CN1560278A - Method for quickly testing amount of No.21 chromosome - Google Patents

Abstract

The invention is a rapid detecting method of No. 21 chromosome number, and its characteristic: it is made by the following steps: a, extracting a DNA from a sample to be detected; b, using PCR to amplify the specific STR sites on the No.21 chromosomes in the DNA: LFG20, LFG21, LFG24, LFG26, LFG29, LFG33 and LFG34, as well as STR sites: D21S1409, D21S1435, D21S1436, D21S2052, and D21S2054; c, according to the detecting results of the amplified products, determining the No.21 chromosome number in the sample.

Description

A kind of No. 21 chromosome number purpose method for quick

Technical field

The present invention relates to a kind of chromosome number purpose molecular biology method that can detect rapidly No. 21.

Background technology

Most eukaryote is a diploid, and promptly the chromosome number in normal somatic cell is 2 multiple, i.e. 2N is as there being 2*23 bar karyomit(e) in the human normal somatic cell.When human chromosomal departs from normal number, will cause corresponding chromosomal disorders.If indivedual one or several chromosomal numbers change, somatic chromosome number is not 23 integral multiple, is called aneuploid.Human modal numerical abnormalities of chromosomes is No. 21 extra karyomit(e)s, i.e. trisomy21s to have occurred.This No. 21 chromosomal numerical abnormalities can cause serious chromosomal disorders---trisomy 21, owing to this disease at first is described by Britain doctor Langdon Down, so be called mongolism again.The Clinical symptoms of mongolism is mainly growth retardation, mental retardation in various degree and comprises a series of unusual sign of women's head-ornaments portion feature, and this makes this disease unfortunately be called as mongolism in the past again.The sickness rate of trisomy 21 is about 1/600-900 among the newborn infant, is chromosome abnormalty the most common among the newborn infant.95% mongolism patient's karyomit(e) basis all is the trisomy 21 due to karyomit(e) does not separate when being secondary to reduction division, promptly the whole body somatocyte is all many No. 21 karyomit(e)s, and this class caryogram is called free type, usually clinical symptom typical case and significantly.By the dna polymorphism analysis, can in most family, judge and not separate which side and maiotic which that occurs among the parents in step.The many initial meiosises of No. 21 extra karyomit(e)s from mother.About 4% mongolism is the result of non-balanced translocation, this caryogram is easy bit-type, though the patient has only 46 karyomit(e)s, but on a karyomit(e) that translocates to another D group or G group for No. 21, add normal two No. 21 karyomit(e)s, still many one extra No. 21 long-armed, and determine this sick key area band be No. 21 long-armed, so still show the symptom of trisomy 21 clinically.At last, the mongolism patient less than 3% is a mosaic, has two kinds of normal and unusual clones simultaneously, and symptom depends on the ratio that abnormal cells is shared, but generally lighter.At present, except strengthening nursing and training, prolong patient's life-span, strengthen outside its self care ability, human do not have therapy measure for mongolism.The generation of this disease all brings great burden for patient family and society.Therefore, improve chromosome number purpose detection level,, reduce the birth of mongolism infant especially in the antenatal level that detects, extremely important.

It is existing chromosome number purpose detection method that fetal cell is carried out karyotyping, this process comprise fetal cell vitro culture and mid-term fetal cell karyotyping.Cells in vitro is cultivated needs the survivaling cell of some amount and suitable specialized technical knowledge, all possibly can't implement karyotyping under following several situations: 1, cell cultures failure.According to statistics, the incidence of cell cultures failure is about 1-2%.2, the cell number of Shou Jiing is limited, can not draw clear conclusions.For guaranteeing that enough cultures are used for karyotyping, must obtain amniotic fluid greater than 5ml.When the amniotic fluid amount of extracting out when amniocentesis is less than 5ml, just have to carry out amniocentesis repeatedly, infect and the risk of damage thereby increased.3, culture is contaminated.Bibliographical information is arranged, even in veteran testing laboratory, the pollution rate of mother cell also can reach 10-14%.4, because cell cultures only limits to survivaling cell, so some special sample can't carry out karyotyping, as some product of conception and formalin fixed or paraffin embedding sample.In addition, the detection method of traditional biological aneuploid significant disadvantage the most is that cell cultivation process is consuming time oversize, roughly needs the time about two weeks, and this just is easy to cause the delay in the processing.Therefore, rapidly, detection technique is very valuable accurately.

