CN1234851C - Vaccine for human papiloma virus - Google Patents
Vaccine for human papiloma virus Download PDFInfo
- Publication number
- CN1234851C CN1234851C CNB2004100033957A CN200410003395A CN1234851C CN 1234851 C CN1234851 C CN 1234851C CN B2004100033957 A CNB2004100033957 A CN B2004100033957A CN 200410003395 A CN200410003395 A CN 200410003395A CN 1234851 C CN1234851 C CN 1234851C
- Authority
- CN
- China
- Prior art keywords
- fever virus
- dengue fever
- cell
- pseudovirion
- replicon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The present invention provides a pseudovirion vaccine with the recombination replicon of dengue fever virus as a core and a preparation method thereof. The vaccine can effectively express antigens in affected cells; because dengue fever virus has the characteristic of affecting dendritic cells, the antigens can be extracted effectively with good immunity effect. In addition, different dengue fever virus can be used for effective repeated immunity so as to strengthen the organism immunity against pathogens with the antigens. The vaccine can be used for preventing and treating tumors and virosis.
Description
Technical field
The present invention relates to dengue fever virus, is the recombiant vaccine that replaces the structural protein gene of dengue fever virus with the HPV specific antigens specifically, and method for making and purposes.
Background technology
Cancer is serious threat human life's a disease.The generation of many cancers is relevant with virus.With the cervical cancer is example, and (human papilloma virus, HPV) infection can cause reproductive tract venereal disease and cancer to gain public acceptance to human papillomavirus.HPV infection rate and gradient of infection increase the weight of and raise gradually with the cervical lesions degree, can briefly be described as: chronic cervicitis → false condyloma → wart sample pathology → pointed condyloma → cervical intraepithelial neoplasia (CIN) → cervical cancer.HPV has infection population widely, and China women's infection rate is 10-40%, and the infection rate of European women is up to 40-60%.The sickness rate of cervical cancer is only second to mammary cancer in the women.According to World Health Organization statistics, the existing cervical cancer patient in the whole world is about 1,700,000, annual about 500,000 new cases, the case of dying of dieing ten thousand deaths 20 more.The existing cervical cancer patient of China is about 140,000, annual newly-increased case about 40,000.Cases of cervical cancer more than 75% infects relevant with the HPV of two types (16 and 18 types).Clinically radiotherapy, operation and chemotherapeutic treatment cervical cancers of adopting more, minority is in conjunction with traditional Chinese medical herbal treatment, but effect is unsatisfactory.Cervical cancer patient's 5 annual survival rates are 65%.The recurrence rate of cervical cancer is higher, the poor prognosis of recurrent cases, and 2 annual survival rates have only 5%.In the U.S., the expense that is used for cervical cancer examination and treatment every year is about 5.7 hundred million dollars.
The most frequently used operation, the chemotherapy and radiation three great tradition therapies of treatment malignant tumour exist recurrence rate height, side effect and reach defectives such as producing resistance greatly.The biotherapy of tumour, especially immunotherapy of tumors or gene therapy is because of its theoretic high specific and low side effect, as the new pattern of treatment tumour, its strategic position is progressively established, but clinical application effect and people's expectation so far still there is a big difference.
Vaccine of the prior art comprises following several:
Killed vaccine: this is the tumor vaccine of human early test, is characterized in comparison safety, but because the inducing cell immunity needs antigen to express in viable cell and offer, so it can not cause effective cellular immunization.
With virus is the vaccine of carrier:
Keeping complete dna replication dna system in the dna viral vector, is a kind of living vaccine.It can duplicate and express the oncogene fragment effectively, irritation cell immunity system constantly, and (Cytotoxic T cells is CTLs) to antitumor to produce cytotoxic T cell.But for fear of carcinogenic possibility, generally adopting the oncogene fragment is antigen, and antigenicity just reduces like this.But this dna virus vaccine safety is low.
(Lancet.1996 Jun 1 such as Borysiewicz LK; 347 (9014): 1523-7.) disclosing a kind of is the HPV vaccine of carrier with the vaccinia virus, but because many people carry the antibody of vaccinia virus, therefore limited the scope of application of this vaccine, and this vaccinia virus vaccine is difficult to carry out the repetition immunity.
WO0153467 discloses a kind of recombinant flavivirus, comprising the extraneous nucleotide sequence of codified exogenous amino acid sequence.Use the recombinant flavivirus host cells infected, exogenous nucleic acid can be provided in host cell, and produce antigenic polypeptide, and then cause immunne response allogenic polypeptide by the exogenous nucleic acid coding.Yet, but its shortcoming has been to use the yellow fever virus of self-replicating propagation, has kept whole yellow fever virus genome sequences, does not have the disappearance of structural protein gene.Though need not packaging system when making up vaccine, security is lower.
Antigen presenting cell prepares tumor vaccine: the basic skills of making is at first to obtain dendritic cell on one's body from the patient; carry out primary cell culture and amplification; again with tumor associated antigen or specific antigens extracorporeal treatment autologous dendritic cell; inoculate the host; make it activate the T lymphocyte in vivo, play treatment and provide protection.Yet this method wastes time and energy, the cost height, and the cultivation of dendritic cell, amplification and activation success ratio are low, are difficult to realize quality control.The method of therefore this complete individuation customization tumor vaccine can't industrialization, is difficult to apply.
In sum, this area presses for that the new security of exploitation is good, immunizing potency is high, repeats the vaccine of good immune effect.
Summary of the invention
Purpose of the present invention just provides that a kind of new security is good, immunizing potency is high and repeat good immune effect, be suitable for the vaccine that industrialization is produced, especially antitumor and vaccine.
In a first aspect of the present invention, a kind of dengue fever virus recombinant replication is provided, described replicon has lacked the proteic whole encoding sequences of dengue fever virus preM, and comprises following element:
A) non-coding region of 5 ' whole ends;
B) preceding 20 the amino acid whose coding regions of C albumen;
C) coding region of NS1 protein signal peptide;
D) all Nonstructural Protein coding region;
E) non-coding region of 3 ' end;
F) be positioned at b) and c) between exogenous nucleic acid sequences, described exogenous nucleic acid sequences coding HPV antigen, immune-regulating factor or HPV antigen and immune-regulating factor mixture.
In another preference, 3 ' end of described exogenous nucleic acid sequences has 3 ' end releasing member, perhaps has 5 ' releasing member before the coding region of NS1 protein signal peptide, described releasing member is selected from: the nucleotide sequence of signal peptide lytic enzyme substrate shown in the nucleotide sequence of the coding foot and mouth disease virus shown in the SEQ ID NO:3 self lytic enzyme, the coding SEQ ID NO:44, and combination.
In another preference, described dengue fever virus is dengue fever virus I, II, III or IV type, or its combination.
In another preference, the coding region of described NS1 protein signal peptide is last 72 Nucleotide of E protein gene.
In another preference, the E7-E6 fragment that described HPV antigen is HPV, for example the E7-E6 fragment of the HPV of 16 hypotypes and 18 hypotypes.
In a second aspect of the present invention, a kind of pseudovirion is provided, it is made up of above-mentioned dengue fever virus recombinant replication and dengue fever virus structural protein packing.
In a third aspect of the present invention, a kind of pharmaceutical composition is provided, it contains above-mentioned dengue fever virus recombinant replication or pseudovirion and pharmaceutically acceptable carrier.
In a fourth aspect of the present invention, the purposes of dengue fever virus recombinant replication of the present invention or pseudovirion is provided, be used to prepare treatment and prevent the medicine of following disease: tumour, virus disease, especially HPV relative disease such as chronic cervicitis, false condyloma, wart sample pathology, pointed condyloma, cervical intraepithelial neoplasia (CIN), cervical cancer.
In a fifth aspect of the present invention, a kind of packing cell that is used to pack above-mentioned dengue fever virus recombinant replication is provided, described packing cell is selected from down group:
(i) quilt is contained the cell of the plasmid transfection of the sub structural protein gene that lacks of dengue fever virus recombinant replication,
(ii) contained dengue fever virus recombinant replication disappearance structural protein gene the helper viral vector cells transfected and
(iii) genome conformity has the cell of the structural protein gene of dengue fever virus recombinant replication disappearance,
And described packing cell can be expressed packing described replicon required singapore hemorrhagic fever structural protein, and the singapore hemorrhagic fever structural protein gene of disappearance does not influence the growth characteristics of cell when expressing therein.
In a sixth aspect of the present invention, a kind of method for preparing pseudovirion is provided, may further comprise the steps:
(i) with the described dengue fever virus recombinant replication of claim 1, perhaps contain the pseudovirion of described replicon, import the packing cell of dengue fever virus;
(ii) when described packing cell is expressed the dengue fever virus structural protein, cultivate described packing cell, thereby produce the pseudovirion of dengue fever virus; Perhaps, when described packing cell is not expressed the dengue fever virus structural protein, helper virus replication is imported this packing cell, wherein said helper virus is expressed the structural protein of dengue fever virus, cultivate described packing cell then, thereby produce the pseudovirion of dengue fever virus;
(iii) reclaim the pseudovirion that contains replicon.
In another preference, described packing cell contains the dengue fever virus structural protein expression vector that is selected from down group: contain the expression vector of the singapore hemorrhagic fever genome sequence that lacks NS3, be subjected to the expression vector of tsiklomitsin regulation and control.
Description of drawings
Fig. 1 is the preparation process synoptic diagram that has shown method 1 among the embodiment 4.
Fig. 2 is the preparation process synoptic diagram that has shown method 4 among the embodiment 4.
Embodiment
The inventor is extensive studies through going deep into, set up is the pseudovirion vaccine technologies of carrier with the dengue fever virus, and made up successfully that security is good, immunizing potency is high, can repeat the dengue fever virus vaccine of the anti-HPV of immunity, finished the present invention on this basis.
As used herein, " nt " is Nucleotide.
