residue.The insertion of interferon gene occurs between NIb and the CP gene.Aminoacid sequence is represented with italics.

At least a portion of interferon gene is expressed in the virus vector of this system design and be built into can infection plant therein.Therefore, the gene product of at least a portion of interferon gene is that biology is effective for the experimenter of at least a portion of the described plant of consumption.Send to pass and for example can use, alleged usually " particle gun " of those of ordinary skill in the art realized.Preferably, virus vector is a marmor upsilon group carrier, more preferably the marmor upsilon group is a shagreen bush pumpkin yellow mosaic virus (ZYMV), more preferably ZYMV is an attenuated strain, the attenuated strain that for example contains SEQ ID NOs.:7 and 8 listed sudden changes, the attenuated strain that ZYMV-AGII transforms.

At least a portion of interferon gene can comprise the recombinant interferon gene of Mammals interferon gene sequence or naturally occurring interferon gene combination results.Mammals interferon gene sequence can comprise, for example, includes but not limited at least a portion of human interferon gene's sequence of interferon alpha 2a (SEQ ID NO.:1).As selection, perhaps in addition, the Mammals interferon gene can comprise with FastA programanalysis and interferon alpha-2 α gene having at least a portion of the gene of at least 85% homology.

As selection, perhaps in addition, human interferon gene's sequence can be an interferon beta, for example SEQ ID NO.:11 or interferon-gamma, for example SEQ ID NO.:13 or have arbitrary gene of at least 85% homology with any of FastA programanalysis and these interferon genes.

As selection, perhaps in addition, this carrier can be expressed the interferon beta gene product, for example, SEQ ID NO.:12, or the interferon-gamma gene product, for example, SEQ ID NO.:14 or have arbitrary proteinic at least a portion of at least 85% homology with any of FastA programanalysis and these interferon gene products.

In case it is sent is delivered to plant, the proteinic at least a portion of this vector expression, arbitrary protein that this protein includes, but not limited to interferon alpha 2a gene product (SEQ ID NO.:2) or has at least 85% homology with the FastA programanalysis with it.For example, the FastA part that can be used as BLAST or GCG routine package is performed.BLAST and FastA are the services that the national NCBI of medical laboratory by the National Institutes of Health provides.The both can obtain from Internet, and the those of ordinary skill of biology field enters for it and uses all and be familiar with.

Because environmental factors, preferably this virus vector is stoped by wherein sudden change to the infectivity of second plant from this plant.

System of the present invention also comprises this plant, and its at least a portion can be eaten by the experimenter.

Invention be also embodied in a kind ofly provides the system that replenishes Interferon, rabbit to the experimenter, and this system comprises design and is built into the dna sequence dna that can express at least a portion of interferon gene in plant.Interferon gene is as indicated above.This system also comprises this plant, and its at least a portion can be eaten by the experimenter.According to this system, this plant is for the conversion susceptible of this dna sequence dna.Preferably, this system also comprises at least one cell that this dna sequence dna is imported plant, thereby transforms the method for this cell.These methods can comprise, for example, are commonly referred to the method for permanent or instantaneous " agrobacterium-mediated conversion " or use the those of ordinary skill in Plant Transformation field to be commonly referred to the method for " particle gun ".

In addition, this dna sequence dna itself can comprise the partial sequence that is designed to help the vegetable cell genetic transformation.These partial sequences can comprise, for example the left border of edaphic bacillus T plasmid and right side boundary.

Invention be also embodied in the method for replenishing Interferon, rabbit to the experimenter is provided.This method comprises and causes plant is expressed at least a portion of interferon gene in its at least some cells step.For the purpose of this specification and the appended claims, phrase " its at least some cells " is meant plant its seed and the cell of finding from the tissue culture cells of its generation.This method also comprises the step at least a portion of edible this plant of experimenter.This Interferon, rabbit is as indicated above.Can reckon with that this initiation step can realize by variety of way.

For example, " initiation " can comprise at least one cell with the viral vector infection plant.In this case, virus vector designs and is built into and can express at least a portion of interferon gene in cells infected.Carrier design and be built into the assembling that causes virosome preferably, this virosome infects flanking cell.More preferably, the system that send the individual cells of passing plant to cause plant infects.

As selection, " initiation " can comprise with design and be built at least one cell that the dna sequence dna that can express at least a portion of interferon gene therein transforms this plant.This conversion can be that somatocyte transforms or germ cell line transforms.

Invention be also embodied in a kind of method that oral biology effective protein proteins matter is provided to the experimenter.This method comprises and causes plant is expressed at least a portion of oral biology effective protein proteins matter in its at least some cells step.This method also comprises the step at least a portion of edible this plant of experimenter.This initiation step can realize in various manners, as above to described as the Interferon, rabbit of oral biology effective protein proteins matter example.

Method disclosed herein shows the marked improvement with respect to prior art, because they do not need purifying alpha-interferon or other oral biology effective protein proteins matter from this plant.

Phrase " at least a portion of edible this plant " the wideest as far as possible implication of Ying Yiqi used in this specification and the appended claims is explained.Edible can comprising, for example, give fresh plant part, dried plant part, freeze-drying plant part, the plant part of grinding, the comminuted plants part, from the juice that plant part extracts, the plant part of anticorrosion (for example, salt marsh or gelation) or stand comprises the plant part of any combination processing of one of these processing.

Other purpose of the present invention, advantage and new feature will be conspicuous to those of ordinary skill in the art during embodiment below examination, and these embodiment plan as limiting.In addition, each in mentioned above and desired various embodiments of the present invention of following claims part and the aspect all can obtain experiment support among the embodiment below.

The result that partly describes in detail of embodiment provides AGII can mediate the interferon-' alpha ' 2a synthetic evidence of biologic activity in edible cucurbit fruit and blade hereinafter.Specifically, in cucumber and pumpkin blade, measure the most highly active interferon-' alpha ' 2a (430,000IU/gFW).This activity is similar to the interferon alpha-2 δ activity (De Zoeten etc., 1989) that obtains in turnip when CaMV is used as dna viral vector, and be equivalent to the activated protein of about 2 μ g/gFW.

Because AGII virus is non-pathogenic, the fruit (Fig. 3 A) that fruit amount that the cucumber plant that AGII-interferon alpha 2a (AGII-IFN) infects produces and quality are comparable to virusfree plant.Consistent with the expression of GFP in fruit, the IFN-2a activity of measuring in pumpkin and cucumber mainly concentrates on the embryonic tissue of fruit.The accumulation of AGII-IFN virosome is virus replication and the result who propagates the exogenous gene expression of mediation in the fruit.

The activity of IFN-2a changed with the leaf development stage in the cucumber leaves.In weighing surpasses the wide-spread blade of 10g, the active decline of IFN-2a and the virus accumulation keeps stable.Uncorrelated between the accumulation of this AGII-IFN virosome and the exogenous gene expression level may be because virus replication minimizing in mature tissue, and compare the turnover rate of Intederon Alpha-2a with the stability of virosome relative higher.7 amino acid of C-terminal interpolation at IFN-2a in the AGII expression system do not influence its activity, and this has confirmed the early stage observations of Petska, promptly do not influence its activity (Pestka etc., 1987) at the terminal amino-acid residue that adds of Interferon, rabbit.Do not lose the IFN activity when it should be noted that the freeze-drying plant tissue.

Since show recently the Interferon, rabbit of oral administration be a kind of in animal (Marcus etc., 1999) and human (Cummins etc., 1999) effective medicine, the Interferon, rabbit Orally-administrable of expressing in the cucurbit fruit is to treat the patient.

In a word, the present invention has confirmed use marmor upsilon group, and for example the transformation attenuation AGII strain of ZYMV is as the feasibility of the expression vector in the cucurbit.

Therefore, with reference to prior art, main advantage of the present invention is that the invention of the disclosure requires to make that by getting rid of purifying the production cost of Interferon, rabbit significantly reduces.Although the edible plant part may stand simply to process to produce such as grinding and exsiccant in some cases, for example, freeze dried fruit powder, the simplest embodiment of the present invention comprises to experimenter's edible fresh product.In fact, plant is distributed to the patient in the present invention's scope required for protection.Therefore, according to its simplest embodiment, the present invention has not only eliminated the purifying cost, and has greatly reduced distribution, stores transportation and packing cost.

In addition, system and method for the present invention can be used for eliminating significantly in the Interferon, rabbit preparation worry about poisonous pollution.Prevent that this fact from being because Interferon, rabbit does not prepare, and therefore can not import bacteriotoxin in process of production in bacterium.Equally, do not import the danger of human pathogen in process of production, because there is not end user's cell culture.Therefore, enforcement of the present invention has also been eliminated about residual antibiotic, the worry of artificial preservative and cell cultures additive.

The present invention has all inherent advantages of oral administration method in the prior art, comprises that administration is easily with comfortable.These factors make self-medication be easier to accept for the patient.In addition, plant cell wall can provide slow release effect (Walmsley and Arntzen, 2000) in vivo, may make the present invention be more suitable in being used for some clinical application, for example third liver.Plant cell wall makes the present invention have " saliva is insoluble ", thus the prior art of being different from.It is believed that Interferon, rabbit of the present invention prevents the protease activity in the Digestive tract.Therefore, Interferon, rabbit absorbs effectively for intestines wall subsequently, i.e. a kind of possibility of generally being got rid of by the training centre of prior art.

In addition, freeze dried vegetable material at room temperature should be stable, non-degradable wherein contained Interferon, rabbit." cold chain " that this is convenient to interrupt transportation and storage further reduces to send the final cost of passing each unit of Interferon, rabbit.In addition, this distribution capability that need not refrigerate makes that the under-developed area that is implemented in the world of the present invention is more feasible.This factor exists, and is conclusive in the treatment of HCV and HIV for example.

Confirmed that the numerous protein of expressing in the prior art is unsettled in the plant virus system.On the contrary, confirmed that Intederon Alpha-2a is stable unusually.