In recent years, fluorescence in situ hybridization (fluorecent in situ hybridization, FISH) and quantitative fluorescence PCR (quantitative fluorecent polymerase chain reaction QF-PCR) has been applied to the chromosome number purpose and has detected.With regard to the method for the biological aneuploid of fluorescence in situ hybridization detection, interval the fluorescence in situ hybridization of cell can carry out cell cultures, shortened the required time of diagnosing greatly; The application of commercialization probe has improved susceptibility and the specificity of FISH.But then, this diagnostic techniques still has certain limitation: 1, in the amniotic fluid of not cultivating, fluorescently-labeled probe can combine with cytoskeleton non-specificly, makes background unintelligible, and the validity of FISH reduces greatly.2, must there be complete cell to be used for analyzing.3, experimenter's professional skill is had relatively high expectations.4, the pollution of mother cell can cause the explanation of error to experimental result.5, compare QF-PCR, fish analysis length consuming time, cost height have limited its high throughput testing to sample.

The quantitative fluorescence PCR method has been utilized the STR (shorttandem repeats is hereinafter to be referred as STR) that extensively distributes in the genome.STR is repeated to form by the core sequence series connection of 2～6bp usually, has the polymorphism of height, is easy to adopt the composite amplification mode to increase.And fluorescent composite amplification is the most general composite amplification method of using in the world at present, normally at each target sequence fluorescent substance on the end mark of a primer wherein, utilizes automatic laser fluorescence genetic analyzer that product is detected.The amplified production of STR separates by clip size when electrophoresis, determines each allelic copy number according to the number and the intensity of fluorescence peak, thereby reflects specific chromosomal copy number.A normal heterozygote cognition produces two highly close peaks, and homozygote then shows as an independent STR peak.When numerical abnormalities of chromosomes, the fluorescence peak that is detected will be observed the unusual of number and intensity, three close peaks of peak height perhaps occur or height ratio occurs near two peaks of 2: 1.Because the application of PCR (polymerase chain reaction) amplification method and fluoroscopic examination, this detection method are very sensitive, can be used for the detection of a small amount of sample, as fetal cell or the foetal DNA of collecting in the maternal blood, also can determine the pollution of mother cell.Particularly importantly, this method is very fast, and the extraction of DNA and amplification only need about 5 hours, and the analysis meeting of each fluorescence-causing substance was finished in half an hour.Easily be automated in addition, might detect simultaneously 36～96 samples, therefore tens, even the detected result of a hundreds of sample can obtain in one day.Identification for the detected result of quantitative fluorescence PCR test method is also very disputable at present, because this method itself remains in some problems.At first, composite amplification is carried out in 2-4 STR site that present quantitative fluorescence PCR test method has only been chosen on every karyomit(e).Concerning a specific karyomit(e), only the detection system that is made of 2-4 STR site can not guarantee to detect all aneuploids usually, especially when the heterozygosity in STR site is not high.In the detection of many utilization quantitative fluorescence PCR test methods, always there is the part sample that information can not be provided, but the several sites on karyomit(e) all show as a STR peak, can't differentiate normally or the homozygote of aneuploid.Particularly importantly, quantitative fluorescence PCR test method is when detecting two peaks, with the ratio of peak height or peak area and the normal reference value contrast of setting up in advance, as judging whether one of euploid foundation of right and wrong, this reduces the validity of this method greatly.PCR is a complicated reaction process, and amplified production amount and template amount are not simple linear relationship, when two allelotrope peaks occurring, to judgement more complicated in actually operating of result.If the ratio of the height at two peaks or area will be equivocal to result's judgement near the dividing value of normal reference value; The composite amplification of a plurality of target sites, because fluorescence peak is overlapping, its position and intensity also are difficult to explain sometimes; There is the advantage pcr phenomenon in some site, is easy to cause mistaken diagnosis, especially in the template amount after a little while.When advantage pcr occurring, or because the little allelotrope excessive amplification of fragment and the erroneous judgement of chromosomal aneuploid is normal diploid, or owing to the low aneuploid that is mistaken for of an amplified allele efficient of normal diploid individuality.In practice, quantitative fluorescence PCR is normally united use as a kind of auxiliary detection method with traditional cytogenetic methods, and the last result that makes a definite diagnosis still need be by cytogenetic method acquisition.