As used herein, " releasing member " refers to be positioned at the nucleotide sequence of antigenic peptide encoding sequence element 3 ' end or NS1 signal peptide coding region 5 ends, serve as interpreter into protein after, be used to discharge antigenic polypeptide complete, that do not contain irrelevant sequence.Preferred releasing member is selected from: the nucleotide sequence of signal peptide lytic enzyme substrate shown in the nucleotide sequence of the coding foot and mouth disease virus shown in the SEQ ID NO:3 self lytic enzyme, the coding SEQ ID NO:44, and combination.Releasing member is generally one, but also can be a plurality of.
Term " immunocompetence " or " immunogenicity " refer to the ability by natural, reorganization or intravital specificity humoral of synthetic inducing peptide Mammals and/or cellullar immunologic response.Term used herein " antigenic polypeptide " or " antigenic peptide " refer to cause the aminoacid sequence that mammalian immune is replied, and no matter are to combine (as I or II class major histocompatibility antigen molecule) separately or with accessory molecule.
Term used herein " immunne response " comprises cellularity and/or body fluid immunne response, and they are enough to suppress or protect from infection; Or prevent or the outbreak of the disease that suppresses to cause by microorganism (especially pathogenic microbes).
As used herein, term " object " or " individuality " or " patient " refer to any target, the especially mammalian object, particularly people that need diagnose or treat, and other object comprises ox, dog, cat, cavy, rabbit, rat, mouse, horse etc.
At first, the inventor has confirmed first that through a large amount of tests the structure of dengue fever virus recombinant replication must satisfy following condition:
1. must keep complete nonstructural protein gene sequence.Any excision to structural protein gene must assurance influence the expression of provirus Nonstructural Protein, can not cause Nonstructural Protein and signal peptide generation frameshift variant thereof.
2. the preceding 60nt (being preceding 20 the amino acid whose encoding sequences of C albumen) that must keep the C protein gene is because the complementary annular that forms of this section sequence and 5 '-UTR and 3 '-UTR is dengue fever virus gene replication and the necessary structure of virus packing.When less than 60nt, form the obviously decline of efficient of pseudovirion.Though during greater than 60nt (as 81,99,120,150,180nt) still can form false particle, hold the length of foreign gene can corresponding decline, so preferred range is the preceding 60-150nt that keeps the C protein gene, more preferably before 60-120nt.
3. the signal peptide that must keep complete non-structural protein NS 1, i.e. 24 last amino acid of E albumen.Corresponding coding sequence is the back 72nt of E protein gene.When less than 72nt, form the obviously decline of efficient of pseudovirion, even can not form false particle.Though during greater than 72nt (as 81,99,120,150nt) still can form false particle, hold the length of foreign gene can corresponding decline, so preferred range is to keep 72-150nt, more preferably 60-120nt.
4. the excision of structural protein gene, and, all can not influence the function of NS1 signal peptide in the insertion of excising the site foreign gene.Dengue fever virus structural protein coding region comprises CpreME.Usually can lack the proteic part encoding sequence of CpreME (about usually 100-2000bp, preferably 500-2000bp), certainly, the coding region of leaving out CpreME as much as possible is preferred.Another kind of optimal way is to lack preM fully, to improve security.
Can be used for dengue fever virus of the present invention and be not particularly limited, can be any hypotype dengue fever virus.The visible following accession number of the genome sequence of 4 kinds of hypotypes:
I type M87512
II type M29095
III type M93130
IV type AF289029.
Dengue fever virus has the dendritic cell of having a liking for characteristic, can more effectively improve vaccine curative effect, better efficacy.In addition, the peculiar ADE of dengue fever virus (antibody dependent enhancement of infection, antibody dependent infects and strengthens) phenomenon, promptly for the first time with after the dengue fever virus immunity, when using the immunity of different subtype dengue fever virus once more, antibody dependent infects and strengthens, thereby can carry out the repetition immunity very effectively.The ADE phenomenon is used for the exogenous protein expression system, not only can avoid the neutralizing effect of repetition when immunity body to carrier, and can improve the efficient that carrier enters cell, improves the delivery efficient of foreign protein.Because dengue fever virus has 4 kinds of hypotypes, as the expression of exogenous gene carrier, can pass through the reorganization dengue fever virus replicon booster immunization of inoculation different subtype with it.
Being not particularly limited applicable to foreign gene of the present invention, can be any tumor antigen gene, virus antigen gene and immune-regulating factor gene.Representational antigen example comprises (but being not limited to): people HPV antigen (as the E6-E7 fragment of 16 hypotypes and 18 hypotypes), HIV antigen, HBV antigen, HCV antigen, EBV antigen, HTLV-I antigen, MAGE, BAGE, CAGE etc.Usually the length of foreign gene is not particularly limited, and is about 100-2000bp usually, preferably is 150-1200bp.In addition, downcut for the ease of the antigen of will express, can be at 3 ' the distolateral releasing member (as the 2A sequence) that connects of foreign gene.When the antigen gene that inserts is tumor antigen gene or virus antigen gene, vaccine of the present invention can prevent and treat tumour and virus disease.
With anti-human papillomavirus vaccine is example, the invention provides the preventative vaccine and the therapeutic type vaccine that infect associated diseases at HPV, described vaccine comprises the pseudovirion of being made up of dengue fever virus recombinant replication and dengue fever virus structural protein packing, the encode antigen protein of one or more HPV hypotypes of the exogenous nucleic acid sequences of described dengue fever virus recombinant replication, immune-regulating factor or HPV antigen and immune-regulating factor mixture, the antigen protein of described HPV hypotype can be the E6 of HPV 16 hypotypes or HPV 18 hypotypes, E7, E7-E6 cancer protein or be the main capsid protein L 1 of HPV, less important capsid protein L2, described immune-regulating factor can be IL2, IL12, IL18, GM-CSF etc.Vaccine provided by the invention has shown the advantage of therapeutic vaccine especially.The vaccine of anti-human papillomavirus (HPV) can prevent and treat by the disease due to the parillomarvirus infections, as chronic cervicitis, false condyloma, wart sample pathology, pointed condyloma, cervical intraepithelial neoplasia (CIN) and cervical cancer etc.
When preparation replicon of the present invention, can carry out according to the following steps usually:
(1) genome sequence of the dengue fever virus of structure total length
The PCR of this available routine and interconnection technique realize.
(2) the part-structure gene of disappearance dengue fever virus
This can realize with homologous recombination, and also available artificial method such as complete synthesis realizes.A kind of particularly preferred method is carried out the homologous recombination disappearance in yeast.
(3) insert foreign gene
Though more available ordinary methods are inserted foreign gene in the zone that has lacked the part-structure gene, but preferred method remains at yeast and carries out homologous recombination: add and the homology arm that is inserted into both sides, site sequence homology at the two ends of foreign gene, then the dengue fever virus genomic dna of foreign gene and disappearance structure gene is introduced yeast cell simultaneously, obtain to insert the replicon of foreign gene by homologous recombination.The reorganization incidence of this method is near 100%, and building process is simple relatively, controlled, stable.
After obtaining replicon, can be introduced into packing cell, thereby produce pseudovirion.A kind of ordinary method is after the dengue fever virus replicon is introduced cell, introduces the proteic helper virus of expression structure again.Another kind of preferable methods has adopted the carrier of the plasmid of the plasmid of abduction delivering or constitutive expression as the dengue fever virus structural protein gene; make up the packing cell of abduction delivering; then replicon (or pseudovirion) is directly introduced this this cell, thereby produce pseudovirion.For example, especially use the packing cell of the constitutive expression of not expressing the NS3 gene.The NS3 gene has special packaging signal sequence, the singapore hemorrhagic fever genome of disappearance NS3 gene can not be packaged into pseudovirion, does not therefore have the NS3 gene of dengue fever virus when packing cell, can not oneself's packing form pseudovirion.The pseudovirion that obtains with this packing cell only contains dengue fever virus recombinant replication, need not screening.
Particularly, preferable methods comprises
(a) when thereby packing cell contains (or other controllable express method) that is subjected to the tsiklomitsin regulation and control expresses the expression casette of dengue fever virus structural protein, dengue fever virus rna replicon of reorganization is imported in the packing cell, thereby produce the pseudovirion that comprises the dengue fever virus replicon.
(b) in the dengue fever virus replicon transfered cell with reorganization, after cultivating for some time (as 24 hours), the Alphavirus replicon (or other expression vector) that can express required singapore hemorrhagic fever structural protein imports same cell, thereby produces the pseudovirion that comprises the dengue fever virus replicon.
(c) when the singapore hemorrhagic fever genome behind the packing cell expression cut-out NS3 gene, in the dengue fever virus replicon importing packing cell with reorganization, thereby produce the pseudovirion that comprises the dengue fever virus replicon.
(d) use the pseudovirion cells infected, after cultivation for some time, the Alphavirus replicon particle (or other non-replicating virus vector) that can express required singapore hemorrhagic fever structural protein infects same cell.Thereby produce the pseudovirion that comprises the dengue fever virus replicon.
Pharmaceutical composition
The present invention also provides the various compositions that comprise reorganization dengue fever virus replicon of the present invention and/or pseudovirion, comprises medicinal compositions, especially vaccine composition.These compositions can be used for preventing and/or treating HPV relative disease such as chronic cervicitis, false condyloma, wart sample pathology, pointed condyloma, cervical intraepithelial neoplasia (CIN), cervical cancer.
The various compositions that comprise reorganization dengue fever virus of the present invention can comprise by the selected buffer reagent of practical use; Also can comprise other material that is applicable to intended purpose.Those skilled in the art are good at the buffer reagent selected, and known in the art have numerous buffers to be applicable to intended purpose.In some example, said composition can contain pharmaceutically acceptable vehicle, and known in the art have multiple and need not to go through at this.Pharmaceutically acceptable various vehicle comprises as " Remington: pharmacy and pharmacy practice " the 19th edition (1995) Mack Publishing Co. at the existing detailed description of multiple publication.