The invention provides some other advantages with respect to the known plants bioreactor system.Because this carrier is benign for host plant, so output is better.Do not propagated easily and realize by natural aphid carrier.This foreign gene is not owing to mix in the plant reproductive clone, therefore can not propagate in the seed of infection plant or pollen.In addition, because the needs of screening and breeding, transgenic plant need the long development time.And the present invention is not limited by this.In addition, the present invention does not need to send and passs viral RNA, instead depends on to send and passs the cDNA carrier.This is convenient to, and significantly minimizing is unexpected send the chance of passing plant, because the cDNA expression vector is not an infective virus.

Embodiment

The following example is provided now, and it illustrates the present invention with top description with non-limiting way.

In general, the laboratory operation of nomenclature used herein and utilization of the present invention comprises molecule, biological chemistry, microbiology and recombinant DNA technology.This technology has detailed explanation in the literature.Referring to, for example, " molecular cloning: laboratory manual ", Sambrook etc., (1989); " modern molecular biology method ", the I-III volume, Ausubel, R.M. compiles (1994); Ausubel etc., " modern molecular biology method ", John Wiley and Sons, Baltimore, the Maryland State (1989); Perbal, " molecular cloning practical guide ", John Wiley ﹠amp; Sons, New York (1988); Watson etc., " recombinant DNA ", U.S.'s science books, New York; Birren etc. (volume), " genome analysis: laboratory manual series ", the 1-4 volume, New York cold spring harbor laboratory publishes (1998); U.S. Patent number 4,666,828; 4,683,202; 4,801,531; The method that proposes in 5,192,659 and 5,272,057; " cytobiology: laboratory manual ", the I-III volume, Cellis, J.E. compiles (1994); Freshney, " animal cell culture-basic technology handbook " of Wiley-Liss, New York (1994), the third edition; " modern immunological method ", the I-III volume, Coligan J.E. compiles (1994); Sites etc. (volume), " basis and clinical immunology " (the 8th edition), Appleton ﹠amp; Lange, Norwalk, CT (1994); Mishell and Shiigi (volume), " cellular immunology method for concentrating ", W.H.Freeman and Co., New York (1980); The available immunoassay is extensively described in patent and scientific and technical literature, referring to, for example, U.S. Patent number 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; " oligonucleotide is synthetic ", Gait, M.J. compiles (1984); " nucleic acid hybridization ", Hames, B.D. and Higgins S.J. compile (1985); " transcribe and translate ", Hames, B.D. and Higgins S.J. compile (1984); " animal cell culture ", Freshney, R.I. compiles (1986); " immobilized cell and enzyme ", IRL press (1986); " molecular cloning practical guide ", Perbal, B., (1984) and " Enzymology method ", 1-317 volume, press of institute; " PCR method: methods and applications guide ", press of institute, San Diego, CA (1990); Marshak etc., " protein purification and evaluation strategy-laboratory study course handbook ", CSHL press (1996); " use antibody: laboratory manual " (EdHarlow, David Lane compiles, cold spring harbor laboratory publishes (1999)), quote all these documents for your guidance, fully describe as this paper.Other general reference providing everywhere at presents.Method is wherein believed well known in the art and is provided for helping reader.Wherein all information that is comprised is quoted for your guidance in this article.

Following method is provided in the experimental implementation of describing among the embodiment that provides hereinafter in addition:

Aphid can not spread-like AG structure

Importing aphid in two steps can not the spread-like sudden change.At first, by cloning pKS with part sacI22 (7515-9591) makes template, to AG (Gal-On, 2000) site-directed mutagenesis, imports a PstI site between Leu in the intragenic NIa proteolytic enzyme of NIb motif (DTVMLQ) and Glu (LQ) encoding sequence.The mutant clon called after pKS of gained SacI-PstI.Then by Nucleotide is replaced the suitable of (boldface type) has MODN 5 ' ATGCTGCAGTCAGGCACTCAGCCAACTGTGGCAGATACTGGAGCT-3 ' to the pKS as template with containing SacI-PstI carries out PCR and imports coat protein (CP) residue A la ⁹The Nucleotide that changes over Thr is replaced.Then with the pKS that suddenlys change SacI-PstI SacI-MluI segment imports the SacI-MluI site of AG to produce AGI.

The structure of the gene insertion sequence box between NIb and the CP

By using oligonucleotide

Is 5 ' CAGCTGCAGAGTACTAGTGCTAGCGTCGACACTGTGATGCTCCAA-3 ' at the pKS as template the enterprising performing PCR clone of SacI-PstI contains restriction site (PstI, ScaI, SpeI, NheI and SalI) and have the polylinker of NIa proteolytic enzyme sequence (boldface type).Digest the PCR product and import pKS with PstI and XbaI (position 9461) does SacI-PstI clone on the interior appropriate site to produce pKS SacI-PstI-poly.Then with pKS the SacI-MluI segment of SacI-PstI-poly imports the Sacl-Mul site of AGI to produce AGII.

Jellyfish green fluorescent protein (GFP), uidA (GRD beta-glucuronidase; GUS) gene is inserted Go into the AGII genome

Use both flanks to be adopted and antisense oligonucleotide (the SEQ IDNos. of having in PstI site; 17 and 18) coding region (SEQ ID NO.:15) by pcr amplification GFP.Digesting this amplification segment with PstI also clones among the part clone pKS Δ SacI-PstI-poly.Replace the PstI except antisense primer contains flank SalI site, using has justice and antisense oligonucleotide (SEQ ID Nos.; 19 and 20) uidA (SEQ ID NO.:16) is used similar clone's strategy.Also clone among the pKS Δ SacI-PstI-poly with PstI and SalI digest amplification PCR segment then.For all genes,, the segment that contains foreign gene of gained is cloned into the AGII genome to produce AGII-GFP and AGII-GUS with SacI/MluI double digested pKS Δ SacI-PstI-poly clone.

Human interferon-alpha 2a (IFN-2a) gene is inserted the AGII genome

Have justice and the antisense oligonucleotide (SEQ IDNos.:3 and 4) that use both flanks to be the SalI site pass through the coding region of pcr amplification IFN (SEQ ID NO.:1) and CMV-CP.Digest this amplification segment and clone part clone pKS with SalI among the SacI-SalI-poly.Do you advance pKS with SalI digest amplification PCR segment and clone then among the SacI-SalI-poly.

For all genes, with SacI/MluI double digested pKS SacI-SalI-poly clone clones into the AGII genome to produce AGII-IFN with the segment that contains the IFN gene of gained.

Plant-growth, inoculation and symptom assessment

The commercial variety of pumpkin (Cucurbita pepo L.cv.Ma ' ayan) and cucumber (Cucumis sativusL.cv.Delila and cv.Muhasan) plant is grown in the growth room under 23 ℃ of continuous illuminations.As for the test under the industrial condition, plant is having in having the 20-l bucket of automatic irrigation and fertilising in the room of fly net and is growing.When the cotyledon full extension, select seedling to be used to test purposes.Particle bombardment inoculation is with the device of holding that has the plasmid that is included in the viral cDNA of cauliflower mosaic virus 35S promoter (Gal-On etc., 1997) under controlling, and pistol carries out.Because AGII virus is asymptomatic in other cucurbitaceous plant, only can be observed slight viral symptom in pumpkin, therefore, selects it to test the infectivity of various virus formulation bodies.Behind bombardment or the mechanical inoculation, growth pumpkin seedling and check symptom development every day, first presentation of record symptom.

Recombinant virus offspring's RT-PCR analyzes

Virus offspring's RT-PCR uses from a pipe single step process of improvement such as Sellner (1992) and carries out.The 50 microlitre volumes that use contain polylinker flank primer 5 '-AGCTCCATACATAGCTGAGACA-3 ' and 5 '-TGGTTGAACCAAGAGGCGAA-3 ' (SEQ ID NOs.:5 and 6), and this primer is in following mixture: 1.5mM MgCl ₂125 μ MdNTPs; 1X Sellner damping fluid: [10X Sellner damping fluid contains: 670mMTris-HCl; 170mM (NH ₄) ₂SO ₄10mM β-sulfydryl-ethanol; 2mg/ml gelatin (Aldrich, piece in the calf skin 225); 60 μ M EDTA pH8.0 (Sellner etc., 1992)]; Each 100ng of Auele Specific Primer; The Taq polysaccharase of 2 units; The AMV-RT of 5 units (Chimerex USA); The total RNA of 2-5 μ g.RT-PCR circulation is as follows: 46 ℃ 30 minutes; 94 ℃ 2 minutes, then carry out 94 ℃ of 33 round-robin, 60 ℃ and 72 ℃, each 30 seconds, and 72 ℃ of last round-robin 5 minutes.

Estimate the ELISA test of virus titer

By described usefulness before (1989) such as Antignus anti--ZYMV CP polyclonal antibody carries out enzyme-linked immunosorbent assay (ELISA) to the vegetable material that infects.Assess the quantity of AGII-IFN by the purifying AGII virosome of on the ELISA flat board, checking known quantity.

IFN determination of activity and immunoblotting assay

Collect plant tissue, freezing and freeze-drying is 24 hours in liquid nitrogen.Freeze dried tissue grinds with pestle and mortar and with 1: the ratio of 1-1.5 (PBS of dry weight tissue/per unit volume) extracts in PBS.1 milliliter homogenate in Eppendorf minifuge with 10, centrifugal 10 minutes of 000g, supernatant is used for ELISA, immunoblotting assay and interferon activity are measured.By suppressing herpes stomatitis virus the IFN activity is measured in the cytopathy influence of people Wish (ATCC CCL-25) cell by described (Rubinstein etc., 1981) in the past in 96 hole microtiter plates.The calibration criterion that in each flat board, comprises IFN.The IFN activity represents 2 * 10 with every milliliter international unit number (IU/ml) ⁸IU is equivalent to 1mg IFN.(ECL, Amersham-Pharmacia Biotech UK), separate extract and carry out immunoblotting in order to anti--IFN polyclonal antibody of dilution in 1: 1000 on 15%SDS-PAGE for immunoblotting.