But, recent result of study shows, if adopt a kind of new biological aneuploid detection method, the STR site that is used for the aneuploid detection is carried out preferably, strict good tetranucleotide or the pentanucleotide multiple STR site of polymorphism of selecting, and increase site number to 6 or more than 6, guarantee the usefulness of detection system, make detection that statistical meaning more be arranged, simultaneously, adopt stricter detection decision method, when promptly only plural specificity STR site has three allelotrope peaks on observing specific karyomit(e), assert that just this karyomit(e) is aneuploid, just can make the judgement of detected result directly perceived more and clear and definite, can be really accurate, fast, high-throughput ground carries out biological aneuploid and detects.This method is had higher requirement to the quantity and the polymorphism in STR site on the specific karyomit(e).Yet as far as we know, in present public database, existing microsatellite locus can not satisfy above-mentioned requirement on some karyomit(e), as No. 21 karyomit(e)s.Therefore, use this method that specific chromosome aneuploid is carried out rapid detection, the matter of utmost importance that faces will be the exploitation of new microsatellite locus.

Develop No. 21 chromosome specific microsatellite locus new, that have the height polymorphism, the detection method of above-mentioned biological aneuploid is applied to No. 21 chromosome number purposes detects, will be to making a definite diagnosis the most common clinically chromosomal disorder fast---mongolism provides objective diagnosis basis.

Summary of the invention

Purpose of the present invention promptly provides a kind of molecular biology method of can be rapidly, exactly No. 21 chromosomal numbers being detected.

No. 21 chromosome number purpose method for quick of the present invention are to carry out according to the following steps:

A, from sample to be checked, extract sample DNA;

B, on No. 21 karyomit(e)s in the sample DNA by we definition specificity STR site LFG20, LFG21, LFG24, LFG26, LFG29, LFG33, LFG34 and STR site D21S1409, D21S1435, D21S1436, D21S2052, D21S2054 carry out pcr amplification, wherein:

Sequence

ATTTATGAGGTAGGTTCCTTAGCCCCATTTCACAGGCTGAGAACCTGAGA

CTGTCAACACTAAGCTGATTTTACTGTGATTACATCTTAGTGAGTGACAG

ATCTAGCAATCATGGAATTGAGAAGGCCCCACCTATGTTATGTTATAA(CA

TAA)n(CATAG)mCATGGCAACATAACATAACACAGGGGGCCTTCTCAATTA

TTTATAACATAACATAGGGGAGGCCTTATAAT

By our called after LFG20 site, this site is the little satellite of a pentanucleotide multiple, and core sequence is (CATAAxCATAG), and the different multiplicity of core sequence are with n, and m represents.

Sequence

ATTGGCGAATCATGACACTAATTTTGGCCAGCATTTAC(GAATA)nGAATG

GATCAGAGTAATATTAAAGAGTATCTAGATATTCATCCACATTATAAAGTTT

TAGTTCAGGCCTCTTTTTCTTCTCCATCAAGTTATTCCTTGAGGCTTCCCTG

AACTTTTTATTTTATGCCTTTCT，

By our called after LFG21 site, this site is the little satellite of a pentanucleotide multiple, and core sequence is (GAATA), and the different multiplicity of core sequence are represented with n.

Sequence

TTAAAAGTTACAGGTTCTAGGAAACATGGCTGGTGAATACAATAATAAT

TTATTAATTTTAATGTCAGCTTCAAATTTTTGGTTCTTTGGAAAATTGT

TTAGGCCCCCAAATATATAGGTC(TATG)n(CATG)mTATG(CATG)k

(TATG)p(TATC)qTATAGCTGCATTGATGCTGTAAGT，

By our called after LFG24 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TATGxCATGxTATC), and the different multiplicity of core sequence are with n, m, and k, p, q represents.

Sequence

ACCACTTTAGAGTTGACAAACTCCATGTTGGAACAGAGTATTCTT

AAACAGAACCCTTAAAACCATATTTTTCACCTCTCTGTTTT(TATC)n

TATTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTCGT

GTGATCACGGTTCTCTGCAGCCTCGATCTCCTGGGCTCTAGCTATCCT

CCCAACTAGCTCAGATTACA，

By our called after LFG26 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TATC), and the different multiplicity of core sequence are represented with n.