Medicinal compositions can be prepared into various formulations, as injection, granula, tablet, pill, suppository, capsule, suspension, sprays etc.Be applicable to pharmaceutical grade other organic or inorganic carrier and/or thinner of oral or local use, can be used for preparing the various compositions that comprise therapeutical active compound.Thinner known in the art comprises aqueous medium, vegetalitas and animality oil ﹠ fat.The salt of also available stablizer, wetting agent and emulsifying agent, change osmotic pressure or keep the various buffer reagents of suitable pH value and skin penetration enhancer etc. as complementary material.
When as vaccine, reorganization dengue fever virus of the present invention can adopt the whole bag of tricks to prepare.Usually, by the whole bag of tricks well known in the art, prepare vaccine of the present invention with suitable pharmaceutical carrier and/or vehicle (vehicle).Suitable carriers is a Sterile Saline.Also can use other water-based and non-aqueous isotonic sterile injection liquid and water-based and non-aqueous sterile suspensions (known all is pharmaceutically acceptable carrier, also is well-known to those skilled in the art) for this reason.
In addition, the preparation of vaccine composition of the present invention also can contain other composition, comprises as adjuvant, stablizer, pH regulator agent, sanitas etc.These compositions are that the vaccine those skilled in the art are known.The adjuvant class comprises (but being not restricted to) aluminium salt adjuvant; Saponin adjuvant; The Ribi adjuvant (Ribi ImmunoChem Research In., Hamilton, MT); Montanide ISA adjuvant (Seppic, Paris, France); Hunter ' sTiterMax adjuvant (CytRx Corp., Norcross, GA); The Gerbu adjuvant (Gerbu BiotechnikGmbH, Gaiberg, Germany) etc.In addition, in preparation, also can comprise other composition of regulating immunne response.
Route of administration and dosage
When as vaccine, available known method is applied to individuality with reorganization dengue fever virus replicon of the present invention and/or pseudovirion.Usually adopt route of administration identical and/or simulation pathogenic infection path to use these vaccines with conventional vaccine.In the time of can adopting the form of vaccine composition, except that reorganization Dengue virus is arranged, also can comprise pharmaceutically acceptable carrier.In addition, this composition also can comprise adjuvant, correctives or stablizer etc.
The routine of administration and pharmaceutically acceptable approach comprise: in the nose, interior, the intravenously of interior, subcutaneous, the intracutaneous of intramuscular, tracheae, intravaginal, lung, intranasal, oral administration or other administered parenterally approach.If desired can the combination medicine-feeding approach, or regulate by antigen peptide or disease situation.Vaccine composition can single dose or multiple doses give, and can comprise and give booster dose to cause and/or to keep immunizing power.
Should in selected administration path, be enough to cause immunne response with the amount that " significant quantity " gives dengue fever virus recombinant replication and/or pseudovirion, can impel the protection host to resist symptoms such as HPV virus infection, tumour effectively.
The selected dengue fever virus replicon and/or the amount of pseudovirion in each vaccine dose part are not have the amount of significant side effects by causing protective immune response and decide.Usually, behind host cells infected, the vaccine of each agent part is enough to produce about 1-1000 μ g, preferably is 1-200 μ g, more preferably 10-100 μ g antigen protein.With reorganization dengue fever virus nucleic acid is the vaccine effective dose of basic calculation, generally includes about 1-1000 μ g nucleic acid.In addition, the general range of the effective dose of vaccine is about 10
2-10
9, 10
3-10
7Or 10
4-10
5Plaque forming unit (PFU).The available research on standard method of the antigen titration degree in the object of observation and other reaction that comprises determines that the optimum amount of concrete vaccine can determine whether that needs strengthen dosage by the immunity level that the monitoring vaccine provides.After having assessed the antigen titration degree in the serum, may need to select for use enhancing dosage immunization.Using adjuvant and/or immunostimulant just can improve proteinic immunne response of the present invention.
Compare with prior art, the present invention has following major advantage:
1. improved immune validity:
(1) dendritic cell is effective antigens presenting cells.Utilizing dengue fever virus to have to have a liking for the characteristic of dendritic cell in the present invention, is carrier with dengue fever virus recombinant replication, express and offer antigen expeditiously in above-mentioned infected cells, thereby excitating organism is at antigenic effective immunity.
(2) utilize characteristic and the ADE phenomenon that veriform dengue fever virus can superinfection to carry out the repetition immunity, improve immune effect.
(3) be tumour antigen be again virus antigen gene E6, E7 the reorganization the dengue fever virus replicon can in cell, express E6, E7 antigen for a long time, stimulating immune system is to antigenic immune response effectively.
2. improve the security of vaccine:
(1) the dengue fever virus replicon is from RNA viruses reorganization, and the duplicating and express fully and carry out in tenuigenin of replicon is difficult to oncogene is recombinated in the karyomit(e) of human body cell.
(2) Chong Zu dengue fever virus replicon is the reorganization dengue fever virus RNA that removes structural protein gene.Can only in human body cell, duplicate and express, can not form infectious virion, can not carry out superinfection peripheral cell.
(3) immunity system has the reorganization identification of replicon and the ability of removing, and replicon is long-term existence in vivo not, and security is good.
3. treatment is painful little:
(1) administration number of times few (2～3 times) reduces the misery that therapeutic process brings the patient.
(2) instant effect has shortened treatment course of treatment;
4. production cost is low:
(1) packing cell that can express the singapore hemorrhagic fever structural protein with the sub-transfection of dengue fever virus recombinant replication produces pseudovirion, infect packing cell once more with pseudovirion and can produce a large amount of pseudovirions, the preparation efficiency of pseudovirion is improved greatly, a large amount of replicons that make up have been avoided needing to repeat simultaneously, thereby shortened the production of vaccine flow process, improved the production efficiency of vaccine, the products production cost reduces.
(2) do not express the packing cell of the constitutive expression of NS3 gene with the sub-transfection of dengue fever virus recombinant replication, produce pseudovirion.The NS3 gene has special packaging signal sequence, the singapore hemorrhagic fever genome of disappearance NS3 gene can not be packaged into pseudovirion, therefore can not self-ly pack when packing cell and form pseudovirion.The pseudovirion that obtains with this packing cell all contains dengue fever virus recombinant replication, need not screening, has improved the preparation efficiency of pseudovirion.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The dengue fever virus cDNA clone's of total length preparation process
1. the dengue fever virus cDNA of total length is incorporated in the pRS424 plasmid (Plasmid) the dengue fever virus cDNA clone of preparation total length.Described dengue fever virus II type NGC (ATCC#:VR-1255) and pRS424 plasmid (ATCC#:77105) are available from American type culture collection (ATCC).
A) method with RT-PCR changes into three sections dengue fever virus cDNA fragments (5 ' end cDNA, 3 ' end cDNA and interlude cDNA) to dengue fever virus RNA, adds Xba I restriction enzyme site and Sp6 enhancer sequence at 5 of 5 ' end cDNA segment ' end; Add Sac I enzyme site at 3 of 3 ' end fragment ' end; Two of intermediate segment comprises part and the gene order that 5 of 3 of 5 ' end cDNA segment ' end and 3 ' end cDNA segment ' end is identical.
The sequence of employed dna primer is as follows:
| Primer | Sequence (5 '-3 ') | SEQ ID NO： |
| 1a. | TGCACATTCGCTCTAGAATTTAGGTGACACTATAGAGTTGTTAGTCTACGTGGACC | 6 |
| 1b. | GCTTCCCGGAGGAGTGGC | 7 |
| 2a. | GACCCAGCAAGTATAGCG | 8 |
| 2b. | GACATGGGGATGGGTTCTTCA | 9 |
| 3a. | ACATGCTTCGACCTCGAGGTGGACCTCGGTTGCGGCAGA | 10 |
| 3b. | CTGGAATCAGCTGAGCTCAGAACCTGTTGATTCAACAGCACCATTCCATTTTCTGGCG | 11 |
Obtain three dengue fever virus cDNA fragments, length is respectively 5484bp, 2530bp and 2922bp.
B), then 3 ' end fragment is connected in the pRS424 plasmid with the method that tradition connects earlier 5 ' end fragment.
C) utilize the DNA of identical sequence in yeast to recombinate, intermediate segment is inserted among the above-mentioned clone, produce the dengue fever virus cDNA clone pRS/FLD2 of total length.
2. the cDNA clone who prepares the dengue fever virus replicon of the sequence of having removed the dengue fever virus structural protein
A) the dengue fever virus cDNA clone pRS/FLD2 of the total length that produces in dengue fever virus cDNA sequence (Gene Bank accession number: (inherent BamH I restriction enzyme site on the dengue fever virus gene) is the c of above-mentioned steps 1 on 1696 or 2203 position AF038403)) with BamH I restriction endonuclease cuts into linearity.
B) with the method for Fusing PCR, prepare one section 96 long dna fragmentation of base, this segmental 5 ' end contains the 6th to the 20 codon that 45 base pairs derive from structural protein; Segmental 3 ' end contains the 751st to the 766th codon that 45 base pairs derive from structural protein; This segmental middle part comprises the restriction enzyme site of a BamH I.The sequence of described dna fragmentation is shown in SEQ ID NO:5.
C) the cDNA fragment and the activatory yeast of the pRS/FLD2 of linearity, 96 bases length are added in the yeast conversion fluid (PEG damping fluid) together, 30 degree insulations Celsius a hour, the cDNA fragment that linear pRS/FLD2 and 96 bases are long can be transformed in the yeast automatically.After cultivating two days on the microzyme culture medium, the yeast bacterium colony that can obtain transforming.The DNA reorganization of utilization identical sequence in yeast, 96 long cDNA fragments of base can replace the sequence (sequence table SEQ ID NO:4) of dengue fever virus structural protein automatically, produce the cDNA clone of the dengue fever virus replicon of the sequence of having removed the dengue fever virus structural protein in a large number.(it is sub the same to have removed the reorganization HPV dengue fever virus rna replicon that produces among dengue fever virus rna replicon of sequence of dengue fever virus structural protein and the embodiment 3, four kinds of Packaging Methods of among the available embodiment 4 all are prepared into the sub-pseudovirion of dengue fever virus rna replicon, as zooperal contrast.)