The agent of test administering therapeutic is to the influence of the colitis in the mouse model

The mouse colitis model of having set up (Gotsman etc., 2001) is used to assess the effect of oral administration from the IFN of edible plant part prepared in accordance with the present invention.

Be used for the preparation of the plant part that contains Interferon, rabbit of oral administration

Pumpkin plant (cv.Guliver) inoculated with ZYMV-AGII-IFN cDNA in the seedling stage (after germinateing 4 days).Infect two week the back with specificity anti--ZYMV antibody measures each plant by DAS-ELISA and confirms to infect.Infect 3 all backs and detect the biologic activity of the interferon alpha of each plant by standard interferon alpha assay method.Plant after 38 days the plant that infects from AGII-IFN and collect fruit as the plant that the AGII of negative control infects.The careful fruit of plucking that cleans, section, freeze-drying, and grind to form uniform powder.Use phosphate buffered saline buffer to extract powder then, collect soluble part and detect the biologic activity of its interferon alpha with the ratio of 1/7.6 (w/v).Obtained 120, the activity of 000IU/ml interferon alpha.Implement identical method for the negative control fruit.All Interferon, rabbit are measured the interferon alpha of employing National Institutes of Health as active standard.

The mouse experiment group

5 groups of mouse (n=10) have been tested.B, C and oral acceptance every day of D group mouse are from expressing human interferon alpha 2a (1.875 * 10 ⁶The extract of pumpkin fruit preparation IFN IU/kg/ agent) or negative control pumpkin (0 IFN IU/kg/ agent) fruit extract totally 14 days.

The visual grade of the clinical assessment of colitis and colitis

Duration of test is followed the tracks of the diarrhoea of mouse every day.Colitis is induced and is used canonical parameter to carry out the colitis assessment after 10 days.That is, put to death mouse and take out colon.The total colon wall percentage ratio and the colon weight of damage appears in record.In addition, assessment colonic ulcer degree; The adhesion of intestines and peritonaeum; Wall thickness; With myxedema degree (Ilan etc., 2000).Each parameter is classified into from 0 (normal fully) to the grade of 4 (the most serious) blindly by two experienced inspectors.

Histological injury's classification

For the Histological assessment of inflammation, take out tip colon (last 10cm) and fixing in 10% formaldehyde.Then according to 5 paraffin sections of standard technique with every mouse of hematoxylin-eosin dyeing.Inflammation degree on the micro-square section of colon from 0 to 4 is carried out (0 grade: the normal circumstances of NIP sign of sxemiquantitative classification (Ilan etc., 2000); 1 grade: extremely low-level leukocyte infiltration; 2 grades: low-level leukocyte infiltration; 3 grades: the high level with high vessel density soaks into the intestines wall thickening; With 4 grades: the saturating wall that goblet cell is lost soaks into, high vessel density, intestines wall thickening, and normal intestines structure deteriorate).Classification is carried out blindly by two experienced pathologists.

Cytokine

Use Genzyme diagnostic kit (MA USA) passes through IL4 according to manufacturers instruction for Genzyme Diagnostics, Boston, IL10, and the ELISA of IL12 and IFN γ measures cytokine in serum.The beginning oral administration was measured serum level after 14 days in all mouse of all groups.

Embodiment 1:

AG is transformed into not spread-like virus of aphid

The same with other marmor upsilon group, ZYMV by aphid with perishability mode natural propagation (Desbiez and Lecoq, 1997).Shown CP Asp ⁸Ala ⁹Gly ¹⁰(DAG) motif is relevant with aphis propagation ZYMV, and alanine mutation becomes Threonine can eliminate aphis propagation ZYMV (Gal-On etc., 1992).Carry out site-directed mutagenesis with Ala in the DAC motif of AG CP ⁹Residue converts Thr (SEQ ID NOs.:9 and 10) to, the mutant virus called after AGI of gained.AGI cDNA is inoculated the infection that pumpkin plant into produces the infection undistinguishable that causes with AG.Confirmed that by RT-PCR and order-checking Ala is altered to Thr in the AGI progeny virus.Aphis propagation test (Antignus etc., 1989) has confirmed that AGI can not be by aphis propagation, and this feature keeps stablizing in the machinery of plant goes down to posterity secular propagation and some plants.Based on these challenging results, AGI becomes the basis and the use in embodiment 2 of the further operation of above-detailed.

Embodiment 2:

In comprising the various cucurbit tissues of edible fruit

By AGII vector expression reporter gene

Propagate and be positioned at expressed exogenous gene in the Different Organs in order to study AGII, bacterium uidA and jellyfish GFP gene are inserted NIb-CP site (Figure 1B).Use corresponding to the recombinant cDNA of AGII-GFP and AGII-GUS 100% infected basically through the pumpkin plant of particle bombardment inoculation.Infect the back and in the pumpkin that AGII-GFP infects, occurred typical vein clearing and slight flower leaf paresthesia in 5-7 days.For AGII-GUS, the appearance of observing symptom postpones 4 days.

In order to follow the tracks of location, inoculate pumpkin and cucumber seedling respectively with AGII-GUS and AGII-GFP by AGII virus vector expressed exogenous gene.The pumpkin that AGII-GUS-infects was analyzed the GUS activity in back 15 days in infection, and observed blade, the GUS dyeing (Fig. 6 A-D) in stem and the root.The painted skewness of GUS in the blade that infects, and dyeing concentrates on (Fig. 6 A) around master pulse and the adjacent cells bunch.Stem demonstrates level dyeing, concentrates on (Fig. 6 B-C) around the vascular tissue.Interested is to detect strong GUS dyeing in adventive root (Fig. 6 C) and axillary root (Fig. 6 D).The GFP of the cucumber that infects by observation analysis AGII-GFP under UV-light.At the blade that AGII-GFP infects, stem is observed green fluorescence (Fig. 6 E, F-right side, G, H-left side) in flower and the fruit, show in these organs and express GFP.In the organ of the equal growth of infecting with AGII, do not observe similar fluorescence (Fig. 6 F-left side, 6H-right side); Visible uneven fluorescence in blade (Fig. 6 E) and male flower (Fig. 6 G).In fruit, fluorescence mainly is arranged in embryonic tissue and at pericarp layer or mesocarp degree lower (Fig. 6 H-left side).

These results show according to expressed exogenous gene in the plant of the present invention and express in comprising the various plant tissues of fruit.

Embodiment 3:

In cucurbit, express the human interferon-alpha 2a that biologic activity is arranged by AGII

For the quantitatively expression of foreign gene in the host plant organ, and in order to confirm the biotechnology potentiality of AGII expression vector in cucurbit, we insert NIb-CP with the IFN encoding sequence and insert site (Figure 1A and 1B).The plasmid that will contain AGII-IFN cDNA is inoculated on pumpkin and the cucumber plant and causes infecting fully.Observe the similar symptom of symptom that is produced to parental virus AGII in 5-7 days after infecting.Analyze the existence that the progeny virus that contains the IFN-2a gene between NIb and CP confirms IFN-2a gene in the AGII genome by RT-PCR.

Fig. 2 A is that the RT-PCR of progeny virus RNA analyzes.Infect the back and extract total RNA from the blade that the AGII-IFN system infects in the time of 14 or 24 days, and be that the primer in NIb-CP insertion site carries out RT-PCR with flank.The plasmid (pAGII-IFN) that contains AGII-IFN cDNA is carried out PCR in contrast.Analysing amplified product (having shown negative image) on the EtBr sepharose then.The amplification segment arrow mark that contains insertion gene and flank 476bp AGII of expection size (bp).The λ DNA of HindIII-EcoRI digestion is as molecular weight marker (M).

Fig. 2 B has shown cumulative AGII-IFN in the pumpkin plant.Accumulation schedule is shown AGII cumulative percentage (100%).Measuring virus levels and it by DAS-ELISA is from three strains plant take out three mean value of sample independently independently.All samples shown in DAI the time blade of working as from developmental phase collect.

Therefore, the IFN gene is kept perfectly in the AGII genome (Fig. 2 A) 24 days the time after infection and is accumulated to the level similar to AGII (Fig. 2 B) at least.In addition, keep stable at the back of 6 continuous passages (with the interval in 3 weeks) from the plant to plant IFN gene.

The seedling of pumpkin (Cucurbita pepo L.cv.Ma ' ayan) and unisexuality cucumber (Cucumissativus L.cv.Muhasan) commercial variety infects by the liquid inoculation of AGII-IFN (8 strain plant) or AGII (4 strain plant).In contrast, comprised the plant (4 strain plant) that does not infect.Plant under automatic irrigation and the fertilizer application condition in the room of half industrialization band net vertical-growth.Fig. 3 A comprise AGII-IFN-that infect with virus-free plant photo, they are taken when seedling inoculates back 45 days.Both are significantly difference not.Plant infection confirms by DAS-ELISA.The AGII-IFN infection is expressed by monitoring plant phenotype and symptom the influence of plant-growth and growth and is assessed by the estimation crop yield.Growing period is with the cucumber plant normal development of AGII-IFN infection.The AGII-IFN plant does not show any visible symptom on its blade or fruit, and on phenotype with virusfree plant indistinction (Fig. 3 A).The also normal development of infecting of pumpkin plant only demonstrates slight disperse flower leaf paresthesia on its blade, but asymptomatic on its fruit (no photo).By from inoculating 3 weeks of back, collect vendible cucumber fruits (each about 60 restrain) measurement crop yield in during 1 month.Fig. 3 B is the histogram of cucumber yield between the plant that infects of comparison virusfree plant and AGII-and AGII-IFN-.Fruit (mean size is 60g) is collected from plant in during 1 month.The data that provide are mean value ± SD of 3 or 4 strain independence plants.In virusfree plant, obtain the output (Fig. 3 B) of the about 2kg fruit of every strain plant, in the plant of inoculation AGII-IFN and AGII, obtained suitable output (Fig. 3 B).