Sequence

ACTTTCTGGTTTGGAAAATTTGCTTGAGAGGTAAAAAGAAAATTT(ACTT)n

(ATTT)mAGTAGAGACAGAATCTCGCTCTGTTGCTCAGGCTGGAGTGCAGTA

GCACGATCCTGGCTCACTGCAAACTGACTCCTGGGTTCAGGTG，

By our called after LFG29 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (ACTTxATTT), and the different multiplicity of core sequence are with n, and m represents.

Sequence

CAGGTGTGAGCCACCATACCCAGCCTTACTGTATC(ATAG)nATG(ATAG)m

AATATAGTTGCCTACAATATTCAGCACAGTAACAGCTATATAGGTCTGTAG

CTTGGGAGCAATAGGC，

By our called after LFG33 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (ATAG), and the different multiplicity of core sequence are with n, and m represents.

Sequence

CTATTTGGTACACAAGGCAGAATAAAGGGATTATTGCTTGA(TAGG)n

(TAGA)mAGA(TAGA)kTGAGACAAGACAAGACAGACTATGAATAAAT

TAATCATACTGCTG；

By our called after LFG34 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TAGGxTAGA), and the different multiplicity of core sequence are with n, m, and k represents.

C, basis are determined No. 21 chromosomal numbers in the sample to the detected result of above-mentioned site pcr amplification product.

For example, after the fluorescent dye primer amplification, determine No. 21 chromosomal numbers in the sample with the number of the corresponding fluorescence peak of allelotrope.

In the present invention, above-mentioned STR site D21S1435, D21S1436, D21S2052, D21S2054 are existing STR site, and information such as their core sequence, reference sequences can obtain the common human genome database from the internet.

Below technical conceive of the present invention is further described.

In step a of the present invention, sample to be checked can be amniotic fluid, chorion, peripheral blood, even formalin fixed or paraffin-embedded tissue, can adopt conventional phenol-chloroform method or Chelex method to extract sample DNA.

The selection in above-mentioned No. 21 chromosome specific STR sites is very crucial.Choosing of specific STR site is based on following consideration: 1, select the good STR site of polymorphism.So-called polymorphism is meant that there are two or more allelic phenomenons in a locus in the same colony.The polymorphism degree of a locus is high more, and using this locus, to carry out the usefulness of genetic analysis just high more.Most STR site all has the polymorphism of height, and its polymorphism comes from the individual difference of core sequence multiplicity.It has been generally acknowledged that duplicating slippage is the mechanism that this species diversity forms.The STR site that polymorphism is good can produce the different pcr amplification product of length in most of individuality of normal population, promptly concerning the good site of each polymorphism, most normal individual all can be a heterozygote, therefore the quantitative fluorescence analysis of PCR product can show as two fluorescence peaks, corresponding to two allelotrope in this site.In chromosomal aneuploid, extra karyomit(e) is many from parent.Loci polymorphism is good more, and it is just big more that parent has not homoallelic possibility.Simultaneously, the possibility different with male parent's allelotrope is also big, and chromosomal aneuploid shows as three fluorescence peaks in this site possibility is also just big more.The polymorphism of heterozygosity loci commonly used is carried out qualitative assessment in population genetics.Therefore, when setting up detection system, should select for use heterozygosity greater than 0.6 STR site.2, increase selected STR site number.Concerning the detection system of specific karyomit(e) trisome, its usefulness not only depends on the polymorphism in STR site, and is also relevant with the number in STR site.Undoubtedly, when the STR number of loci of analyzing increases, therefore the usefulness of system will increase, and observes chromosomal aneuploid in plural STR site and has three not homoallelic possibilities and will increase, and aneuploid determined also just more to have meaning on the statistics.According to our research, should select the STR site more than 6 at least for use.3, select tetranucleotide or pentanucleotide multiple STR site, promptly the core sequence in site is made of 4bp or 5bp Nucleotide.The little satellite of this two class not only has the polymorphism of height, and amplification is more loyal, and somatotype is also more accurate.

Based on mentioned above principle, we have selected described 12 No. 21 chromosome specific STR sites, 2 pentanucleotide multiple STR sites are wherein arranged, 10 tetranucleotide multiple STR sites, the heterozygosity that mass survey confirms these sites in China Han colony all greater than 0.6.Because present public database lacks the pentanucleotide multiple microsatellite locus of No. 21 chromosome specifics, polymorphism good, No. 21 chromosome specific microsatellite locus of tetranucleotide multiple are also few, therefore we have developed 7 No. 21 new chromosome specific microsatellite locus, comprising 2 pentanucleotide multiple microsatellite locus, 5 tetranucleotide multiple microsatellite locus, called after LFG20, LFG21, LFG24, LFG26, LFG29, LFG33, LFG34 respectively.