Embodiment 2:
Preparation HPV E7-E6-2A dna fragmentation
(i) wherein the E7-E6 sequence is oncogene (the Gene Bank accession number: AF486352 of HPV; AF469197; AF472508), shown in SEQ ID NO:1,256 the amino acid whose antigens (SEQ IDNO:2) of encoding.
(ii) described 2A is the gene fragment of foot and mouth disease virus, and by 60 based compositions, its gene order is shown in sequence table SEQ ID NO:3.
Being template with HPV-16 plasmid (ATCC#:45113D) (iii), is a pair of primer with GCGAGAAATACGCCTTTCAATATGCTGAAACGCGAGAGAAACATGCATGGAGATAC ACCTACA (SEQID NO:12) and TGCAGTTCTCTTTTGGTGCATTGGTTTCTGAGAACAGATGGG (SEQ ID NO:13) respectively; And with ATGCACCAAAAGAGAACTGCA (SEQ ID NO:14) and AAGGTCAAAATTCAACAGCTGGGTTTCTCTACGTGT (SEQ ID NO:15) be another to primer, prepare E6 and E7 cDNA fragment with PCR method.Segmental 5 ' the end 21nt of E6 cDNA is identical with the partial sequence of the segmental 3 ' end of E7 cDNA, segmental 3 ' the end 21nt of E6 cDNA is identical with the partial sequence of the pulsating 5 ' end that contains 2A, and segmental 5 ' the end parts sequence of E7 cDNA is identical with singapore hemorrhagic fever II C-type virus C cDNA nt 108-124 sequence.With CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGG CCCC (SEQID NO:3) and ATACAGCGTCACGACTCCCACCAATACTAGTGACACAGACAGTGAGGTGCTGGGGC CAGGGTTGGACTCGAC (SEQ ID NO:16) is primer, identical with singapore hemorrhagic fever II C-type virus C cDNA nt 2275-2325 sequence with its 3 ' end parts sequence of the fragment that contains 2A of a 111bp of method preparation who merges PCR.
4. E6 cDNA fragment, E7 cDNA fragment and the 111bp fragment that contains 2A are placed on simultaneously and are template in the PCR reaction tubes, hold primer with GCGAGAAATACGCCTTTCAATATGCTGAAACGCGAGAGAAACATGCATGGAGATAC ACCTACA (SEQ ID NO:17) as E7 cDNA segmental 5 ', with ATACAGCGTCACGACTCCCACCAATACTAGTGACACAGACAGTGAGGTGCTGGGGC CAGGGTTGGACClontech company).This plasmid can be expressed a kind of regulation protein, is called " the contrary activator of tsiklomitsin control ", and this albumen participates in the regulation and control that gene expression plasmid is transcribed.This gene expression system comprises that pTet-Off regulates carrier (regulator vectors), pTRE2 reaction carriers (response vector), and pTK-Hyg selects carrier (selection vector).
1. dengue fever virus structural protein gene (the dengue fever virus structural protein gene of complete 2328bp) (sequence table SEQ ID NO:4) is inserted into the pTRE2 reaction carriers of the gene expression system of tsiklomitsin regulation and control.Specifically: the dengue fever virus cDNA clone (being the pRS/FLD2 plasmid) with total length is a template, with ATATCCCCGCGGATGAATAACCAACGAAAAAAGGCG (SEQ ID NO:19) and ATATATCTAGACTAGGCCTGCACCATAACTCCCAA (SEQ ID NO:20) is a pair of primer, prepares CpreME cDNA fragment with PCR method.CpreME cDNA fragment and pTRE2 (Clontech company) are digested with Xba I and Sac II.With Qiagen spin column (QIAGEN Inc.) enzyme is cut product and carry out purifying.Above-mentioned two dna fragmentations are connected with T4 ligase enzyme (New England Biolab company), and be converted in the intestinal bacteria, thereby the clone produces the pTRE2 plasmid of dengue fever virus structural protein gene reorganization.
2. with the method for electric shock pTet-Off is regulated carrier (regulator vector) and be transformed in the BHK-21 cell, screening obtains BHK-21 Tet-of cell strain then.
3. with the gene expression system of the tsiklomitsin regulation and control of the insertion dengue fever virus structural protein gene that produces in the step 1, method with electric shock is converted into BHK-21 Tet-off (Baby hamster kidney), obtains regulating the BHK-21 cell strain with high expression level dengue fever virus structural protein.
4. reorganization HPV dengue fever virus rna replicon that produces among the embodiment 3 is transformed above-mentioned cell strain with the method that shocks by electricity.After one day, the gene expression system of tsiklomitsin regulation and control is induced this cell strain high expression level dengue fever virus structural protein.After ten days, collect the nutrient solution supernatant, can obtain the every milliliter 104 sub-pseudovirion of packing of reorganization HPV dengue fever virus rna replicon.
Method two: utilize Sindbis rna replicon preparation vaccine
1. the structural protein gene fragment for preparing dengue fever virus:
A) pRS/FLD2 with the preparation of the 1st step c) of embodiment 1 is a template, with CCTCTAGCTAGAGCTTACCATGAATAACCAACGAAAAAAG (SEQ ID NO:21) and GATTAGAGCTCTTATCTGCGTCTCCTGTTCAAGAT (SEQID NO:22) is primer, prepares the C coding region dna fragmentation of dengue fever virus structural protein gene with the method for PCR.
B) pRS/FLD2 with the preparation of the 1st step c) of embodiment 1 is a template, with GCGCTCTAGAATGACTGCAGGCATGATCATTATG (SEQ ID NO:23) and ATGCCAGTAGGACAGGTGTAATCTAGGCCTGCACCATAACTCCCAA (SEQ ID NO:24) is primer, prepares the preM-E coding region dna fragmentation of dengue fever virus structural protein gene with the method for PCR.
C) be template with SindbisRNA replicon cDNA clone (STRATAGENE company), with ATTACACCTGTCCTACTGGCA (SEQ ID NO:25) and CATGGTAAGCTCTAGCTAGAG (SEQ ID NO:26) is primer, prepares Sindbis 26S dna fragmentation with the method for PCR.
D) the 21nt sequence of 3 of preM-E coding region dna fragmentation ' end is identical with the portion gene sequence of 5 of Sindbis 26S dna fragmentation ' end.3 of Sindbis 26S dna fragmentation ' end 22nt sequence is identical with the portion gene sequence of 5 of C coding region dna fragmentation ' end.
E) be template with C coding region dna fragmentation, preM-E coding region dna fragmentation and Sindbis 26S dna fragmentation, with GCGCTCTAGAATGACTGCAGGCATGATCATTATG (SEQ ID NO:27) and GTATAGAGCTCTTATCTGCGTCTCCTGTTCAAGAT (SEQ ID NO:28) is primer, prepares the preME-26S-C fragment with the method for fusing PCR.
2. set up Sindbis rna replicon of dengue fever virus structural protein gene reorganization.
A) preME-26S-C fragment and the SindbisRNA replicon cDNA clone (STRATAGENE company) with preparation in the step 1 digests with Xba I and Sac I.With Qiagen spincolumn (QIAGEN Inc.) digestion product is carried out purifying.Above-mentioned two dna fragmentations are connected with T4 ligase enzyme (New England Bio lab), and be converted in the intestinal bacteria, the clone produces the sub-cDNA clone of Sindbis rna replicon of dengue fever virus structural protein gene reorganization, and carries out purifying with Qiagen spin column (QIAGEN Inc.).
B) the sub-cDNA clone of the Sindbis rna replicon linearizing of the dengue fever virus structural protein gene that produces in the step a) being recombinated with Xho I restriction endonuclease;
C) the SindbisRNA replicon cDNA clone who linearizing dengue fever virus structural protein gene is recombinated with DNA dependency Sp6 RNA polymerase (DNA dependent Sp6 RNApolymerase) is transcribed into RNA, promptly obtains Sindbis rna replicon of dengue fever virus structural protein gene reorganization.
3. with the reorganization HPV dengue fever virus rna replicon transfection BHK-21 cell (ATCC#:CCL-10) that produces among the embodiment 3, after 24 hours, with the c of above-mentioned steps 2) in Sindbis rna replicon this cell of transfection once more of the dengue fever virus structural protein gene reorganization that produces.Twice transfection all is the method with electric shock, 0.4cm Gene Pulser Cuvette, 200 V/950uF.One to two days later, collects the substratum supernatant, can obtain every milliliter 10
4-10
5The sub-pseudovirion of reorganization HPV dengue fever virus rna replicon.
Method three: utilize the pseudovirion of Sindbis rna replicon to prepare vaccine
1. with the c of method two step 2) in the SindbisRNA replicon of the dengue fever virus structural protein gene reorganization that produces and DH-BB RNA (available from STRATAGENE) simultaneously with the method transfection BHK-21 cell (ATCC#:CCL-10) of electric shock, after three to five days, collect the substratum supernatant, can obtain the pseudovirion of Sindbis rna replicon of dengue fever virus structural protein gene reorganization.
2. infect BHK-21 cell (ATCC#:CCL-10) with the sub-pseudovirion of the reorganization HPV dengue fever virus rna replicon that produces in the method two step 3.After 24 hours, the pseudovirion of Sindbis rna replicon of the dengue fever virus structural protein gene reorganization that produces in the usefulness above-mentioned steps 1 is this cell of subinfection again.After 24-48 hour, collect the substratum supernatant, can obtain every milliliter 10
5-10
6The sub-pseudovirion of reorganization HPV dengue fever virus rna replicon.