Fig. 3 C is presented at AGII and AGII-IFN virus cumulative histogram in the cucumber plant.In from 4 samples of different plants, measure virus levels by DAS-ELISA.Collect all samples from the blade that developmental phase is worked as in infection in the time of back 45 days.In the blade of these plants, measure similar viral accumulation level (Fig. 3 C), confirmed that virus infection does not influence fruit production.

Fig. 3 D is that the RT-PCR of progeny virus RNA analyzes.The plant leaf that total RNA infects from recombinant virus (shown in pressing) or from virusfree plant, extract, and be that the primer in IFN insertion site carries out RT-PCR with flank.The plasmid (pAGII-IFN) that contains AGII-IFN cDNA is carried out PCR in contrast.Contain (995) or do not contain the segment arrow mark of the expection size (bp) of (476) IFN.The λ DNA of HindIII-EcoRI-digestion is as molecular weight marker (M); It should be noted that IFN gene in the AGII-IFN test plant (be expressed as plant number 17 and 20) even in confirm still to be kept perfectly (Fig. 3 D) back 2 months of inoculation with RT-PCR.

Fig. 4 A is the active histogram of measuring in the cucumber leaves of AGII-IFN-inoculation in the time of back 60 days in infection of IFN.This value obtains in subtracting background activity (activity of the cucumber that AGII-infects) back.The data that provide are the mean value ± SD of three independent measurements.The etap (weight and from vertical position) and the AGII-IFN virus quantity of pilot blade are provided below the histogram.The n.d.=undetermined.When back 60 days of infection and 30 days, analytically state the IFN activity of the infection blade of cucumber (representing plant 17 and 20) and pumpkin plant respectively.At tender leaf (second leaf; Fig. 4 A) measures every gram fresh weight (gFW) 157 * 10 in ³With 34 * 10 ³The activity of IU.At Lao Ye (4-6 leaf; Fig. 4 A) finds higher IFN activity in.Yet, fully stretch back (the 8th leaf) at blade, active reduce suddenly (Fig. 4 A) of IFN.In stem, measure 21 * 10 ³The average activity of IU/gFW.

Fig. 4 B is the immunoblotting assay of the sample tested among Fig. 4 A.Use anti--IFN polyclonal antibody to analyze soluble protein extract (70 μ g).(Rec is 4ng) as the gel shift rate contrast for reorganization IFN.Immunoblotting assay to the sample of analyzing Interferon, rabbit demonstrates the protein band that exists with anti--IFN antibody response.In addition, band strength is relevant with the active level of IFN, shows that this band represents IFN (Fig. 4 B).As expection, this band shows than the hIFN-2a gel shift rate slightly slowly of recombinating, because added 8 amino-acid residues (Figure 1B) on the IFN sequence.

Fig. 4 C has shown the IFN activity of measuring in the time of back 30 days in infection in the pumpkin blade of inoculation AGII-IFN.This value obtains in subtracting background activity (activity of the pumpkin that AGII-infects) back.The data that provide are the mean value ± SD of three independent measurements.In pumpkin, the IFN in the tender leaf (the 4th leaf from the top, Fig. 4 C) is active suitable with cucumber (Fig. 4 A).In the blade of control plant, do not find active.For the accumulation of the virus in the blade is connected with protein expression, by the amount (below Fig. 4 A, histogram) of AGII CP in the quantitative DAS-ELISA experiment with measuring blade.Measure the amount increase of AGII CP along with the maturation of blade.Obtain between the biologic activity of CP accumulation and IFN uncorrelated.This point is containing maximum AGII CP and is showing in the active wide-spread blade of minimum IFN especially significantly (Fig. 4 A).

The IFN activity of in the fruit extract of the cucumber (Fig. 5 A) of AGII-IFN inoculation or pumpkin (Fig. 5 B) plant, having found respectively when Fig. 5 A and B have shown after infection 60 or 30 days.This value obtains in subtracting background activity (activity of the plant that AGII-infects) back.The data that provide are the mean value ± SD of three independent measurements.The fruit development stage (weight) and the AGII-IFN virus quantity of test provide below histogram.The n.d.=undetermined.

The IFN activity of measuring in the fruit from same cucumber and pumpkin plant (Fig. 5 A and 5B) is than low 2 to 4 times of the activity in the same plant leaf (Fig. 4 A and 4C).High reactivity is all found (Fig. 5 A and 5B) in the minimum immature fruit of cucumber and pumpkin.On average, at the pumpkin fruit than the active high twice (Fig. 5 A and 5B) of the IFN that in cucumber, measures.The accumulation of AGII CP is than low two orders of magnitude in the blade in the cucumber fruits, and this is consistent with the IFN activity difference between two organs.

The IFN activity of in the fruit part of the cucumber plant 20 (Fig. 5 C) of AGII-IFN inoculation or pumpkin (Fig. 5 D), having found respectively when Fig. 5 C and D have shown after infection 60 or 30 days.This value obtains after the background activity of the fruit that deducts the AGII-infection.The data that provide are the mean value ± SD of three independent measurements.

Interesting is, the IFN activation analysis in cucumber and pumpkin fruit part shows that most of activity are positioned at fruit placenta tissue and/or embryonic tissue (fruit stone), and at mesocarp and pericarp layer much lower (Fig. 5 C and 5D).

Embodiment 4:

In different cucurbit kinds, express by AGII

The human interferon-alpha 2a that biologic activity is arranged

In order to determine to produce Interferon, rabbit in the kind important on various agriculturals easily, in the commercial variety of shagreen bush pumpkin (zucchini squash) and cucumber, experimentize.The result sums up in table 1.The expression level of Interferon, rabbit is all high in the kind of all tests.

Interferon alpha 2a activity in the various cucurbit kind of table 1. fruit

Kind	Kind	Interferon alpha 2a IU/gFW a
			Cucumber (Cucumis sativus	Muhasan	11534
IV-40	8759
		Sarig		8428
Zucchinisquash (cucurbitapepo)	Marrow				13693
		Ma’ayan	22939
	Cocozelle			24977
		XPS136	15690
	XPS159			18792
		Goldy	12957
	Scaloppini			18779
		Crookneck	14238
	Zucchini			17909
		Erlica	22316
	Straightneck			20425
		Nano-Verde	57142
	Gulliver			137500

^aAverage activity from least three different fruits measurements.

Embodiment 5:

The Orally administered human interferon-alpha 2a that produces in pumpkin is to the influence of mouse experiment colitis

In order to measure the interferon alpha 2a that produces in the plant influence, adopt the TNBS mouse model of colitis to colitis.This model is basically as described in (2000) such as (2001) such as Gotsmann and Ilan.Briefly, mouse is a normal inbrde female mice of keeping and keep 12 hours illumination/dark cycles on standard laboratory food.Induce colitis by colonic instillation trinitro-benzene-sulfonic acid (TNBs).After inducing 14 days, colitis gives the mouse oral administration of handling with the pumpkin fruit extract of expressing interferon alpha 2a.In contrast, induce the mouse of colitis to accept the pumpkin fruit extract or the bovine serum albumin of not expressing interferon alpha 2a of same amount.By standard clinical, visual and microscope inspection level evaluation colitis.Measure the serum cytokines secretion by ELISA.

By assessment diarrhoea level, the assessment of induction of tolerance to the influence of experiment colitis finished in the visual scoring of colitis, cytokine levels and Histological injury's classification.The result sums up in table 2.

Give the Fructus Cucurbitae moschatae extract do not induce the Orally administered Fructus Cucurbitae moschatae extract of mouse of colitis or to contain interferon alpha 2a to its healthy state have no adverse effect (B and C group).Yet, significantly improve its experiment type colitis for the pumpkin fruit extract (D group) of the Orally administered expression interferon alpha of the mouse 2a that induces colitis.These mouse weight increase of D group, it is not serious to suffer from diarrhoea, and shows the visual of remarkable improvement and microscope inspection colitis parameter.Compare with the mouse (E group) of having induced colitis and having expressed the Fructus Cucurbitae moschatae extract of interferon alpha 2a in these mouse that IFN γ level reduces and the IL10 level increases.

In a word, the pumpkin fruit extract of the Orally administered expressing human interferon alpha of this experiment confirm 2a produces positive influence to the mouse intestinal of inducing colitis.This shows that Interferon, rabbit is absorbed in digestive tube after swallowing, opposite with the instruction of prior art.No matter observed effect is a general or partial, represents that all the practicality of oraferon treatment has obvious improvement with respect to clinical medicine.

Table 2: the pumpkin fruit extract of Orally administered expression interferon alpha 2a

Influence in mouse colitis model

Group	Induce colitis	Handle	The microscope inspection scoring	Visual scoring	IFNγ	IL4	IL10	IL12
									A	Not	Do not have	0	0	160	39.3	90	-
B	Not	The extract that contains interferon alpha 2a	0	0	101	14.5	76.2	223
									C	Not	The extract of noiseless element	0	0	270	-	35.4	190
D	Be	The extract that contains interferon alpha 2a	1.65	1.4	134	11.5	65.37	230
									E	Be	Do not have	2.4	2.5	250	5	6	-

Although described the present invention in conjunction with its specific embodiments, clearly many selections are modified and are changed apparent to one skilled in the art.Therefore, the present invention plans to comprise essence and all these the interior selections that drop on claims on a large scale, modifies and variation.

All publications of mentioning in this specification sheets, patent and patent application are quoted reference as this specification sheets in this article with its integral body, its scope is equal to every piece of publication quoting as a reference in this article, patent and patent application concrete and separately shown in scope.In addition, quoting or authenticating not constitute and admit that this reference can be used as prior art of the present invention and can access arbitrary reference in this application.