Usually the structure of str locus seat is divided into two portions, and the centre is the iteron, is repeated to constitute by the core sequence series connection, and the individual difference of multiplicity is the basis that polymorphism produces; Both sides are the flanking sequence of non-repeatability.If select a pair of specific oligonucleotide fragment as primer at flanking sequence, can carry out pcr amplification to corresponding STR site, the difference of migration distance during according to the amplified production electrophoresis that varies in size can detect the difference of iteron inner core sequence multiplicity.

To the amplification in described 12 No. 21 chromosome specific sites, the present invention can adopt existing composite amplification technology, as the principle of the applicant's mentioned multiple colour fluorescent composite amplification method in No. 200310104034.7, Chinese invention patent application.The required sample amount of fluorescent composite amplification technology is few, and the result is accurate, highly sensitive, level of automation height, repeatable strong.But with the STR site that one group of amplified fragments of fluorescein mark of a kind of color varies in size, multiple fluorescein then can the different STR site of the many groups of mark.Utilize the different colours of fluorescein and the different lengths of amplified fragments like this, can detect nearly 20 STR sites at present simultaneously.Based on above several reasons, fluorescent composite amplification has been widely used in molecular biological every field.Equally,, just can simplify procedures significantly, save time, reach the purpose of No. 21 chromosomal numerical abnormalities being carried out rapid detection with a small amount of sample if adopt this fluorescent composite amplification technology among the present invention.

In the present invention, No. 21 chromosome specific STR number of sites that detected have reached 12, guaranteed the usefulness of detection system, make detection that statistical meaning more be arranged, like this, if adopt specific detection decision method, when promptly only plural specificity STR site has three allelotrope peaks on observing specific karyomit(e), just assert numerical abnormalities of chromosomes No. 21, this just can make the judgement of detected result directly perceived more and clear and definite.In addition, if adopt the fluorescent composite amplification method, just can be more quick, high-throughput ground detects No. 21 chromosome numbers.

Content of the present invention further illustrates with the following Examples, but content of the present invention is not limited only to content related among the embodiment.

Embodiment

Embodiment 1: present embodiment carries out according to the following steps to the detection of No. 21 numerical abnormalities of chromosomes:

A, employing phenol-chloroform method extract DNA from sample to be checked.Sample in the present embodiment is from the fetal cell of amniotic fluid.

B, employing fluorescent composite amplification mode increase to above-mentioned 12 in the sample DNA No. 21 chromosome specific STR sites, promptly STR site LFG20, LFG21, LFG24, LFG26, LFG29, LFG33, LFG34 and STR site D21S1409, D21S1435, D21S1436, D21S2052, D21S2054 are increased.For 7 STR site LFG20, LFG21, LFG24, LFG26, LFG29, LFG33, LFG34 newly developed, we have designed corresponding original primer voluntarily.

The original primer of site LFG20 is

P1：5’-TGAGGTAGGTTCCTTAGCCC-3’

P2：5’-AAGGCCTCCCCTATGTTATG-3’

The original primer of site LFG21 is

P1：5’-TTGGCGAATCATGACACTAA-3’

P2：5’-GGGAAGCCTCAAGGAATAAC-3’

The original primer of site LFG24 is

P1：5’-AGGTTCTAGGAAACATGGCTG-3’

P2：5’-TGCAAAACTGCTCTGGACTT-3’

The original primer of site LFG26

P1：5’-TTAGAGTTGACAAACTCCATGTTG-3’

P2：5’-TCTGAGCTAGTTGGGAGGATAG-3’

The original primer of site LFG29 is

P1：5’-TGGAAAATTTGCTTGAGAGG-3’

P2：5’-TGAACCCAGGAGTCAGTTTG-3’

The original primer of site LFG33 is

P1：5’-CACCATACCCAGCCTTACTG-3’

P2：5’-GCTCCCAAGCTACAGACCTA-3’

The original primer of site LFG34 is

P1：5’-CACAAGGCAGAATAAAGGGA-3’

P2：5’-AGCATGTGTCCTGAATCTTTG-3’

In addition, 5 existing STR sites and original primer thereof can obtain by disclosed human genome database retrieval on the internet.The original primer of the D21S1409 locus of announcing in the online GDB gene database is