Method four: the BHK-21 package cell line of setting up the dengue fever virus cDNA conversion that is lacked by NS3
With pCI (available from PROMEGA, USA) as template, with 5 ' CMV and 3 ' CMV as primer, method with PCR prepares CMV (cytomegalovirus, cytomegalovirus) dna fragmentation (being called for short CMV), the dna fragmentation of CMV is as early stage enhanser and promotor, and its length is 631bp (SEQ IDNO:29).PRS/FLD2 with the preparation of the 1st step c) of embodiment 1 is a template, as primer, prepares the 5 ' end fragment (vehicle economy N5 ' end) of dengue fever virus cDNA with 5 ' DEN5 ' end and 3 ' DEN5 ' end with the method for PCR.As template, as primer, prepare the dna fragmentation (being called for short CMV-DEN5 ' end) of CMV-DEN5 ' end with the method for fusing PCR with an above-mentioned company dna fragmentation with 5 ' CMV and 3 ' DEN5 ' end.
2. the dna fragmentation of the CMV-DEN5 ' end that step 1 is produced and pRS424 plasmid (ATCC#:77105) carry out enzyme with Kpn I and Apa I and cut.With Qiagen spin column (QIAGEN Inc.) digestion product is carried out purifying.Above-mentioned two dna fragmentations are connected with T4 ligase enzyme (available from New England Biolab), and be converted in the intestinal bacteria.Screening produces CMV-DEN5 ' end clone (being called for short pRS/CMV-DEN5 ' end).
3. the pRS/FLD2 with the preparation of the 1st step c) of embodiment 1 is a template, as primer, prepares the 3 ' end fragment (vehicle economy N3 ' end) of dengue fever virus cDNA with 5 ' DEN3 ' end and3 ' DEN3 ' end with the method for PCR.As primer, prepare hepatitis delta virus antigen mass formed by blood stasis ribozyme (hepatitis delta virus antigenomic ribozyme, dna fragmentation HDVr) (being called for short HDVr, SEQ ID NO:30) with 5 ' HDVr and 3 ' HDVr with the method for PCR.(,, as primer, prepare the dna fragmentation (being called for short pA) of Trobest polyA (bovine growth hormone poly A, BGH pA) with the method for PCR with pcDNA3 with 5 ' pA and 3 ' pA USA) as template available from INVITROGEN.With above-mentioned three fragments is template, as primer, prepares the dna fragmentation of DEN3 ' end-HDVr-pA with 5 ' DEN3 ' end and 3 ' pA with the method for fusing PCR.
The sequence of employed dna primer is as follows:
| Primer | Sequence (5 '-3 ') | SEQ ID NO： |
| 5’CMV | GCGCGCGGTACCTTGACATTGATTATTGACTAGTTA | 31 |
| 3’CMV | GGTCCACGTAGACTAACAACTCGGTTCACTAAACGAGCTCTG | 32 |
| 5’DEN5’end | AGTTGTTAGTCTACGTGGACC | 33 |
| 3’DEN5’end | CCCTGCAGCATTCCAAGTGAG | 34 |
| 5’DEN3’end | CTCACTTGGAATGCTGCAGGGCCCAAGGTGAGATGAAGCTGT | 35 |
| 3’DEN3’end | GTGGAGATGCCATGCCGACCCAGAACCTGTTGATTCAACAGC | 36 |
| 5’HDVr | GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCATCCG | 37 |
| 3’HDVr | CTCCCTTAGCCATCCGAGTGGACGTGCGTCCTCCTTCGGATGCCCAGGTCGGACC | 38 |
| 5’pA | CCACTCGGATGGCTAAGGGAGAATAAAATGAGGAAATTGCATCGC | 39 |
| 3’pA | TATATCCGCGGATAGAATGACACCTACTCAGACAA | 40 |
4. the dna fragmentation of the pRS/CMV-DEN5 ' end that above-mentioned steps 2 is generated and the DEN3 ' end-HDVr-pA of step 3 generation carries out enzyme with Apa I and Sac II and cuts, and with Qiagen spin column (QIAGENInc.) digestion product is carried out purifying.Above-mentioned two dna fragmentations are connected with T4 ligase enzyme (available from NewEngland Bio lab), and be converted in the intestinal bacteria.Screening produces the clone of pRS/CMV-DEN5 ' end-DEN3 ' end-HDVr-pA.
5. the clone of the pRS/CMV-DEN5 ' end-DEN3 ' end-HDVr-pA that above-mentioned steps 4 is generated carries out enzyme with Apa1 and cuts, and the pRS/FLD2 of the 1st step c) preparation of embodiment 1 is carried out enzyme with Xba1 and Sac I cut.Above-mentioned enzyme is cut product carry out purifying, and purified product is converted into yeast, utilize the DNA reorganization of identical sequence in yeast, generated the cDNA clone (being called for short pRS/CMV/D2) of dengue fever virus rna replicon of total length.
6. the cDNA of dengue fever virus rna replicon of the total length that step 5 is produced clone (pRS/CMV/D2) carries out enzyme with Xho I and cuts, and the cDNA that obtains dengue fever virus rna replicon of linearizing total length clones.With CAGACTGAAAAAAGTATTGAAGACAATCCAGAGATCGAAGGAATTAAGAACAACCA AATC (SEQ ID NO:41) and CTCCACATTTTCCAAGATTTGGTTGTTCTTAATTCC (SEQ ID NO:42) is primer, method with PCR generates the long dna fragmentation of a 75bp, and its sequence is CAGACTGAAAAAAGTATTGAAGACAATCCAGAGATCGAAGGAATTAAGAACAACCA AATCTTGGAAAATGTGGAG (SEQ ID NO:43).The dna fragmentation that the cDNA clone and the 75bp of dengue fever virus rna replicon of above-mentioned linearizing total length grown together is converted into yeast, the DNA reorganization of utilization identical sequence in yeast, the part NS3 coding region gene sequence (nt 5059-6215) of dengue fever virus rna replicon of linearizing total length is cut, and has obtained the cDNA clone of the dengue fever virus of NS3 disappearance.
With the cDNA cloned DNA of the dengue fever virus of the NS3 disappearance that produces in the above-mentioned steps 6 and pcDNA3 (available from INVITROGEN, USA) transfection BHK-21 cell (ATCC#:CCL-10) simultaneously.This cell cultures is after one day, be converted to contain G418 (available from SIGMA, cell culture fluid USA).With the cell strain of the anti-G418 of reorganization HPV dengue fever virus rna replicon conversion that produces among the embodiment 3, pick out package cell line.The output of this clone can reach 10
6The sub-pseudovirion of reorganization HPV dengue fever virus rna replicon.
Embodiment 5
The experimentation on animals report of HPV virus vaccines:
In order to confirm the immune curative effect of HPV virus vaccines, we have tested the influence of HPV virus vaccines to the C57BL/6 mouse tumor model.
With JHU-1 HPV tumor cell inoculation C57BL/6 mouse as tumor model: JHU-1 HPV tumour cell contains the E6/E7 oncogene of HPV virus.With 1 * 10
5JHU-1 HPV tumour cell at the PBS of 500 microlitres damping fluid, be injected into the navel belly (FLANK) of big C57BL/6 mouse of eight weeks.The JHU-1HPV tumour cell can 100% induces substantial tumour.Injecting JHU-1 HPV tumour cell after seven days, it is fast to touch tumour.And behind fortnight, the tumour that derives can be more than 6mm.
The treatment plan of HPV virus vaccines: whole experiment is divided into four groups, every group of eight C57BL/6 mouse.
| Navel belly injection in first day | Injected back 14 days | Injected back 21 days | Injected back 35 days | |
| First group: the normal control group | The analysis of HPV E6/E7-specific C D8+T-cell | |||
| Second group: the |
1×10 5JHU-1 CELLS | 10 7The PFU pseudovirion | The 107PFU pseudovirion | |
| The 3rd group: the |
1×10 5JHU-1 CELLS | 10 7PFU HPV-Vac | 10 7PFU HPV-Vac | |
| The 4th group: the vaccine control group | PBS 500 microlitres | 10 7PFU HPV-Vac | 10 7PFU HPV-Vac | HPV E6/E7-specific C D8 +The analysis of T-cell |
PFU＝Infectious Particle of HPV replion-containing VLP
Every mouse navel belly injection 1 * 10 in tumour control group and vaccine therapy group
5JHU-1CELLS, after injecting the JHU-1 cell fortnight, the subcutaneous injection 10 respectively of vaccine therapy group and vaccine mice in control group
7The effective vaccine particle.And after seven days, subcutaneous once more injection 10
7The effective vaccine particle of PFU is as appending treatment.
1.HPV the observation of virus vaccines immunity curative effect:
A. when mouse inoculation behind the JHU-1 HPV tumour cell, observation in per two days and measure the growth of tumor situation and the tumour size.
B. use the method for cell inner dyeing and fluidic cell mensuration (FLOW CYTOMETRY) to HPV E6/E7-specific C D8
+The analysis of T-cell.When the fortnight of vaccine mice in control group behind subcutaneous injection second time HPV-VAC, spleen cell is separated, then with fluorescently-labeled IFN-γ and the dyeing of TNF-Alpha antibodies.The IFN-and the TNF of the cell surface after the dyeing detect with flow cytometer.
2. experimental result:
TCGAC (SEQ ID NO:18) obtains the E7-E6-2A cDNA fragment of total length as segmental 3 ' the end primer that contains 2A with the method for PCR, and these pulsating two ends comprise respectively partly and the identical sequence of dengue fever virus cDNA gene.
Embodiment 3:
Integrate the process of HPV virogene to dengue fever virus rna replicon
1. with the dengue fever virus cDNA clone (being called for short pRS/FLD2) of the total length of the 1st step c) of embodiment 1 preparation.Be cut into linearity with BamH I restriction endonuclease.