Reference:

Antignus，Y.，Raccah，B.，Gal-On，A.，Cohen，S.，1989。The biology and the serological identification of Israel's shagreen bush pumpkin yellow mosaic virus and watermelon mosaic virus-2 strain isolated.Phytoparasitica17，289-287。

Arazi, T., G.Slutzky, Y.Shiboleth, Y.Wang, M.Rubinstein, S.Barak, J.Yang, and A.Gal-On.2001.Transforming shagreen bush pumpkin yellow mosaic marmor upsilon group is used at cucurbit expressing heterologous protein as not pathogenic carrier.J.Biotech.87，67-82。

Bocci，V.，1999。Oral sending passed Interferon, rabbit: present situation and direction.J.InterferonCytokineRes.19：859-861。

Carrington，J.C.，Cary，S.M.，Dougherty，W.G.，1988。The mutation analysis of tobacco etch virus polyprotein processing: the cis and the trans proteolytic activity that contain the polyprotein of 49-kilodalton proteolytic enzyme.J.Virol.62，2313-2320。

Carrington，J.C.，Cary，S.M.，Parks，T.D.，Dougherty，W.G.，1989。Second proteolytic enzyme of plant marmor upsilon group genome encoding.EMBOJ.8，365-370。

Chapman，S.，Kavanagh，T.，Baulcombe，D.C.，1992。Potato virus X is as the carrier of expressing gene in plant.PlantJ.2，549-557。

Choi，1.R.，Stenger，D.R.，Morris，T.J.，French，R.，2000。The plant viral vector of system expression foreign gene in cereal grass.PlantJ.23，547-555。

Cummins，J.M.，Beilharz，M.W.，Krakowka，S.，1999。The oral application of Interferon, rabbit.J.InterferonCytokineRes.19，853-857。

Desbiez，C.，Lecoq，H.，1997。Shagreen bush pumpkin yellow mosaic virus.PlantPathol.46，809-829。

DeZoeten，G.A.，Penswick，J.R.，Horisberger，M.A.，Ahl，P.，Schultze，M.，Hohn，T.，1989。The expression of human interferon in plant, location and effect.Virology172，213-222。

Dolja，V.V.，McBride，H.J.，Carrington，J.C.，1992。Tracking plant marmor upsilon duplicates and moves in the viral polyprotein by GRD beta-glucuronidase is inserted.Proc.Natl.Acad.Sci.USA89，10208-10212。

Dolja，V.V.，Herndon，K.L.，PironeT.P.，Carrington，J.C.，1993。The genomic spontaneous mutagenesis of plant marmor upsilon group behind the insertion foreign gene.J.Virol.67，5968-5975。

Dolja，V.V.，Hong，J.，Keller，K.E.，Martin，R.R.，Peremyslov，V.V.，1997。Infect by coexpression line style virus histone inhibition of potato Y virus group.Virology234，243-252。

Fleischmann, W.R.JR. and Koren, S., 1999.The system effect of Orally administered Interferon, rabbit and interleukin-2.J.InterferonCytokineRes.19：829-839。

Gal-On，A.，Antignus，Y.，Rosner，A.，Raccah，B.，1992。The coat protein gene sudden change of shagreen bush pumpkin yellow mosaic virus is replied aphis propagation but propagation is not had influence.J.Gen.Virol.73，2183-2187。

Gal-On，A.，Meiri，A.，Elman，C.，Gray，D.J.，Gaba，V.，1997。By the simple hand held device of particle bombardment with the effective infection plant of construct of coding virus.J.Virol.Methods64，103-110。

Gal-On，A.，2000。The protection to strict homology virus is expressed and shown to the symptom of point mutation change in cucurbit in the marmor upsilon group HC-Pro gene FRNK motif.Phytopathology90，467-473。

German-Retana, S., Candresse, T., Alias, E., Delbos, R.P. and Le Gall, O., 2000.Green fluorescent protein or GRD beta-glucuronidase mark antagonism destructive lactuca virus 1 strain isolated in susceptible and resistance varieties of lettuce accumulation and pathogenic influence.Mol.PlantMicrobeInteract.13，316-324。

Gopinath，K.，Wellink，J.，Porta，C.，Taylor，K.M.，Lomonossoff，G.P.，vanKammen，A.，2000。Cowpea mosaic virus RNA-2 is transformed into carrier expressing heterologous albumen in plant.Virology267，159-173。

GotsmanI，ShlomaiA，AlperR，RabbaniE，EngelhardtD，IlanY.，2001。Improve immune-mediated experiment type colitis: induction of tolerance in the presence of the immunity that is pre-existing in and alternative antigenic bystander effect.J.Pharmacol.Exp.Ther.297(3)：926-32。

Guo，H.S.，Lopez-Moya，J.J.，Garcia，J.A.，1998。The susceptibility that the sick marmor upsilon group of chimeric plum acne genome is reset reorganization behind the insertion foreign gene.VirusRes.57，183-195。

Hamamoto，H.，Suglyama，Y.，Nakagawa，N.，Hashida，E.，Matsunaga，Y.，Takemoto，S.，Watanabe，Y.Okada，Y.，1993。New tobacco mosaic disease poisonous carrier and the purposes that system produces Angiotensin-I-converting enzyme inhibitor in transgene tobacco and tomato thereof.Bio/Technology11，930-932。

Hammond-Kosack，K.E.，Staskawicz，B.J.，Jones，J.D.G.，Baulcombe，D.C.，1995。Functional expression from the fungi non-toxic gene of the potato virus X gene group of modifying.Mol.Plant-Microbe.Interact.8，181-185。

Hendy，S，Chen，Z.C.，Barker，H.，Santa-Cruz，S.，Chapman，S.，Torrance，L.，Cockburn，W.，Whitelam，G.C.，1999。Use potato virus X episomal vector in plant, to produce strand Fv segment rapidly.J.Immunol.Meth.231，137-146。

IlanY，Weksler-ZangenS，Ben-HorinS，DimentJ，SauterB，RabbaniE，EngelhardtD，ChowdhuryNR，ChowdhuryJR，GoldinE.，2000。Treat experiment type colitis by oral tolerance induction: the lymphocytic medium pore of inhibition.AmJGastroenterol.95，966-973。

Kumagai，M.H.，Turpen，T.H.，Weinzettl，N.，della-Cioppa，G.，Turpen，A.M.，Donson，J.，Hilf，M.E.，Grantham，G.L.，Dawson，W.O.，Chow，T.P.，Piatak，M.，Jr.，Grill，L.K.，1993。Quick in the transfection plant by rna virus vector, high level expression has the α-Trichosanthin of biologic activity.Proc.Natl.Acad.Sci.USA90，427-430。

Kumagai，M.H，Donson，J.，della-Cioppa，G.，Grill，L.K.，2000。Quick in the transfection plant by rna virus vector, high level expression glycosylation paddy rice α-Dian Fenmei.Gene.245，169-174。

Marcus，P.I.，vanderHeide，L.，Sekellick，M.J.，1999。Interferon, rabbit is to the effect of ornithosis virus.I. Orally administered chicken interferon α improves newcastle disease.J.InterferonCytokine.Res.19，881-885。

Masuta，C.，Yamana，T.，Tacahashi，Y.，Uyeda，I.，Sato，M.，Ueda，S.，Matsumura，T.，2000。The yellow vein virus of trifolium is developed to the effective stable gene expression system of beans species.PlantJ.23，539-546。

Matthews, R.E.F.1991, Plant Virology, the third edition, academic press, New York.

McCormick，A.A.，Kumagai，M.H.，Hanley，K.，Turpen，T.H.，Hakim，I，Grill，L.K.，Tuse，D，Levy，S.，Levy，R.，1999。Produce lymphadenomatous specificity vaccine fast by in tobacco plant, expressing from the strand Fv epi-position of tumour.Proc.Natl.Acad.Sci.USA96，703-708。

Pestka，S.，Langer，J.A.，Zoon，K.C.，Samuel，C.E.，1987。Interferon, rabbit and effect thereof.Annu.Rev.Biochem.56，727-777。

Porta，C.，Lomonossoff，G.P.，1996。Use virus replication expressing gene in plant.Mol.Biotechnol.5，209-221。

Revers，F.，Gall，O.L.，Candresse，T.，Maule，A.J.，1999。The interactional molecule of plant marmor upsilon group is given birth to the new development of understanding.Mol.Plant-Microbe.Interact.12，367-376。

Riechmann，J.L.，Lain，S.Garcia，J.A.，1992。Marmor upsilon component biological emphasis of son and prospect.J.Gen.Virol.73，1-16。

Rommens，C.M.，Salmeron，J.M.，Baulcombe，D.C.Staskawicz，B.J.，1995。The tomato pto homologue of control Tiguvon susceptibility is determined and is identified in use rapidly based on the gene expression system of potato virus X.PlantCell7，249-257。

Rubinstein，S.，Familletti，P.C.，Pestka，S.，1981。Interferon, rabbit make things convenient for assay method.J.Virol.37，755-758。

Sablowski，R.W.M.，Baulcombe，D.C.，Bevan，M.，1995。Use virus vector in leaf cell, to express the allosteric activation that flower specific Myb albumen causes the target promotor.Proc.Natl.Acad.Sci.USA92，6901-6905。

Scholthof，H.B.，Scholthof，K-B.G.，Jackson，A.，1996。Plant virus genophore instant expression of exogenous protein in plant.Ann.Rev.Phytopathal.34，299-323。

Sellner，L.N.，Coelen，R.J.，Mackenzie，J.S.，1992。The one operation RT-PCR reaction of one pipe is used to detect Ross River virus.J.Virol.Meth.40，255-263。

Ship, J.A., Fox, P., Mi chalek, J.E., Cummins, M.J., Richards, A.B. and IFN method research group, 1999.Through port transmucosal approach is used low dosage natural human interferon-' alpha ' treatment primary siogren's syndrome: II clinical trial phase, J.Interferon Cytokine Res.19:943-951.