P1：5’-GGAGGGGAATACATTTGTG-3’

P2：5’-TTGCCTCTGAATATCCCTAT-3’

The original primer of D21S1435 locus:

P1：5’-CCCTCTCAATTGTTTGTCTACC-3’

P2：5’-GCAAGAGATTTCAGTGCCAT-3’

The original primer of D21S1436 locus:

P1：5’-AGGAAAGAGAAAGAAAGGAAGG-3’

P2：5’-TATATGATGAAAGTATATTGGGGG-3’

The original primer of D21S2052 locus:

P1：5’-GCACCCTTTATACTTGGGTG-3’

P2：5’-TAGTACTCTACCATCCATCTATCCC-3’

The original primer of D21S2054 locus:

P1：5’-GCAGTAAATGTCTATGAAACAAGG-3’

P2：5’-ATGATAGGTAGATGGATCAATTAGA-3’

Described 12 No. 21 chromosome specific str locus seats are adopted the design of primers principle of the applicant's related multiple colour fluorescent composite amplification in No. 200310104034.7, Chinese invention patent application.Increased in twice composite amplification reaction respectively in above-mentioned 12 STR sites.

Site LFG21, LFG24, LFG26, D21S1409, D21S2052 and D21S2054 increase in once-combined amplified reaction.It is right that the composite amplification reaction relates to three pairs of different short sequences.At common sequence SA

5 ' the end of SA (5 '--TGTTCTT-3 ') adds and just can obtain 3 fluorescent mark sequences by fluorescent marker F1, F2, the F3 that 3 kinds of compositions and color have nothing in common with each other

SB1(5’--F1-TGTTCTT-3’)

SB2(5’--F2-TGTTCTT-3’)

SB3(5’--F3-TGTTCTT-3’)

These 3 fluorescent mark sequences match with above-mentioned common sequence SA respectively, promptly constitute short sequence to " SA, SB1 ", short sequence to " SA, SB2 " and weak point sequence to " SA, SB3 ".

Site LFG24, D21S2054 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT-3’)

SB1(5’--F1-GTTCTT-3’)，

In SB1, fluorescent substance F1 is commercially available blue-fluorescence marker FAM.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG24, D21S2054.

The long aligning primer of LFG24 locus:

SA-P1：5′-GTTCTT-AGGTTCTAGGAAACATGGCTG-3′

SB1-P2：5′-F1-GTTCTT-TGCAAAACTGCTCTGGACT-3′，

The long aligning primer of D21S2054 locus:

SA-P1：5′-GTTCTT-GCAGTAAATGTCTATGAAACAAGG-3′

SB1-P2：5′-F1-GTTCTT-ATGATAGGTAGATGGATCAATTAGA-3′，

Site LFG26, D21S1409 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT-3’)

SB2(5’--F2-GTTCTT-3’)，

In SB2, fluorescent substance F2 is commercially available existing yellow fluorescence marker NED.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG26, D21S1409.

The long aligning primer of LFG26 locus:

SA-P1：5′-GTTCTT-TTAGAGTTGACAAACTCCATGTTG-3′

SB2-P2：5′-F2-GTTCTT-TCTGAGCTAGTTGGGAGGATAG-3′，

The long aligning primer of D21S1409 locus:

SA-P1：5′-GTTCTT-GGAGGGGAATACATTTGTG-3′

SB2-P2：5′-F2-GTTCTT-TTGCCTCTGAATATCCCTAT-3′，

Site LFG21, D21S2052 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT-3’)

SB3(5’-F3-GTTCTT-3’)，

In SB3, fluorescent substance F3 is commercially available existing green fluorescence marker JOE.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG21, D21S2052.

The long aligning primer of LFG21 locus:

SA-P1：5′-GTTCTT-TTGGCGAATCATGACACTAA-3′

SB3-P2：5′-F3-GTTCTT-GGGAAGCCTCAAGGAATAAC-3′，

The long aligning primer of D21S2052 locus:

SA-P1：5′-GTTCTT-GCACCCTTTATACTTGGGTG-3′

SB3-P2：5′-F3-GTTCTT-TAGTACTCTACCATCCATCTATCCC-3′；

Composite amplification is reflected in the PE-9600 amplification instrument and carries out, and the consumption of each composition is as follows in the reaction system:

DDH ₂O： 12.4μL

dNTP： 7.5μl

10Xbuffer 3.75μL、

6 couples of each 0.3 μ l of long aligning primer

Taq enzyme 1 μ l (3u)

BSA 3.75μL

MgCl2 3μl

Dna profiling: 2.5 μ L (about 3ng)

Cumulative volume: 37.5 μ L

The warm start technology is adopted in composite amplification reaction, circulates altogether 28 to take turns, and loop parameter is as follows:

Pre-sex change: 94 ℃ 3 minutes

Sex change: 94 ℃ 50 seconds

Renaturation: 54 ℃ 50 seconds

Extend: 72 ℃ of 4 circulations in 30 seconds

Sex change: 94 ℃ 50 seconds

Renaturation: 54 ℃ 30 seconds

Extend: 72 ℃ of 24 circulations in 30 seconds

Extend: 72 ℃ 10 minutes

Site LFG20, LFG29, LFG33, LFG34 D21S1435 and D21S1436 be amplification simultaneously in the reaction of another time composite amplification, and it is right to relate to the different short sequence of this three couple equally.

Site LFG20, D21S1436 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT-3’)

SB1(5’--F1-GTTCTT-3’)，

In SB1, fluorescent substance F1 is commercially available blue-fluorescence marker FAM.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG20, D21S1436.

The long aligning primer of LFG20 locus:

SA-P1：5′-GTTCTT-TGAGGTAGGTTCCTTAGCCC-3′

SB1-P2：5′-F1-GTTCTT-AAGGCCTCCCCTATGTTATG-3′，

The long aligning primer of D21S1436 locus:

SA-P1：5′-GTTCTT-AGGAAAGAGAAAGAAAGGAAGG-3′

SB1-P2：5′-F1-GTTCTT-TATATGATGAAAGTATATTGGGGG-3′，

Site LFG29, LFG33 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT?3’)

SB2(5’--F2-GTTCTT-3’)，

In SB2, fluorescent substance F2 is commercially available existing yellow fluorescence marker NED.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG29, LFG33.

The long aligning primer of LFG29 locus:

SA-P1：5′-GTTCTT-TGGAAAATTTGCTTGAGAGG-3′

SB2-P2：5′-F2-GTTCTT-TGAACCCAGGAGTCAGTTTG-3′，

The long aligning primer of LFG33 locus:

SA-P1：5′-GTTCTT-CACCATACCCAGCCTTACTG-3′

SB2-P2：5′-F2-GTTCTT-GCTCCCAAGCTACAGACCTA-3′，

Site LFG34, D21S1435 are one group, the fluorescence of a kind of color of mark.The genomic short sequence of non-human is to being:

SA(5’--GTTCTT-3’)

SB3(5’--F3-GTTCTT-3’)，

In SB3, fluorescent substance F3 is commercially available existing green fluorescence marker JOE.

Can add respectively with the 5 ' end of the original primer P1 of human genomic sequence specificity bonded, P2 this to short sequence to after, promptly constitute the long aligning primer of site LFG34, D21S1435.

The long aligning primer of LFG34 locus:

SA-P1：5′-GTTCTT-CACAAGGCAGAATAAAGGGA-3′

SB3-P2：5′-F3-GTTCTT-AGCATGTGTCCTGAATCTTTG-3′，

The long aligning primer of D21S1435 locus:

SA-P1：5′-GTTCTT-CCCTCTCAATTGTTTGTCTACC-3′

SB3-P2：5′-F?3-GTTCTT-GCAAGAGATTTCAGTGCCAT-3′；

The reaction system of this composite amplification and amplification condition and last time similar are so be omitted.

C, determine No. 21 chromosomal numbers in the sample according to the number of the corresponding fluorescence peak of allelotrope.In the present embodiment, when observing plural No. 21 chromosome specific STR sites and have three allelotrope peaks, assert that No. 21 karyomit(e)s of this sample are trisomy.During concrete operations, utilize ABI310 genetic analyzer (PE, the U.S.) that the resulting pcr amplification product of above-mentioned composite amplification process is carried out check and analysis.Number with PCR product 0.4 μ l and somatotype standard substance GS500 ROX size standard 0.2 μ l, denaturing agent Hi-DiTMformamide3 μ l mixing, put into the automatic sampling dish.Electricity sample introduction 15000V, 5s. electrophoresis 15000V, 24 minutes.Collect data with Date Collection software, Genescan3.7 software analysis data use the AmpFISTR PLUS kit Kazam macro file of revising at Genetype3.7 software automatic parting direction.Allelic identification is by relatively confirming with allelic ladder, window ranges+/-0.5bp.

Claims (1)

1, a kind of No. 21 chromosome number purpose method for quick is characterized in that carrying out according to the following steps:

A, from sample to be checked, extract sample DNA;

B, No. 21 chromosome specific STR site LFG20, LFG21, LFG24, LFG26, LFG29, LFG33, LFG34 and STR site D21S1409, D21S1435, D21S1436, D21S2052, D21S2054 in the sample DNA are carried out pcr amplification, wherein:

Sequence

ATTTATGAGGTAGGTTCCTTAGCCCCATTTCACAGGCTGAGAACCTGAGA

CTGTCAACACTAAGCTGATTTTACTGTGATTACATCTTAGTGAGTGACAG

ATCTAGCAATCATGGAATTGAGAAGGCCCCACCTATGTTATGTTATAA(CA

TAA)n(CATAG)mCATGGCAACATAACATAACACAGGGGGCCTTCTCAATTA

TTTATAACATAACATAGGGGAGGCCTTATAAT

Be the LFG20 site, this site is the little satellite of a pentanucleotide multiple, and core sequence is (CATAAxCATAG), and the different multiplicity of core sequence are with n, and m represents;

Sequence

ATTGGCGAATCATGACACTAATTTTGGCCAGCATTTAC(GAATA)nGAATG

GATCAGAGTAATATTAAAGAGTATCTAGATATTCATCCACATTATAAAGTTT

TAGTTCAGGCCTCTTTTTCTTCTCCATCAAGTTATTCCTTGAGGCTTCCCTG

AACTTTTTATTTTATGCCTTTCT，

Be the LFG21 site, this site is the little satellite of a pentanucleotide multiple, and core sequence is (GAATA), and the different multiplicity of core sequence are represented with n;

Sequence

TTAAAAGTTACAGGTTCTAGGAAACATGGCTGGTGAATACAATAATAAT

TTATTAATTTTAATGTCAGCTTCAAATTTTTGGTTCTTTGGAAAATTGT

TTAGGCCCCCAAATATATAGGTC(TATG)n(CATG)mTATG(CATG)k

(TATG)p(TATC)qTATAGCTGCATTGATGCTGTAAGT，

Be the LFG24 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TATGxCATGxTATC), and the different multiplicity of core sequence are with n, m, and k, p, q represents;

Sequence

ACCACTTTAGAGTTGACAAACTCCATGTTGGAACAGAGTATTCTT

AAACAGAACCCTTAAAACCATATTTTTCACCTCTCTGTTTT(TATC)n

TATTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTCGT

GTGATCACGGTTCTCTGCAGCCTCGATCTCCTGGGCTCTAGCTATCCT

CCCAACTAGCTCAGATTACA，

Be the LFG26 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TATC), and the different multiplicity of core sequence are represented with n;

Sequence

ACTTTCTGGTTTGGAAAATTTGCTTGAGAGGTAAAAAGAAAATTT(ACTT)n

(ATTT)mAGTAGAGACAGAATCTCGCTCTGTTGCTCAGGCTGGAGTGCAGTA

GCACGATCCTGGCTCACTGCAAACTGACTCCTGGGTTCAGGTG，

Be the LFG29 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (ACTTxATTT), and the different multiplicity of core sequence are with n, and m represents;

Sequence

CAGGTGTGAGCCACCATACCCAGCCTTACTGTATC(ATAG)nATG(ATAG)m

AATATAGTTGCCTACAATATTCAGCACAGTAACAGCTATATAGGTCTGTAG

CTTGGGAGCAATAGGC，

Be the LFG33 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (ATAG), and the different multiplicity of core sequence are with n, and m represents;

Sequence

CTATTTGGTACACAAGGCAGAATAAAGGGATTATTGCTTGA(TAGG)n

(TAGA)mAGA(TAGA)kTGAGACAAGACAAGACAGACTATGAATAAAT

TAATCATACTGCTG；

Be the LFG34 site, this site is the little satellite of a tetranucleotide multiple, and core sequence is (TAGGxTAGA), and the different multiplicity of core sequence are with n, m, and k represents;

C, basis are determined No. 21 chromosomal numbers in the sample to the detected result of above-mentioned site pcr amplification product.