2. with the dengue fever virus cDNA of linearity clone (pRS/FLD2) and HPV E7-E6-2A cDNA fragment transformed yeast bacterium (yeast) together, in the process of saccharomycetic dna replication dna, HPV E7-E6-2A cDNA fragment can be incorporated among the dengue fever virus cDNA clone automatically, and the gene order (comprising C coding region sequence, M coding region sequence and E coding region sequence) of replacement dengue fever virus structural protein, the cDNA that produces a large amount of cyclic HPV-dengue fever virus rna replicon clones (being pRS/D2-HPV16).
3. the cDNA clone of HPV-dengue fever virus rna replicon that produces in the step 2 is come out with Qiagencolumn (QIAGEN Inc.) purifying in the yeast.
4. the cDNA clone with HPV-dengue fever virus rna replicon of yeast preparation transforms Stab12TM bacterium (available from American I nvitrogen company), and the cDNA clone of a large amount of HPV-dengue fever virus rna replicon can prepare with this system.
5. with Sac I restriction endonuclease the cDNA of HPV-dengue fever virus rna replicon clone's 3 ' end is cut into linearity.
6. with DNA dependency Sp6 RNA polymerase (DNA dependent Sp6 RNA polymerase) the cDNA clone of HPV-dengue fever virus rna replicon after modifying is transcribed into RNA, HPV dengue fever virus rna replicon promptly obtains recombinating.
7. with the method (electroporation) that shocks by electricity, to recombinate the sub-transfection of HPV dengue fever virus rna replicon to host cell BHK-21 (Baby hamster kidney) (ATCC#:CCL-10) in, reorganization HPV dengue fever virus rna replicon can duplicate and express the E7-E6 albumen of HPV in host cell.
Embodiment 4:
The quadruplet preparation method of HPV virus vaccines
Method one: utilize the gene expression system of tsiklomitsin regulation and control to prepare vaccine
The method general introduction: utilize the gene expression system of tsiklomitsin regulation and control, transform BHK-21 (Baby hamsterkidney) (ATCC#:CCL-10), developing one can be by the clone of regulating and expressing dengue fever virus structural protein.(Tet-Off Gene Expression systems is available from the U.S. for the gene expression system of tsiklomitsin regulation and control
A) the HPV virus vaccines is to the influence of tumor growth
The tumour control group
| JHU-1 CELLS navel belly injection back fate | Tumour | Tumour mm mouse #2 | Tumour mm mouse #3 | Tumour mm mouse #4 | Tumour mm mouse #5 | Tumour mm mouse #6 | Tumour mm mouse #7 | Tumour mm mouse #8 |
| Injected back 14 days | 6 | 6 | 7 | 7 | 7 | 8 | 8 | 8 |
| Injected back 21 days | 12 | 14 | 15 | 15 | 16 | 16 | 17 | 17 |
| Injected back 28 days | 15 | 16 | 17 | 18 | 18 | 18 | 19 | 20 |
| Injected back 35 days | 19 | 22 | ＞25 * | ＞25 | ＞25 | ＞25 | ＞25 | ＞25 |
*If the intravital tumour of mouse is greater than after 25 millimeters, this mouse just no longer keeps.
The vaccine therapy group
| JHU-1 CELLS navel belly injection back fate | Tumour | Tumour mm mouse #2 | Tumour mm mouse #3 | Tumour mm mouse #4 | Tumour mm mouse #5 | Tumour mm mouse #6 | Tumour mm mouse #7 | Tumour mm mouse #8 |
| Injected back 14 days | 6 | 7 | 7 | 7 | 7 | 8 | 8 | 8 |
| Injected back 21 days | 3 | 5 | 5 | 6 | 6 | 7 | 9 | 10 |
| Injected back 28 days | 0 | 0 | 0 | 0 | 2 | 4 | 8 | 10 |
| Injected back 35 days | 0 | 0 | 0 | 0 | 0 | 4 | 9 | 11 |
We observe, in the vaccine therapy group, when 1 * 10
5JHU-1 CELLS was injected into the navel belly of C57BL/6 mouse after 14 days, can induce the real piece of the above tumour of 6mm.During this time, we give these mouse subcutaneous injections 10
7PFU HPV-Vac.In injection two days later, can observe most tumour and begin to dwindle.After seven days, we append vaccine (10 again one time
7PFU HPV-Vac).In a week after finishing twice vaccination, the intravital tumour of 50% mouse disappears substantially.There is the tumours of two mouse to have obviously and dwindles, but have the tumours of two mouse that the trend of slow growth is arranged.At the tumour control group, when 1 * 10
5JHU-1CELLS was injected into the navel belly of C57BL/6 mouse after 35 days, and the intravital tumour of 75% mouse is greater than 25.
B) the HPV virus vaccines is to HPV E6/E7-specific C D8
+The T-cell influence
| IFN-γ | TNF-α | |
| Normal control group (first group) | 0.04％ | 0.08％ |
| Vaccine control group (the 4th group) | 1.5％ | 1.28％ |
We measure the HPV virus vaccines to HPV E6/E7-specific C D8 with the method for cell inner dyeing
+The influence of T-cell, and observe the HPV virus vaccines and can activate CD8
+T-emiocytosis IFN-γ and TNF-α.
Embodiment 6
Make up different II type dengue fever virus vaccines
In the present embodiment, made up following II type dengue fever virus recombinant replication by embodiment 1,2 with 3 described identical methods, difference only is that C protein gene 5 ' sequence is different with NS1 protein signal peptide length.And with the method among the embodiment 44 preparation pseudovirions.The result is as follows:
| The C protein gene length that keeps | The E protein gene length that keeps | The exogenous array that inserts | Can duplicate and express | Can in producing cell, pack |
| 30 | 72 | Do not have | Not | Not |
| 60 | 45 | HPV16 E7-E6-2A | Not | Not |
| 120 | 72 | HPV16 E7-E6-2A | Be | Be |
| 15 | 30 | HPV16 E7-E6-2A | Not | Not |
| 90 | 120 | HPV16 E7-E6-2A | Be | Be |
| 90 | 150 | HPV16 E7-E6-2A | Be | Be |
| 120 | 72 | HPV16 E7-E6 | Not | Not |
Embodiment 7
Make up I type dengue fever virus vaccine
In the present embodiment, made up following dengue fever virus recombinant replication by embodiment 1,2 with 3 described identical methods, difference only is with the II type dengue fever virus among the I type dengue fever virus alternative embodiment 1-3, then with the 4 preparation pseudovirions of the method among the embodiment 4.Then, press the same approach administration of treatment group among the embodiment 5, laboratory animal is 4 mouse that tumour does not disappear among the embodiment 5.
As a result, 4 tumours of merely hitting 3 mouse are obviously dwindled.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Tianjia Biological Meidicne Co., Ltd., Shanghai
Tengen Biomedical Company
Dongfang Tianjia Tech Development Co., Ltd. Beijing
＜120〉anti-human papillomavirus vaccine
<130>040528
<150>CN 03115273.2
<151>2003-01-30
<160>44
<170>Patentln version 3.1
<210>1
<211>768
<212>DNA
＜213〉human papillomavirus (Human papillomavirus)
<400>1
atgcatggag atacacctac attgcatgaa tatatgttag atttgcaacc agagacaact 60
gatctctact gttatgagca attaaatgac agctcagagg aggaggatga aatagatggt 120
ccagctggac aagcagaacc ggacagagcc cattacaata ttgtaacctt ctgttgcaag 180
tgtgactcta cgcttcggct gtgcgtacaa agcacacacg tagacattcg tacgttggaa 240
gacctgttaa tgggcacact aggaattgtg tgccccatct gttctcagaa accaatgcac 300
caaaagagaa ctgcaatgtt tcaggaccca caggagcgac ccagaaagtt accacagtta 360
tgcacagagc tgcaaacaac tatacatgat ataatattgg aatgtgtgta ctgcaagcaa 420
cagttactgc gacgtgaggt atatgacttt gcttttcggg atttatgcat agtatataga 480
gatgggaatc catatgctgt atgtgataaa tgtttaaagt tttattctaa aattagtgag 540
tatagacatt attgttatag tttgtatgga acaacattag aacagcaata caacaaaccg 600
ttgtgtgatt tgttaattag gtgtattaac tgtcaaaagc cactgtgtcc tgaagaaaag 660
caaagacatc tggacaaaaa gcaaagattc cataatataa ggggtcggtg gaccggtcga 720
tgtatgtctt gttgcagatc atcaagaaca cgtagagaaa cccagctg 768
<210>2
<211>256
<212>PRT
＜213〉human papillomavirus (Human papillomavirus)
<400>2
Met His Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp Leu Gln
1 5 10 15
Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu Asn Asp Ser Ser
20 25 30
Glu Glu Glu Asp Glu Ile Asp Gly Pro Ala Gly Gln Ala Glu Pro Asp
35 40 45
Arg Ala His Tyr Asn Ile Val Thr Phe Cys Cys Lys Cys Asp Ser Thr
50 55 60
Leu Arg Leu Cys Val Gln Ser Thr His Val Asp Ile Arg Thr Leu Glu
65 70 75 80
Asp Leu Leu Met Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln
85 90 95
Lys Pro Met His Gln Lys Arg Thr Ala Met Phe Gln Asp Pro Gln Glu
100 105 110
Arg Pro Arg Lys Leu Pro Gln Leu Cys Thr Glu Leu Gln Thr Thr Ile
115 120 125
His Asp Ile Ile Leu Glu Cys Val Tyr Cys Lys Gln Gln Leu Leu Arg
130 135 140
Arg Glu Val Tyr Asp Phe Ala Phe Arg Asp Leu Cys lle Val Tyr Arg
145 150 155 160