Shukla，D.D.，Ward，C.W.，Brunt，A.A.，1994。ThePotyviridae。CABIWallingford。

Takamatsu，N.，Ishikawa，M.，Meshi，T.，Okada，Y.，1987。The expression of bacterium chloramphenicol acetyl transferasegene in tobacco plant of TMV-RNA mediation.EMBOJ.6，307-311。

Tompkins，W.，1999。Orally use the immunomodulatory and the result of treatment of interferon-' alpha ': mechanism of action, J.of Interferon and Cytokine Res.19:817-828.

Valerie，E.，Spall，M.，Shanks，M.，Lomonossoff，G.P.，1997。Polyprotein processing is as the strategy that carries out genetic expression in RNA viruses.SeminarsinVirology8，15-23。

Verchot，J.，Koonin，E.V.，Carrington，J.C.，1991。The 35-kDa protein of marmor upsilon group polyprotein N-terminal is as the proteolytic enzyme of the 3rd encoding viral.Virology185，527-535。

Walmsley，A.M.，Arntzen，C.J.2000。Be used to send the plant of passing edible vaccine.Curr.Opin.Biotechnol.11，126-9。

Walter，M.R.，Bordens，R.，Nagabhushan，T.L.，Williams，B.R.，Herberman，R.B.，Dinarello，C.A.，Borden，E.C.，Trotta，P.P.，Pestka，S.，Pfeffer，L.M.，1998。Look back the latest developments of the Molecular Identification of recombinant alpha interferon in the 40th anniversary of discovery Interferon, rabbit.CancerBiother.Radiopharm.13，143-54。

Zhang，G.，Leung，C.，Murdin，L.，Rovinski，B.，White，K.A.，2000。Use is expressed HIV-1 p24 protein based on the expression vector of RNA plant virus in plant.Mol.Biotechnol.14，99-107。

Sequence table

I

(1) general information:

(i) applicant: look into and cut that I is neat; Yue Er Moses Xi Bolaisi; A Mitejialong;

(ii) denomination of invention: supply the system and method that replenishes Interferon, rabbit to the experimenter

(iii) sequence number: 20

(iv) contact address:

(A) contact person: Mark M.Friedman C/O Mr.Bill Polkinghorn

DiscoveryDispatch

(II) street:

(C) city:

(D) country: the U.S.

(E) postcode: 20772

(v) computer-reader form:

(A) medium type: 1.44MB, 3.5 inches floppy disks

(B) computer: Twinhead*Slimnote-890TX

(C) operating system: MS DOS version 6.2,

Windowsversion3.11

(D) Word of software: Windows 2.0 is converted into the ASCI file

(vi) the application's data:

(A) application number:

(B) applying date:

(C) classification number:

(vii) priority application data

(A) application number: 60/253,136

(B) applying date: on November 28th, 2000

(C) application number:

(D) applying date:

(E) application number:

(F) applying date:

(viii) lawyer/proxy's information:

(A) name: Friedmarn, Mark M.

(B) registration number: 33,883

(C) reference/summary number: 910/14

(ix) telecommunication information:

(A) phone: 972-3-5625553

(B) fax: 972-3-5625554

(C) fax:

The information of SEQ ID NO:1

(i) sequence signature:

(A) length: 498

(B) type: nucleic acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:1:

ATGTGTGATCTGCCGCAGACTCACTCTCTGGGTTCTCGTCGTACTCTGAT50

GCTGCTGGCTCAGATGCGTCGTATCTCTCTTTTCTCCTGCTTGAAGGACA100

GACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAG150

GCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCT200

CTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACA250

AATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTG300

ATACAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCAT350

TCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAARGAGA400

AGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGA450

TCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAA498

(2) information of SEQ ID NO:2

(i) sequence signature:

(A) length: 166

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:2:

MetCysAspLeuProGlnThrHisSerLeuGlySerArgArgThr

II

51015

LeuMetLeuLeuAlaGlnMetArgArgIleSerLeuPheSerCys

202530

LeuLysAspArgHisAspPheGlyPheProGlnGluGluPheGly

354045

AsnGlnPheGlnLysAlaGluThrIleProValLeuHisGluMet

505560

IleGlnGlnIlePheAsnLeuPheSerThrLysAspSerSerAla

657075

AlaTrpAspGluThrLeuLeuAspLysPheTyrThrGluLeuTyr

808590

GlnGlnLeuAsnAspLeuGluAlaCysValIleGlnGlyValGly

95100105

ValThrGluThrProLeuMetLysGluAspSerIleLeuAlaVal

110115120

ArgLysTyrPheGlnArgIleThrLeuTyrLeuLysGluLysLys

125130135

TyrSerProCysAlaTrpGluValValArgAlaGluIleMetArg

140145150

SerPheSerLeuSerThrAsnLeuGlnGluSerLeuArgSerLys

155160165

Glu

The information of SEQ ID NO:3

(i) sequence signature:

(A) length: 34

(B) type: nucleic acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:3:

GCTGCAGTCATGTGATCTGCCGCAGACTCACTCT34

The information of SEQ ID NO:4

(i) sequence signature:

(A) length: 31

(B) type: nucleic acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:4:

CAGTGTCGACTTCCTTACTTCTTAAACTTTC31

The information of SEQ ID NO:5

(i) sequence signature:

(A) length: 22

(B) type: nucleic acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:5:

AGCTCCATACATAGCTGAGACA22

The information of SEQ ID NO:6

(i) sequence signature:

(A) length: 498

(B) type: nucleic acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:6:

TGGTTGAACCAAGAGGCGAA20

2) information of SEQ ID NO:7

(i) sequence signature:

(A) length: 1359

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:7:

TCACAACCGGAAGTTCAGTTCTTCCAAGGATGGCGACGAATGTTTGACAA50

III

GTTTAGGCCCAGCCTAGATCATGTGTGCAAAGTTGACCACAACAACGAGG100

AATGTGGTGAGTTGGCAGCAATCTTTTGTCAGGCTCTATTCCCAGTAGTG150

AAACTATCGTGCCAAACATGCAGAGAAAAGCTTAGTAGAGTTAGCTTCGA200

GGAATTCAAAGACTCTTTGAACGCAAACTTTATTATCCACAAGGATGAAT250

GGGATAGTTTCAAGGAAGGCTCTCATTACGATAATATTTTCAAATTGATC300

AAAGTGGCAACACAGGCTACTCAGAATCTCAAGCTCTCATCTGAAGTTAT350

GAAGTTAGTTCAGAACCACACAAGCACTCACATGAAGCAAATACAAGACA400

TCAACAAGGCGCTCATGAAAGGTTCATTGGTTACGCAAGACGAATTGGAC450

TTAGCTTTGAAACAGCTTCTTGAAATGACTCAGTGGTTTAAGAACCACAT500

GCATCTGACTGGTGAGGAGGCATTGAAAATGTTCATAAATAAGCGCTCTA550

GCAAGGCCATGATAAATCCTAGCCTTCTATGTGACAACCAATTGGACAAA600

AATGAAATTTTGTTTGGGGAGAAAGAGATACATTCCAAGCGATTATTCAA650

GAACTTCTTCGAAGAAGTATACCAGCGAAGGATATACGAAGTACGTAGTG700

CGAACTTTCCAAATGGTACTCGTAAGTTGGCCATAGGCTCATTGATTGTA750

CCACTCAATTTGGATAGGGCACGCACTGCACTACTTGGAGAGAGTATTGA800

GAAGAAGCCACTCACATCAGCGTGTGTCTCCCAACAGAATGGAAATTATA850

TACACTCATGCTGCTGTGTAACGATGGATGATGGAACCCCGATGTACTCA900

GAGCTTAAGAGCCCGACGAAGAGGCATCTAGTTATAGGAGCTTCTGGTGA950

TCCAAAGTACATTGATCTGCCAGCATCTGAGGCAGAACGCATGTATATAG1000

CAAAAGAAGGTTATTGCTATCTCAATATTTTCCTCGCAATGCTTGTGAAT1050

GTTAATGAGAACGAAGCAAAGGATTTCACCAAAATGATTCGTGATGTTTT1100

GATCCCCATGCTTGGGCAGTGGCCTTCATTGATGGATGTTGCAACTGCAG1150

CATATATTCTAGGTGTATTCCATCCTGAAACGCGATGCGCTGAATTACCC1200

AGGATCCTTGTTGACCACGCTACACAAACCATGCATGTCATTGATTCTTA1250

TGGATCACTAACTGTTGGGTATCACGTGCTCAAGGCCGGAACTGTCAATC1300

ATTTAATTCAGTTTGCCTCAAATGATATGCAAAGCGAGATGAAACATTAC1350

AGAGTTGGC1359

The information of SEQ ID NO:8

(i) sequence signature:

(A) length: 453

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:8:

SerGlnProGluValGlnPhePheGlnGlyTrpArgArgMetPhe

51015

AspLysPheArgProSerLeuAspHisValCysLysValAspHis

202530

AsnAsnGluGluCysGlyGluLeuAlaAlaIlePheCysGlnAla

354045

LeuPheProValValLysLeuSerCysGlnThrCysArgGluLys

505560

LeuSerArgValSerPheGluGluPheLysAspSerLeuAsnAla

657075

AsnPheIleIleHisLysAspGluTrpAspSerPheLysGluGly

808590

SerHisTyrAspAsnIlePheLysLeuIleLysValAlaThrGln

95100105

AlaThrGlnAsnLeuLysLeuSerSerGluValMetLysLeuVal

110115120

GlnAsnHisThrSerThrHisMetLysGlnIleGlnAspIleAsn

125130135

LysAlaLeuMetLysGlySerLeuValThrGlnAspGluLeuAsp

140145150

LeuAlaLeuLysGlnLeuLeuGluMetThrGlnTrpPheLysAsn

155160165

HisMetHisLeuThrGlyGluGluAlaLeuLysMetPheIleAsn

170175180

LysArgSerSerLysAlaMetIleAsnProSerLeuLeuCysAsp

185190195

AsnGlnLeuAspLysAsnGluIleLeuPheGlyGluLysGluIle

200205210

HisSerLysArgLeuPheLysAsnPhePheGluGluValTyrGln

215220225

ArgArgIleTyrGluValArgSerAlaAsnPheProAsnGlyThr

230235240

ArgLysLeuAlaIleGlySerLeuIleValproLeuAsnLeuAsp

245250255

ArgAlaArgThrAlaLeuLeuGlyGluSerIleGluLysLysPro

260265270

LeuThrSerAlaCysValSerGlnGlnAsnGlyAsnTyrIleHis

IV

275280285

SerCysCysCysValThrMetAspAspGlyThrProMetTyrSer

290295300

GluLeuLysSerProThrLysArgHisLeuValIleGlyAlaSer

305310315

GlyAspProLysTyrIleAspLeuProAlaSerGluAlaGluArg

320325330

MetTyrIleAlaLysGluGlyTyrCysTyrLeuAsnIlePheLeu

335340345

AlaMetLeuValAsnValAsnGluAsnGluAlaLysAspPheThr

350355360

LysMetIleArgAspValLeuIleProMetLeuGlyGlnTrpPro

365370315

SerLeuMetAspValAlaThrAlaAlaTyrIleLeuGlyValPhe

380385390

HisProGluThrArgCysAlaGluLeuProArgIleLeuValAsp

395400405

HisAlaThrGlnThrMetHisValIleAspSerTyrGlySerLeu

410415420

ThrValGlyTyrHisValLeuLysAlaGlyThrValAsnHisLeu

425430435

IleGlnPheAlaSerAsnAspMetGlnSerGluMetLysHisTyr

440445450

ArgValGly

453

The information of SEQ ID NO:9

(i) sequence signature:

(A) length: 837

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:9:

TCAGGCACTCAGCCAACTGTGGCAGACACTGGAGCTACAAAGAAAGATAA

AGAAGATGACAAAGGGAAAAACAAGGACGTTACAGGCTCCGGCTCAGGTG

AGAAAACAGTAGCAGCTGTCACGAAGGACAAGGATGTGAATGCTGGTTCT

CATGGGAAAATTGTGCCGCGTCTTTCGAAGATCACAAAGAAAATGTCATT

GCCACGCGTGAAAGGAAATGTGATACTCGATATTGATCATTTGCTGGAAT

ATAAACCGGATCAAATTGAGTTATATAACACACGAGCGTCTCATCAGCAG

TTCGCCTCTTGGTTCAACCAGGTTAAGACGGAATATGATTTGAACGAGCA

ACAGATGGGAGTTGTAATGAATGGTTTCATGGTTTGGTGCATTGAGAATG

GCACTTCACCCGACATTAATGGAGTGTGGGTTATGATGGACGGAAATGAG

CAAGTTGAGTATCCCTTGAAACCAATAGTTGAAAATGCAAAGCCAACGCT

GCGGCAAATAATGCATCATTTTTCAGATGCAGCGGAGGCATATATAGAGA

TGAGAAATGCAGAGGCACCATACATGCCGAGGTATGGTTTGCTTCGAAAC

CTACGGGATAGGAGTTTAGCACGATATGCTTTTGATTTCTATGAAGTCAA

TTCTAAAACTCCTGAAAGAGCCCGCGAAGCTGTTGCGCAGATGAAAGCAG

CAGCTCTTAGCAATGTTTCTTCAAGGTTGTTTGGCCTTGATGGAAATGTT

GCCACCACTAGCGAAGACACTGAACGGCACACTGCACGTGATGTTAATAG

AAACATGCACACCTTACTAGGTGTGAATACAATGCAG

The information of SEQ ID NO:10

(i) sequence signature:

(A) length: 279

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:10:

SerGlyThrGlnProThrValAlaAspThrGlyAlaThrLysLys

51015

AspLysGluAspAspLysGlyLysAsnLysAspValThrGlySer

202530

GlySerGlyGluLysThrValAlaAlaValThrLysAspLysAsp

354045

ValAsnAlaGlySerHisGlyLysIleValproArgLeuSerLys

505560

IleThrLysLysMetSerLeuProArgValLysGlyAsnValIle

657075

V

LeuAspIleAspHisLeuLeuGluTyrLysProAspGlnIleGlu

808590

LeuTyrAsnThrArgAlaSerHisGlnGlnPheAlaSerTrpPhe

95100105

AsnGlnValLysThrGluTyrAspLeuAsnGluGlnGlnMetGly

110115120

ValValMetAsnGlyPheMetValTrpCysIleGluAsnGlyThr

125130135

SerProAspIleAsnGlyValTrpValMetMetAspGlyAsnGlu

140145150

GlnValGluTyrProLeuLysProIleValGluAsnAlaLysPro

155160165

ThrLeuArgGlnIleMetHisHisPheSerAspAlaAlaGluAla

170175180

TyrIleGluMetArgAsnAlaGluAlaProTyrMetProArgTyr

185190195

GlyLeuLeuArgAsnLeuArgAspArgSerLeuAlaArgTyrAla

200205210

PheAspPheTyrGluValAsnSerLysThrProGluArgAlaArg

215220225

GluAlaValAlaGlnMetLysAlaAlaAlaLeuSerAsnValSer

230235240

SerArgLeuPheGlyLeuAspGlyAsnValAlaThrThrSerGlu

245250255

AspThrGluArgHisThrAlaArgAspValAsnArgAsnMetHis

260265270

ThrLeuLeuGlyValAsnThrMetGln

275279

2) information of SEQ ID NO:11

(i) sequence signature:

(A) length: 561

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:11:

ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCAC50

GACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCA100

GCAATTGTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAA150

TACTGCCTCAAGGACAGGAGGAACTTTGACATCCCTGAGGAGATTAAGCA200

GCTGCAGCAGTTCCAGAAGGAGGACGCCGCAGTGACCATCTATGAGATGC250

TCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCGAGCACTGGCTGG300

AATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGAGAAA350

CCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCA400

GGGGAAAACGCATGAGCAGTCTGCACCTGAAAAGATATTATGGGAGGATT450

CTGCATTACCTGAAGGCCAAGGAGGACAGTCACTGTGCCTGGACCATAGT500

CAGAGTGGAAATCCTAAGGAACTTTTACGTCATTAACAGACTTACAGGTT550

ACCTCCGAAAC561

2) information of SEQ ID NO:12

(i) sequence signature:

(A) length: 187

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:12:

MetThrAsnLysCysLeuLeuGlnIleAlaLeuLeuLeuCysPhe

51015

SerThrThrAlaLeuSerMetSerTyrAsnLeuLeuGlyPheLeu

202530

GlnArgSerSerAsnCysGlnCysGlnLysLeuLeuTrpGlnLeu

354045

AsnGlyArgLeuGluTyrCysLeuLysAspArgArgAsnPheAsp

505560

IleProGluGluIleLysGlnLeuGlnGlnPheGlnLysGluAsp

VI

657075

AlaAlaValThrIleTyrGluMetLeuGlnAsnIlePheAlaIle

808590

PheArgGlnAspSerSerSerThrGlyTrpAsnGluThrIleVal

95100105

GluAsnLeuLeuAlaAsnValTyrHisGlnArgAsnHisLeuLys

110115120ThrValLeuGluGluLysLeuGluLysGluAspPheThrArgGly

125130135

LysArgMetSerSerLeuHisLeuLysArgTyrTyrGlyArgIle

140145150

LeuHisTyrLeuLysAlaLysGluAspSerHisCysAlaTrpThr

155160165

IleValArgValGluIleLeuArgAsnPheTyrValIleAsnArg

170175180

LeuThrGlyTyrLeuArgAsn

185

2) information of SEQ ID NO:13

(i) sequence signature:

(A) length: 498

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:13:

ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGG50

TTCTCTTGGCTGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACC100

TTAAGAAATATTTTAATGCAGGTCATTCAGATGTAGCGGATAATGGAACT150

CTTTTCTTAGGCATTTTGAAGAATTGGAAAGAGGAGAGTGACAGAAAAAT200

AATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTTAAAAACTTTA250

AAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG300

AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAA350

GCTGACTAATTATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATAC400

ATGAACTCATCCAAGTGATGGCTGAACTGTCGCCAGCAGCTAAAACAGGG450

AAGCGAAAAAGGAGTCAGATGCTGTTTCGAGGTCGAAGAGCATCCCAG498

2) information of SEQ ID NO:14

(i) sequence signature:

(A) length: 166

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:14:

MetLysTyrThrSerTyrIleLeuAlaPheGlnLeuCysIleVal

51015

LeuGlySerLeuGlyCysTyrCysGlnAspProTyrValLysGlu

202530

AlaGluAsnLeuLysLysTyrPheAsnAlaGlyHisSerAspVal

354045

AlaAspAsnGlyThrLeupheLeuGlyIleLeuLysAsnTrpLys

505560

GluGluSerAspArgLysIleMetGlnSerGlnIleValSerPhe

657075

TyrPheLysLeuPheLysAsnPheLysAspAspGlnSerIleGln

808590

LysSerValGluThrIleLysGluAspMetAsnValLysPhePhe

95100105

AsnSerAsnLysLysLysArgAspAspPheGluLysLeuThrAsn

110115120

TyrSerValThrAspLeuAsnValGlnArgLysAlaIleHisGlu

125130135

LeuIleGlnValMetAlaGluLeuSerProAlaAlaLysThrGly

140145150

LysArgLysArgSerGlnMetLeuPheArgGlyArgArgAlaSer

155160165

Gln

VII

2) information of SEQ ID NO:15

(i) sequence signature:

(A) length: 714

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:15:

ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGA50

ATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTG100

AAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACT150

GGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGG200

TGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTT250

TCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTC300

AAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGA350

TACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATG400

GAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTA450

TACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAAT500

TAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAAC550

AAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC600

CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCA650

CATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGG700

ATGAACTATACAAA714

2) information of SEQ ID NO:16

(i) sequence signature:

(A) length: 1809

(B) type: nucleic acid

(C) chain: two strands

(D) topology: line style

(xi) sequence description of SEQ ID NO:16:

ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGG50

CCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTT100

GGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAGT150

TTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGT200

CTGGTATCAGCGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTA250

TCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAAT300

AATCAGGAAGTGATGGAGCATCAGGGCGGCTATACGCCATTTGAAGCCGA350

TGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTTGTG400

TGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACC450

GACGAAAACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTA500

TGCCGGAATCCATCGCAGCGTAATGCTCTACACCACGCCGAACACCTGGG550

TGGACGATATCACCGTGGTGACGCATGTCGCGCAAGACTGTAACCACGCG600

TCTGTTGACTGGCAGGTGGTGGCCAATGGTGATGTCAGCGTTGAACTGCG650

TGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTAGCGGGACTT700

TGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTAT750

GAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGATATCTACCCGCT800

TCGCGTCGGCATCCGGTCAGTGGCAGTGAAGGGCGAACAGTTCCTGATTA850

ACCACAAACCGTTCTACTTTACTGGCTTTGGTCGTCATGAAGATGCGGAC900

TTGCGTGGCAAAGGATTCGATAACGTGCTGATGGTGCACGACCACGCATT950

AATGGACTGGATTGGGGCCAACTCCTACCGTACCTCGCATTACCCTTACG1000

CTGAAGAGATGCTCGACTGGGCAGATGAACATCGCATCGTGGTGATTGAT105O

GAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGC1100

GGGCAACAAGCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAA1150

CTCAGCAAGCGCACTTACAGGCGATTAAAGAGCTGATAGCGCGTGACAAA1200

AACCACCCAAGCGTGGTGATGTGGAGTATTGCCAACGAACCGGATACCCG1250

TCCGCAAGGTGCACGGGAATATTTCGCGCCACTGGCGGAAGCAACGCGTA1300

AACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTAATGTTCTGCGAC1350

GCTCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAACCG1400

TTATTACGGATGGTATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGG1450

TACTGGAAAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATT1500

ATCATCACCGAATACGGCGTGGATACGTTAGCCGGGCTGCACTCAATGTA1550

CACCGACATGTGGAGTGAAGAGTATCAGTGTGCATGGCTGGATATGTATC1600

ACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGTGAACAGGTATGGAAT1650

TTCGCCGATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGTAACAA1700

GAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGC1750

TGCAAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGA1800

GGCAAACAA1809

VIII

2) information of SEQ ID NO:17

(i) sequence signature:

(A) length: 33

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:17:

ATGCTGCAGAAGACTAATCTTTTTCTCTTTCTC33

2) information of SEQ ID NO:18

(i) sequence signature:

(A) length: 42

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:18:

TGACTGCAGCATTACAGTGTCAAGCTCATCATGTTTGTATAG42

2) information of SEQ ID NO:19

(i) sequence signature:

(A) length: 190

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:19:

AACTGCAGTCAATGTTACGTCCTGTAGAAACCC33

2) information of SEQ ID NO:20

(i) sequence signature:

(A) length: 190

(B) type: amino acid

(C) chain: strand

(D) topology: line style

(xi) sequence description of SEQ ID NO:20:

ACGCGTCGACCTTTGTTTGCCTCCCTGCTGC31

Claims (30)

1, a kind of being used for provides the system that replenishes Interferon, rabbit to the experimenter, this system comprises: (a) virus vector, described carrier design also is built into and can infection plant also expresses at least a portion of interferon gene therein, (b) described plant, at least a portion of this plant are that the experimenter is edible; Wherein the gene product of described at least a portion of interferon gene is that biology is effective for the experimenter of the described plant at least a portion of consumption.

2, the system of claim 1, wherein said virus vector is a marmor upsilon group carrier.

3, the system of claim 2, wherein said marmor upsilon group are shagreen bush pumpkin yellow mosaic virus (ZYMV).

4, the system of claim 3, wherein said ZYMV are the attenuated strains of listed sudden change in a kind of SEQ of containing ID NOs.:7 and 8.

5, the system of claim 1, at least a portion of wherein said interferon gene comprise Mammals interferon gene sequence.

6, the system of claim 5, wherein said Mammals interferon gene sequence comprises at least a portion of human interferon gene's sequence.

7, the system of claim 6, wherein said human interferon gene's sequence are selected from by interferon alpha 2a (SEQ ID NO.:1) and the group of arbitrary genomic constitution of at least 85% homology are arranged with it with the FastA programanalysis.

8, the system of claim 6, wherein said human interferon gene's sequence are selected from by interferon beta (SEQ ID NO.:11) or interferon-gamma (SEQ ID NO.:13) with any of FastA programanalysis and described interferon gene group of arbitrary genomic constitution of at least 85% homology is arranged.

9, the system of claim 1, wherein said vector expression is selected from a kind of proteinic at least a portion in the group of being made up of arbitrary protein of at least 85% homology by interferon alpha 2a gene product (SEQ ID NO.:2) with FastA programanalysis and its.

10, the system of claim 1, wherein said vector expression is selected from by interferon beta gene product (SEQ ID NO.:12), interferon-gamma gene product (SEQ ID NO.:14) and with a kind of proteinic at least a portion in any group of being made up of arbitrary protein of at least 85% homology of FastA programanalysis and described interferon gene product.

11, the system of claim 1, the infectivity of wherein said virus vector from described plant to second plant stoped by one described virus vector sudden change.

12, a kind of being used for provides the system that replenishes Interferon, rabbit to the experimenter, and this system comprises: (a) design and be built into the dna sequence dna that can express at least a portion of interferon gene in plant; (b) described plant, at least a portion of this plant are the conversion susceptible of edible and this plant of experimenter for this dna sequence dna; Wherein the gene product of described at least a portion of interferon gene is that biology is effective for the experimenter of this at least a portion of the described plant of consumption.

13, the system of claim 12 also comprises at least one cell that described dna sequence dna is imported described plant, thereby transforms the method for described cell.

14, the system of claim 12, wherein said dna sequence dna comprises left border and the right side boundary of edaphic bacillus T-DNA.

15, the system of claim 12, described at least a portion of wherein said interferon gene comprises Mammals interferon gene sequence.

16, the system of claim 15, wherein said Mammals interferon gene sequence comprises at least a portion of human interferon gene's sequence.

17, the system of claim 16, wherein said human interferon gene's sequence are selected from by interferon alpha 2a (SEQ ID NO.:1) and the group of arbitrary genomic constitution of at least 85% homology are arranged with it with the FastA programanalysis.

18, the system of claim 14, wherein said human interferon gene's sequence are selected from by interferon beta (SEQ ID NO.:11) or interferon-gamma (SEQ ID NO.:13) with any of FastA programanalysis and described interferon gene group of arbitrary genomic constitution of at least 85% homology is arranged.

19, the system of claim 12, wherein said vector expression is selected from a kind of proteinic at least a portion in the group of being made up of arbitrary protein of at least 85% homology by interferon alpha 2a gene product (SEQ ID NO.:2) with FastA programanalysis and its.

20, the system of claim 12, wherein said vector expression is selected from by interferon beta gene product (SEQ ID NO.:12), interferon-gamma gene product (SEQ ID NO.:14) and with a kind of proteinic at least a portion in any group of being made up of arbitrary protein of at least 85% homology of FastA programanalysis and described interferon gene product.

21, a kind ofly provide the method for replenishing Interferon, rabbit to the experimenter, the method comprising the steps of: (a) cause plant and express at least a portion of interferon gene in its at least some cells; (b) at least a portion of the edible described plant of experimenter.

22, the method for claim 21, wherein said initiation step is finished by being selected from following behavior: (i) with at least one cell of the described plant of viral vector infection, described virus vector designs and is built into can express at least a portion of interferon gene therein; (ii) with designing and be built at least one cell that the dna sequence dna that can express at least a portion of interferon gene therein transforms described plant.

23, the method for claim 21, described at least a portion of wherein said interferon gene comprises Mammals interferon gene sequence.

24, the method for claim 23, wherein said Mammals interferon gene sequence comprises at least a portion of human interferon gene's sequence.

25, the method for claim 24, wherein said human interferon gene's sequence are to be selected from by interferon alpha 2a (SEQ ID NO.:1) and the group of arbitrary genomic constitution of at least 85% homology is arranged with it with the FastA programanalysis.

26, the method for claim 24, wherein said human interferon gene's sequence are to be selected from by interferon beta (SEQ ID NO.:11) or interferon-gamma (SEQ ID NO.:13) with any of FastA programanalysis and described interferon gene group of arbitrary genomic constitution of at least 85% homology is arranged.

27, the method for claim 21, the step of wherein said initiation expression of plants comprise expresses a kind of proteinic at least a portion be selected from the group of being made up of arbitrary protein of at least 85% homology by interferon alpha 2a gene product (SEQ ID NO.:2) with FastA programanalysis and its.

28, the method for claim 21, the step of wherein said initiation expression of plants comprises expressing and is selected from by interferon beta gene product (SEQ ID NO.:12), interferon-gamma gene product (SEQ ID NO.:14) and with a kind of proteinic at least a portion in any group of being made up of arbitrary protein of at least 85% homology of FastA programanalysis and described interferon gene product.

29, a kind ofly provide the method for oral biology effective protein proteins matter to the experimenter, the method comprising the steps of: (a) cause plant is expressed oral biology effective protein proteins matter in its at least some cells at least a portion; (b) at least a portion of the edible described plant of experimenter.

30, the method for claim 29, wherein said initiation step is finished by being selected from following behavior: (a) with at least one cell of the described plant of viral vector infection, described virus vector designs and is built at least a portion of the gene that can express the oral biology effective protein proteins matter of coding therein; (b) with design and the dna sequence dna of at least a portion that is built into the gene that can express the oral biology effective protein proteins matter of coding therein transform at least one cell of described plant.

Images