Asp Gly Asn Pro Tyr Ala Val Cys Asp Lys Cys Leu Lys Phe Tyr Ser
165 170 175
Lys Ile Ser Glu Tyr Arg His Tyr Cys Tyr Ser Leu Tyr Gly Thr Thr
180 185 190
Leu Glu Gln Gln Tyr Asn Lys Pro Leu Cys Asp Leu Leu Ile Arg Cys
195 200 205
Ile Asn Cys Gln Lys Pro Leu Cys Pro Glu Glu Lys Gln Arg His Leu
210 215 220
Asp Lys Lys Gln Arg Phe His Asn Ile Arg Gly Arg Trp Thr Gly Arg
225 230 235 240
Cys Met Ser Cys Cys Arg Ser Ser Arg Thr Arg Arg Glu Thr Gln Leu
245 250 255
<210>3
<211>60
<212>DNA
＜213〉foot and mouth disease virus (foot-and-mouth disease virus)
<400>3
cagctgttga attttgacct tcttaagctt gcgggagacg tcgagtccaa ccctggcccc 60
<210>4
<211>2328
<212>DNA
＜213〉dengue fever virus (Dengue virus)
<400>4
atgaataacc aacgaaaaaa ggcgagaaat acccctttca atatgctgaa acgcgagaga 60
aaccgcgtgt cgactgtaca acagctgaca aagagattct cacttggaat gctgcaggga 120
cgaggaccat taaaactgtt catggccctg gtggcgttcc ttcgtttcct aacaatccca 180
ccaacagcag ggatactgaa gagatgggga acaattaaaa aatcaaaagc cattaatgtt 240
ttgagagggt tcaggaaaga gattggaagg atgctgaaca tcttgaacag gagacgcaga 300
actgcaggca tgatcattat gctgattcca acagtgatgg cgttccattt aaccacacgt 360
aacggagaac cacacatgat cgtcagtaga caagagaaag ggaaaagtct tctgtttaaa 420
acagaggatg gtgtgaacat gtgtaccctc atggccatgg accttggtga attgtgtgaa 480
gatacaatca cgtacaagtg tccttttctc aggcagaatg aaccagaaga catagattgt 540
tggtgcaact ctacgtccac atgggtaact tatgggacgt gtaccaccac aggagaacac 600
agaagagaaa aaagatcagt ggcactcgtt ccacatgtgg gaatgggact ggagacacga 660
actgaaacat ggatgtcatc agaaggggcc tggaaacatg cccagagaat tgaaacttgg 720
atcttgagac atccaggctt taccataatg gcagcaatcc tggcatacac cataggaacg 780
acacatttcc aaagagccct gattttcatc ttactgacag ctgtcgctcc ttcaatgaca 840
atgcgttgca taggaatatc aaatagagac tttgtagaag gggtttcagg aggaagctgg 900
gttgacatag tcttagaaca tggaagctgt gtgacgacga tggcaaaaaa caaaccaaca 960
ttggattttg aactgataaa aacagaagcc aaacaacctg ccactctaag gaagtactgt 1020
atagaggcaa agctgaccaa cacaacaaca gattctcgct gcccaacaca aggagaaccc 1080
agcctaaatg aagagcagga caaaaggttc gtctgcaaac actccatggt ggacagagga 1140
tggggaaatg gatgtggatt atttggaaaa ggaggcattg tgacctgtgc tatgttcaca 1200
tgcaaaaaga acatgaaagg aaaagtcgtg caaccagaaa acttggaata caccattgtg 1260
ataacacctc actcagggga agagcatgca gtcggaaatg acacaggaaa acatggcaag 1320
gaaatcaaaa taacaccaca gagttccatc acagaagcag agttgacagg ctatggcact 1380
gtcacgatgg agtgctctcc gagaacgggc ctcgacttca atgagatggt gttgctgcaa 1440
atggaaaata aagcttggct ggtgcacagg caatggttcc tagacctgcc gttgccatgg 1500
ctgcccggag cggacacaca aggatcaaat tggatacaga aagagacatt ggtcactttc 1560
aaaaatcccc atgcgaagaa acaggatgtt gttgttttgg gatcccaaga aggggccatg 1620
cacacagcac tcacaggggc cacagaaatc cagatgtcat caggaaactt actgttcaca 1680
ggacatctca agtgcaggct gaggatggac aaactacagc tcaaaggaat gtcatactct 1740
atgtgcacag gaaagtttaa agttgtgaag gaaatagcag aaacacaaca tggaacaata 1800
gttatcagag tacaatatga aggggacggt tctccatgta agatcccttt tgagataatg 1860
gatttggaaa aaagacatgt tttaggtcgc ctgattacag tcaacccaat cgtaacagaa 1920
aaagatagcc cagtcaacat agaagcagaa cctccattcg gagacagcta catcatcata 1980
ggagtagagc cgggacaatt gaagctcaac tggtttaaga aaggaagttc tatcggccaa 2040
atgattgaga caacaatgag gggagcgaag agaatggcca ttttaggtga cacagcttgg 2100
gattttggat ccctgggagg agtgtttaca tctataggaa aggctctcca ccaagttttc 2160
ggagcaatct atggggctgc cttcagtggg gtctcatgga ctatgaaaat actcatagga 2220
gtcattatca catggatagg aatgaattca cgcagcacct cactgtctgt gtcactagta 2280
ttggtgggag tcgtgacgct gtatttggga gttatggtgc aggcctga 2328
<210>5
<211>96
<212>DNA
＜213〉artificial sequence
<400>5
aaaaaggcga gaaatacgcc tttcaatatg ctgaaacgcg agagaggatc cagcacctca 60
ctgtctgtgt cactagtatt ggtgggagtc gtgacg 96
<210>6
<211>56
<212>DNA
＜213〉artificial sequence
<400>6
tgcacattcg ctctagaatt taggtgacac tatagagttg ttagtctacg tggacc 56
<210>7
<211>18
<212>DNA
＜213〉artificial sequence
<400>7
gcttcccgga ggagtggc 18
<210>8
<211>18
<212>DNA
＜213〉artificial sequence
<400>8
gacccagcaa gtatagcg 18
<210>9
<211>21
<212>DNA
＜213〉artificial sequence
<400>9
gacatgggga tgggttcttc a 21
<210>10
<211>39
<212>DNA
＜213〉artificial sequence
<400>10
acatgcttcg acctcgaggt ggacctcggt tgcggcaga 39
<210>11
<211>58
<212>DNA
＜213〉artificial sequence
<400>11
ctggaatcag ctgagctcag aacctgttga ttcaacagca ccattccatt ttctggcg 58
<210>12
<211>63
<212>DNA
＜213〉artificial sequence
<400>12
gcgagaaata cgcctttcaa tatgctgaaa cgcgagagaa acatgcatgg agatacacct 60
aca 63
<210>13
<211>42
<212>DNA
＜213〉artificial sequence
<400>13
tgcagttctc ttttggtgca ttggtttctg agaacagatg gg 42
<210>14
<211>21
<212>DNA
＜213〉artificial sequence
<400>14
atgcaccaaa agagaactgc a 21
<210>15
<211>36
<212>DNA
＜213〉artificial sequence
<400>15
aaggtcaaaa ttcaacagct gggtttctct acgtgt 36
<210>16
<211>72
<212>DNA
＜213〉artificial sequence
<400>16
atacagcgtc acgactccca ccaatactag tgacacagac agtgaggtgc tggggccagg 60
gttggactcg ac 72
<210>17
<211>63
<212>DNA
＜213〉artificial sequence
<400>17
gcgagaaata cgcctttcaa tatgctgaaa cgcgagagaa acatgcatgg agatacacct 60
aca 63
<210>18
<211>72
<212>DNA
＜213〉artificial sequence
<400>18
atacagcgtc acgactccca ccaatactag tgacacagac agtgaggtgc tggggccagg 60
gttggactcg ac 72
<210>19
<211>36
<212>DNA
＜213〉artificial sequence
<400>19
atatccccgc ggatgaataa ccaacgaaaa aaggcg 36
<210>20
<211>35
<212>DNA
＜213〉artificial sequence
<400>20
atatatctag actaggcctg caccataact cccaa 35
<210>21
<211>40
<212>DNA
＜213〉artificial sequence
<400>21
cctctagcta gagcttacca tgaataacca acgaaaaaag 40
<210>22
<211>35
<212>DNA
＜213〉artificial sequence
<400>22
gattagagct cttatctgcg tctcctgttc aagat 35
<210>23
<211>34
<212>DNA
＜213〉artificial sequence
<400>23
gcgctctaga atgactgcag gcatgatcat tatg 34
<210>24
<211>46
<212>DNA
＜213〉artificial sequence
<400>24
atgccag tag gacaggtgta atctaggcct gcaccataac tcccaa 46
<210>25
<211>21
<212>DNA
＜213〉artificial sequence
<400>25
attacacctg tcctactggc a 21
<210>26
<211>21
<212>DNA
＜213〉artificial sequence
<400>26
catggtaagc tctagctaga g 21
<210>27
<211>34
<212>DNA
＜213〉artificial sequence
<400>27
gcgctctaga atgactgcag gcatgatcat tatg 34
<210>28
<211>35
<212>DNA
＜213〉artificial sequence
<400>28
gtatagagct cttatctgcg tctcctgttc aagat 35
<210>29
<211>595
<212>DNA
＜213〉cytomegalovirus (cytomegalovirus)
<400>29
cattgattat tgactagtta ttaatagtaa tcaattacgg ggtcattagt tcatagccca 60
tatatggagt tccgcgttac ataacttacg gtaaatggcc cgcctggctg accgcccaac 120
gacccccgcc cattgacgtc aataatgacg tatgttccca tagtaacgcc aatagggact 180
ttccattgac gtcaatgggt ggagtattta cggtaaactg cccacttggc agtacatcaa 240
gtgtatcata tgccaagtcc gccccctatt gacgtcaatg acggtaaatg gcccgcctgg 300
cattatgccc agtacatgac cttacgggac tttcctactt ggcagtacat ctacgtatta 360
gtcatcgcta ttaccatggt gatgcggttt tggcagtaca ccaatgggcg tggatagcgg 420
tttgactcac ggggatttcc aagtctccac cccattgacg tcaatgggag tttgttttgg 480
caccaaaatc aacgggactt tccaaaatgt cgtaataacc ccgccccgtt gacgcaaatg 540
ggcggtaggc gtgtacggtg ggaggtctat ataagcagag ctcgtttagt gaacc 595
<210>30
<211>84
<212>DNA
＜213〉hepatitis virus (Hepatitis virus)
<400>30
gggtcggcat ggcatctcca cctcctcgcg gtccgacctg ggcatccgaa ggaggacgca 60
cgtccactcg gatggctaag ggag 84
<210>31
<211>36
<212>DNA
＜213〉artificial sequence
<400>31
gcgcgcggta ccttgacatt gattattgac tagtta 36
<210>32
<211>42
<212>DNA
＜213〉artificial sequence
<400>32
ggtccacgta gactaacaac tcggttcact aaacgagctc tg 42
<210>33
<211>21
<212>DNA
＜213〉artificial sequence
<400>33
agttgttagt ctacgtggac c 21
<210>34
<211>21
<212>DNA
＜213〉artificial sequence
<400>34
ccctgcagca ttccaagtga g 21
<210>35
<211>42
<212>DNA
＜213〉artificial sequence
<400>35
ctcacttgga atgctgcagg gcccaaggtg agatgaagct gt 42
<210>36
<211>42
<212>DNA
＜213〉artificial sequence
<400>36
gtggagatgc catgccgacc cagaacctgt tgattcaaca gc 42
<210>37
<211>48
<212>DNA
＜213〉artificial sequence
<400>37
gggtcggcat ggcatctcca cctcctcgcg gtccgacctg ggcatccg 48
<210>38
<211>55
<212>DNA
＜213〉artificial sequence
<400>38
ctcccttagc catccgagtg gacgtgcgtc ctccttcgga tgcccaggtc ggacc 55
<210>39
<211>45
<212>DNA
＜213〉artificial sequence
<400>39
ccactcggat ggctaaggga gaataaaatg aggaaattgc atcgc 45
<210>40
<211>35
<212>DNA
＜213〉artificial sequence
<400>40
tatatccgcg gatagaatga cacctactca gacaa 35
<210>41
<211>60
<212>DNA
＜213〉artificial sequence
<400>41
cagactgaaa aaagtattga agacaatcca gagatcgaag gaattaagaa caaccaaatc 60
<210>42
<211>36
<212>DNA
＜213〉artificial sequence
<400>42
tccacattt tccaagattt ggttgttctt aattcc 36
<210>43
<211>75
<212>DNA
＜213〉artificial sequence
<400>43
cagactgaaa aaagtattga agacaatcca gagatcgaag gaattaagaa caaccaaatc 60
ttggaaaatg tggag 75
<210>44
<211>5
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(5)
＜223〉signal peptide lytic enzyme substrate
<400>44
Pro Gln Ala Gln Ala
1 5
Claims (10)
1. dengue fever virus recombinant replication is characterized in that, described replicon has lacked the proteic whole encoding sequences of dengue fever virus preM, and comprises following element:
A) non-coding region of 5 ' whole ends;
B) preceding 20 the amino acid whose coding regions of C albumen;
C) coding region of NS1 protein signal peptide;
D) all Nonstructural Protein coding region;
E) non-coding region of 3 ' end;
F) be positioned at b) and c) between exogenous nucleic acid sequences, described exogenous nucleic acid sequences coding HPV antigen.
2. replicon as claimed in claim 1, it is characterized in that, 3 ' end of described exogenous nucleic acid sequences has 3 ' end releasing member, perhaps has 5 ' releasing member before the coding region of NS1 protein signal peptide, described releasing member is selected from: the nucleotide sequence of signal peptide lytic enzyme substrate shown in the nucleotide sequence of the coding foot and mouth disease virus shown in the SEQ ID NO:4 self lytic enzyme, the coding SEQ ID NO:44, and combination.
3. replicon as claimed in claim 1 is characterized in that, described dengue fever virus is dengue fever virus I, II, III or IV type.
4. replicon as claimed in claim 1 is characterized in that, the E7-E6 fragment that described HPV antigen is HPV.
5. a pseudovirion is characterized in that, is made up of described dengue fever virus recombinant replication of claim 1 and dengue fever virus structural protein packing.
6. a pharmaceutical composition is characterized in that, it contains described pseudovirion of claim 5 and pharmaceutically acceptable carrier.
7. the purposes of dengue fever virus recombinant replication as claimed in claim 1, it is characterized in that, be used to prepare the medicine of treatment and the following HPV relative disease of prevention: chronic cervicitis, false condyloma, wart sample pathology, pointed condyloma, cervical intraepithelial neoplasia (CIN), cervical cancer.
8. the purposes of the described dengue fever virus recombinant replication of claim 1 is characterized in that, is used for producing by packing cell the pseudovirion of dengue fever virus, and wherein said packing cell is selected from down group:
(i) quilt is contained the cell of the plasmid transfection of the sub structural protein gene that lacks of dengue fever virus recombinant replication,
(ii) contained dengue fever virus recombinant replication disappearance structural protein gene the helper viral vector cells transfected and
(iii) genome conformity has the cell of the structural protein gene of dengue fever virus recombinant replication disappearance,
And described packing cell can be expressed packing described replicon required singapore hemorrhagic fever structural protein, and the singapore hemorrhagic fever structural protein gene of disappearance does not influence the growth characteristics of cell when expressing therein.
9. a method for preparing pseudovirion is characterized in that, comprises step:
(i) with the described dengue fever virus recombinant replication of claim 1, perhaps contain the pseudovirion of described replicon, import the packing cell of dengue fever virus;
(ii) when described packing cell is expressed the dengue fever virus structural protein, cultivate described packing cell, thereby produce the pseudovirion of dengue fever virus; Perhaps, when described packing cell is not expressed the dengue fever virus structural protein, helper virus replication is imported this packing cell, wherein said helper virus is expressed the structural protein of dengue fever virus, cultivate described packing cell then, thereby produce the pseudovirion of dengue fever virus;
(iii) reclaim the pseudovirion that contains replicon.
10. method as claimed in claim 9 is characterized in that, described packing cell contains the dengue fever virus structural protein expression vector that is selected from down group: contain the expression vector of the singapore hemorrhagic fever genome sequence that lacks NS3, be subjected to the expression vector of tsiklomitsin regulation and control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100033957A CN1234851C (en) | 2003-01-30 | 2004-01-30 | Vaccine for human papiloma virus |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN03115273.2 | 2003-01-30 | ||
| CN03115273 | 2003-01-30 | ||
| CNB2004100033957A CN1234851C (en) | 2003-01-30 | 2004-01-30 | Vaccine for human papiloma virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1524951A CN1524951A (en) | 2004-09-01 |
| CN1234851C true CN1234851C (en) | 2006-01-04 |
Family
ID=34314763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100033957A Expired - Fee Related CN1234851C (en) | 2003-01-30 | 2004-01-30 | Vaccine for human papiloma virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1234851C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112014023092A8 (en) * | 2012-03-18 | 2017-07-25 | Glaxosmithkline Biologicals Sa | IMMUNOGENIC COMPOSITION, METHOD FOR THE PREVENTION OF INFECTION OR DISEASE BY HPV IN AN INDIVIDUAL, AND, KIT |
-
2004
- 2004-01-30 CN CNB2004100033957A patent/CN1234851C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1524951A (en) | 2004-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1440296A (en) | Vaccine against foot-and-mouth disease | |
| CN1606624A (en) | Vaccines | |
| CN1653183A (en) | Recombinant poxvirus expressing homologous genes inserted into the poxviral genome | |
| CN101035897A (en) | Vaccine for prevention and treatment of HIV-infection | |
| CN101054582A (en) | A-type kreotoxin receptor combination region Hc, coding protein and application thereof | |
| CN1738833A (en) | HCV vaccine | |
| CN1810970A (en) | CpG-containing single-stranded deoxynucleotide, its vaccine composition and their application | |
| CN1192799C (en) | Adjuvant combination formulations | |
| CN101048178A (en) | Combination of a recombinant mycobacterium and a biologically active agent as a vaccine | |
| CN1705747A (en) | Vector for anti-HPV vaccine and transformed microorganism by the vector | |
| CN1656116A (en) | Non-immunosuppressive imunogenic or vaccine composition comprising a mutated e7 protein of the HPV-16 virus | |
| CN1173744C (en) | Stable gene preparations | |
| CN1234852C (en) | False virosome vaccine with recombinant replicon of dengue fever virus as carrier | |
| CN101057975A (en) | Cocktail vaccine for anti immune tolerance and immunodeficiency virus and its application | |
| CN1234851C (en) | Vaccine for human papiloma virus | |
| CN1570115A (en) | Optimized SARS coronary virus spike protein gene | |
| CN101054577A (en) | A siRNA and expression carrier capable of inhibiting Bax gene expression and application of the same used as virus hepatitis B treatment medicament | |
| CN1629194A (en) | Super antigen fusion protein for cancer therapy and its producing method | |
| CN1289146C (en) | Nucleic acid vaccin for preventing and treating hepatitis B virus inflammation and its preparation | |
| CN1268392C (en) | Vaccine of recombined albumen for preventing and treating infection of human C type hepatitis virus and its usage | |
| CN1769433A (en) | Recombinant vesicular stomatitis virus and its uses | |
| CN1517437A (en) | Vaccine for specificity treating tumour or endocellular infection and application | |
| CN1976946A (en) | Supertype epitopes, oligonucleotides coding the same which induce effective CTL response against HCV and the use thereof | |
| CN1720261A (en) | Vaccine | |
| CN1304579C (en) | Recombinant vaccine using flavivirus as vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| DD01 | Delivery of document by public notice |
Addressee: Dongfang Tianjia Tech Development Co., Ltd. Beijing Document name: Notification to Pay the Fees |
|
| DD01 | Delivery of document by public notice | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060104 Termination date: 20190130 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |