CN1844408A - Method for screening Down syndrome high risk fetus - Google Patents

Abstract

The invention discloses a method of sieving and checking high-risk foetus with Down's syndrome. The method use actual time fluorescence definite quantity PCR to check Ct value of gene fragment, which stable in evolution and function, on non-21-chromosome of pregnant woman peripheral blood plasma or serum free DNA which fragments is less than 500bp and Ct value of gene fragment on 21-chromosome which related to the occurrence of Down' s syndrome, calculate the absolute value of difference in the two Ct value showing above; and compare with the calculated average absolute value of difference in the two Ct value that use actual time fluorescence definite quantity PCR check 20 shares pregnant woman, who has normal foetus, peripheral blood plasma or serum free DNA which fragments is less than 500bp; if checked pregnant woman whose |delta Ct| larger than average |delta Ct| of pregnant woman who has normal foetus, the foetus ,that the checked woman has, may be high-risk feotus with Down's syndrome. The method of sieving and checking foetus with Down's syndrome non-invasive has the advantage of high percent of accuracy and sensibility; low false positive and false negative ratio.

Description

A kind of method of screening Down syndrome high risk fetus

Technical field

The present invention relates to a kind of method of screening Down syndrome high risk fetus.

Background technology

Mongolism (D.S claims mongolism again, mongolism) is the modal congenital numerical abnormalities of chromosomes disease that causes serious mental retardation, incidence about 1/800; Pregnant woman's incidence is higher advanced age more than 35 years old.D.S. the patient No. 21 karyomit(e)s are 2, have more 1 than the normal people, and promptly its " original copy number " is 1.5 times of normal people.This disease is not had effective methods of treatment so far, cause very big burden for family and society.Prenatal Screening and gene diagnosis are the effective means of avoiding this type of sick child's birth." antenatal diagnosis technical supervision way " detailed rules for the implementation of " the antenatal diagnosis technical supervision way " that China Ministry of Health formulates and Beijing Municipal Health Bureau's formulation have all been stipulated and must have been carried out Prenatal Screening and corresponding techniques standard to mongolism etc.What existing Down syndrome high risk fetus examination (Tang's sieve) clinical application was wider is to survey α-FP (alpha-fetoprotein) and hCG (human chorionic gonadotrophin), uE3 (free trihydroxy-oestrin in pregnant woman's second trimester peripheral blood serum with euzymelinked immunosorbent assay (ELISA), unconjugatedEstriol), analyze above-mentioned two-three measurement results and pregnant woman age, body weight and pregnant week etc. accurately with the computer software synthesis, calculate the relative risk that fetus suffers from D.S and neural tube defects (NTD)." high risk gravida " that sifts out is proposed further extraction amniotic fluid, does karyotyping, so that accurately find D.S and 18 possible trisomes, or 13-trisome etc. is unusual.This kind method can calculate the risk of NTD simultaneously.But the result according to domestic a large amount of examinations in recent years sees, reflects that generally its false positive rate is very high, (sieve several thousand examples and do not find the 1 example positive unexpectedly); And also have certain loss, i.e. examination is to have given birth to D.S infant (Sun Niangu, Tang Shi examination, the present situation and the countermeasure of China, the 5th national antenatal diagnosis scientific seminar paper compilation, in September, 2005, Wuhan, Hubei P38 among the low-risk pregnant woman; Liu Zijian, antenatal diagnosis, the experiences and lessons in Hong Kong, the 5th national antenatal diagnosis scientific seminar paper compilation, in September, 2005, Wuhan, Hubei P37).Another kind is the unusual auxiliary diagnosis index as the D.S fetus of observing the thickness (NT) of measuring fetus neck transparent layer with B ultrasonic.But this index is all very high to operator's requirements such as experience, skill and instrument, and sensitivity is low, and only 60-70% is influenced by pregnant woman's body weight, diabetes and smoking etc., and error is also very big; Further among research and the summing up experience (Yan Yingliu, heredity is ultrasonic, the 5th national antenatal diagnosis scientific seminar paper collects in September, 2005, Wuhan, Hubei P51).The multiple real-time quantitative PCR technology of usefulness such as Lv Shiming is carried out tube amplification to target gene and reference molecules mark, determine No. 21 chromosome numbers and diagnose mongolism (Lv Shiming etc. thus by the two Δ CT value, application number: CN200510049601.2, No. 21 chromosome number purposes of real-time quantitative PCR technology for detection people method).This technology be based upon absolute quantitation method on the typical curve basis (Zheng Mingming, Hu Yali etc., the application of real-time fluorescence quantitative PCR technology in the antenatal diagnosis mongolism. Chinese journal of obstetrics and gynecology, 2004,39:678-681) easier, more accurate; But can not be used for not having the wound Prenatal Screening.In addition, Liu Jingzhong has also initiated utilization SYBR Green 1 real-time fluorescence PCR is made diagnosis to D.S in conjunction with the melt curve analysis analytical method technology (Liu Jingzhong, application number: CN200510055338.8, down's syndrome gene diagnostic new technology and application thereof).Above-mentioned three kinds of technology for detection all be amniocyte, fine hair or white corpuscle DNA are to be used for the diagnosis of D.S or the antenatal diagnosis of wound property is arranged, rather than do not have the wound Prenatal Screening.

In discovered in recent years maternal blood blood plasma and the serum dissociative DNA is arranged, and comprise foetal DNA, though very low (the Lo YM of the ratio that the latter accounts for, Corbetta N, Chamberlain PF et al, Presence of fetalDNA in maternal plasma and serum.Lancet 1997,350:485-487).And then report such as Li Y is divided into the total DNA of pregnant woman blood plasma with gel electrophoresis the component of different lengths, discovery is in the component of≤300bp, the ratio that foetal DNA accounts for is the highest, (accounting for 28.4%～68.7%) (Li Y, Zimmermann B, Rusterholz C et al, Size Seperation of circulatory DNA in maternal plasmapermits ready detection of fetal DNA polymorphisms.Clin.Chem, 50:1002-1011,2004).So the very low foetal DNA of script concentration has just been played an enrichment.From the DNA of this component by a plurality of STR site fragment on No. 21 karyomit(e)s of multiplex PCR amplification, automatically analyze through ABI310 then, from the peak type, male fetus can be diagnosed out very clearly, thereby the nothing wound antenatal diagnosis of sex linkage single gene inheritance disease, RhD mother and baby's blood group incompatibility can be carried out; Can find simultaneously the special polymorphism sign (STR) in father source on the sudden change of the beta-globin gene whether fetus inherited father or No. 21 karyomit(e).Or actually but owing to can not distinguish the STR peak one two (by pregnant woman DNA peak covered) of fetus from mother's succession, they think whether still can not detect fetus from the maternal blood dissociative DNA suffers from mongolism (Li Y thus, Zimmermann B, Rusterholz C et al, Size Seperation of circulatoryDNA in maternal plasma permits ready detection of fetal DNA polymorphisms.Clin.Chem, 50:1002-1011,2004).Obtain the diagnosis of technique D.S that fetal nucleated red blood is used PCR-based then from the maternal blood separation.Though fetus is Non-Invasive technology (Samura O, Sohda S, JohnsonK, et al, Diagnosis of trisomy 21 in fetal nucleated erythrocytes frommaternal blood by use of short tandem repeat sequences.Clin.Chem.2001,47:1622-1626), but because the fetal nucleated red blood number that obtains very little, need expensive plant and instrument, unicellular PCR's is highly difficult etc., so still be in the conceptual phase of Individual testwas chamber.

Real-time fluorescence quantitative PCR (real-time Q-PCR) technology has realized the leap of PCR from qualitative to quantitative, it with its high specificity, highly sensitive, good reproducibility, quantitatively accurately, advantages such as fast, the totally-enclosed reaction of speed become the important tool in the molecular biology research.So-called real-time Q-PCR technology is meant in the PCR reaction system to add fluorophor, utilizes the fluorescent signal accumulation whole PCR process of monitoring in real time, the method for by typical curve unknown template being carried out quantitative analysis at last.In real-time Q-PCR, whole PCR reaction amplification procedure has been carried out real-time monitoring and analysing amplified relevant fluorescent signal continuously, along with the carrying out in reaction times, the variation of the fluorescent signal that monitors can be depicted as a curve.Early stage in PCR reaction, the level that produces fluorescence can not be distinguished significantly with background, can certain detect the amount of PCR product on a bit in that the PCR reaction is in exponential phase, and infer the copy number that template molecule is initial thus.At first need set the thresholding of certain fluorescent signal, general this threshold value (thresholding) (threshold) be preceding 15 round-robin fluorescent signals with the PCR reaction as fluorescence background signal (baseline), the setting of thresholding is 10 times of standard deviation of 3～15 round-robin fluorescent signals.Be considered to real signal if detect fluorescent signal above threshold value, it can be used for defining the thresholding cycle number (Ct) of sample.The implication of Ct value is: the cycle number that the fluorescent signal in each reaction tubes is experienced when reaching the thresholding of setting.Studies show that there is linear relationship in the logarithm of the Ct value of each PCR reaction and the initial copy number of this pcr template, initial copy number is many more, and the Ct value is more little.Utilize the standard substance of known initial copy number can make typical curve,, can calculate the initial copy number of this sample from typical curve as long as therefore record the Ct value of unknown sample.The most frequently used Real-time Q-PCR is the Taqman probe technique.

Summary of the invention

The method that the purpose of this invention is to provide a kind of screening Down syndrome high risk fetus.

The method of screening Down syndrome high risk fetus provided by the present invention, be with real-time fluorescence quantitative PCR detect simultaneously in maternal blood blood plasma or the free serum DNA in the DNA component less than 500bp on non-No. 21 karyomit(e)s evolve with function on the Ct value of the gene fragment relevant on the Ct value, No. 21 karyomit(e) of stable gene fragment with the generation of mongolism, calculate the absolute value of the difference of described two Ct values, obtain pregnant woman to be measured | Δ Ct|;

With detect with described real-time fluorescence quantitative PCR at least 20 parts of normal fetus maternal blood blood plasma in bosom or the free serum DNA in the DNA component less than 500bp on non-No. 21 karyomit(e)s evolve with function on the Ct value of the gene fragment relevant on the Ct value, No. 21 karyomit(e) of stable gene fragment with the generation of mongolism, calculate the average absolute of the difference of described two Ct values, obtain cherishing normal fetus pregnant woman | the mean value of Δ Ct|;

As pregnant woman to be measured | Δ Ct| is greater than the normal fetus pregnant woman in bosom | the mean value of Δ Ct| and 2SD sum (threshold value), then this pregnant woman to be measured fetus of cherishing is an excessive risk mongolism fetus; Described 2SD is the pregnant woman of the normal fetus in bosom | two times of standard deviations of Δ Ct|.

Above-mentioned real-time fluorescence quantitative PCR is a multiple real time fluorescence quantifying PCR.

The pcr template that described multiple real time fluorescence quantifying PCR detects maternal blood blood plasma to be measured or serum is less than the DNA component of 500bp in maternal blood blood plasma to be measured or the serum.

In order to improve the sensitivity of examination, the pcr template that described multiple real time fluorescence quantifying PCR detects maternal blood blood plasma to be measured or serum is less than the DNA component that equals 300bp in maternal blood blood plasma to be measured or the serum.

In actual applications, on described non-No. 21 karyomit(e)s evolve and function on stable gene can be the GAPDH gene, the gene relevant with the generation of mongolism can be the DSCR3 gene on described No. 21 karyomit(e)s.The normal fetus pregnant woman's in described bosom | the mean value of Δ Ct| and 2SD sum are 1.62 under experiment condition of the present invention.This numerical value is fixed under the condition of using same test kit; But can be different when using different test kit.

In the described real-time fluorescence quantitative PCR, the primer of amplification DSCR3 gene has the nucleotide sequence of sequence 1 and sequence 2 in the sequence table, detects the nucleotide sequence that the probe of DSCR3 gene has sequence 3 in the sequence table.

In the described real-time fluorescence quantitative PCR, the primer of amplification GAPDH gene has the nucleotide sequence of sequence 4 and sequence 5 in the sequence table, detects the nucleotide sequence that the probe of GAPDH gene has sequence 6 in the sequence table.

In actual applications, on described non-No. 21 karyomit(e)s evolve and function on stable gene can be the RABIF gene, the gene relevant with the generation of mongolism can be D21S1437 on described No. 21 karyomit(e)s.This moment the normal fetus pregnant woman in described bosom | the mean value of Δ Ct| and 2SD sum are being fixed for this numerical value of 1.86. under the condition of the same test kit of use under the experiment condition of the present invention; But can be different when using different test kit.

In the described real-time fluorescence quantitative PCR, the primer of amplification D21S1437 gene has the nucleotide sequence of sequence 7 and sequence 8 in the sequence table, detects the nucleotide sequence that the probe of D21S1437 gene has sequence 9 in the sequence table.

In the described real-time fluorescence quantitative PCR, the primer of amplification RABIF gene has the nucleotide sequence of sequence 10 and sequence 11 in the sequence table, detects the nucleotide sequence that the probe of RABIF gene has sequence 12 in the sequence table.

In order to improve examination result's reliability, to can also detect simultaneously with a sample on two non-No. 21 karyomit(e)s evolve and function on stable gene, as GAPDH and RABIF gene, the gene relevant with the generation of mongolism on two No. 21 karyomit(e)s is as DSCR3 and D21S1437 gene; When the absolute value of the difference of the Ct value of pregnant woman's to be measured GAPDH gene fragment and DSCR3 gene fragment greater than the normal fetus pregnant woman in bosom | the absolute value of the difference of the mean value of Δ Ct| and 2SD sum, the pregnant woman's to be measured RABIF gene fragment and the Ct value of D21S1437 gene fragment is greater than cherishing normal fetus pregnant woman | the mean value of Δ Ct| and 2SD sum, then this pregnant woman to be measured fetus of cherishing is an excessive risk mongolism fetus; Described 2SD is the pregnant woman of the normal fetus in bosom | two times of standard deviations of Δ Ct|.

The method of screening Down syndrome high risk fetus of the present invention can directly detect excessive risk mongolism fetus from maternal blood blood plasma or serum, and this method does not have wound, accuracy and highly sensitive; The false positive rate false negative rate is low.

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Embodiment 1, detect in mimic maternal blood blood plasma or the free serum DNA Δ CT less than the DNA sample of the DNA component of 500bp-300bp with real-time fluorescence quantitative PCR

1, DNA extracting: obtain genomic dna for the peripheral blood cells that clinical and karyotyping are diagnosed as the infant of D.S with the phenol-chloroform extraction process from 2 normal peoples (2 No. 21 karyomit(e)s are arranged the hemocyte) and 2.Use ultraviolet spectrophotometry, agarose gel electrophoresis method and real-time fluorescence quantitative PCR method (detection) GAPDH gene fragment are accurately made DNA concentration, and are diluted to 0.05 μ g/ μ l.

2, in mimic maternal blood blood plasma or the free serum DNA less than the preparation of the DNA sample of the DNA component of 500bp-300bp: prepare the mixing solutions of normal DNA and D.S infant DNA (D.S.DNA) in varing proportions, undertaken by table 1:

Table 1

The pipe number	1	2	3	4	5	6
							Normal DNA solution (μ l)	0	5	6	7	8	10
D.S.DNA solution (μ l)	10	5	4	3	2	0
							DNA mixed solution cumulative volume (μ l)	10	10	10	10	10	10
The per-cent that D.S.DNA accounts for (%)	100	50	40	30	20	0

No. 2 DNA samples have been equivalent to cherish in the maternal blood blood plasma of a D.S fetus or the free serum DNA less than the DNA component of 500bp in the table 1, and the DNA of its fetus accounts for 50%.In like manner, in the table 1 No. 3, No. 4 and No. 5 samples are equivalent in maternal blood blood plasma of having cherished a D.S fetus or the free serum DNA less than the DNA component of 500bp, and the DNA of its fetus accounts for 40%, 30% and 20% successively.

3, the primer and the probe of the gene DSCR3 fragment relevant with D.S. on No. 21 karyomit(e)s of amplification (in the sequence table sequence 13 from the 28th to the 149th deoxynucleoside acid sequence of 5 ' end) are as follows:

The upstream primer sequence: 5 ' TAG CAA GTC AGA GGT TTC CTT, 3 ' (sequence 1),

Downstream primer: 5 ' AAC ATT GAC TGT GGC TCT TGC, 3 ' (sequence 2)

Detect the probe of DSCR3 gene fragment: 5 ' FAM-CAC TCT CCA GCA AGC TCA AACTGC-Tamra, 3 ' (sequence 3).

4, amplification as the house-keeping gene GAPDH fragment on No. 12 karyomit(e)s of internal reference (in the sequence table sequence 14 from 5 ' the 41st to the 191st deoxynucleoside acid sequence of end) primer and probe as follows:

Upstream primer: 5 ' CTG TCC AGT TAA TTT CTG ACC, 3 ' (sequence 4),

Downstream primer: 5 ' CTT TGT ACA TGG TAT TCA CCA C, 3 ' (sequence 5),

Detect the probe of GAPDH gene fragment: 5 ' VIC-AAT GCT TGC TGC TGC CTA GCTCAG-Tamra, 3 ' (sequence 6).

5, the only reaction system of the pipe every pipe dna single of DNA of 6 in the table 1.PCR reaction mixture cumulative volume 25 μ l, contain dna solution 1 μ l in the table 1, each 0.2 μ mol/L of above-mentioned 2 pairs of primers, the probe that detects the DSCR3 gene is 0.04 μ mol/L, the probe that detects the GAPDH gene is 0.2 μ mol/L, available from the TaqManUniversal Master Mix 12.5 μ l of ABI company.Each the pipe number DNA make 3 parallel pipes.

6, thermal cycling is carried out on ABI Prism 7000 quantitative real time PCR Instruments: earlier 50 ℃ 2 minutes; Then 95 ℃ 10 minutes; Carry out 40 circulations by following condition at last: 95 ℃ 15 seconds, 60 ℃, 1 minute.

Baseline (Baseline) fixes on 6-21, threshold value 0.2, and instrument provides the Ct value of each response curve automatically.

7, it is as follows to calculate Δ Ct: Δ Ct=Ct _GAPDH-Ct _DSCR3

The result is as shown in table 2, shows with D.S.DNA per-cent in the hybrid dna solution to be measured to be increased at 50% o'clock from 20%, and the intergenic Δ Ct of target gene and internal reference is also increasing, and all greater than normal Δ Ct mean value+2SD=1.42 ± 2SD, (seeing embodiment 2).When the pregnant woman cherishes a last D.S. fetus, in the DNA component less than 500bp-300bp in its peripheral blood blood plasma or the free serum DNA, will contain and have an appointment at least 20% to 50%, even 70% D.S foetal DNA.DNA with this component is that the Δ Ct value that template records will be apparently higher than pregnant woman (normal Δ Ct mean value ± 2SD=1.42 ± 2SD of the normal fetus in bosom like this; If record the Δ Ct value 〉=1.42 ± 2SD of key sample not conversely speaking,, can judge this not key sample be " excessive risk D.S fetus ".

To be template with normal DNA and D.S.DNA mixing solutions detect Ct value and the Δ Ct value that the GAPDH gene obtains on No. 21 chromosomal DSCR3 genes and No. 12 karyomit(e) with real-time fluorescence quantitative PCR with table 2.

NO.	The per-cent that D.S.DNA accounts for (%)	DSCR3	GAPDH	ΔCt	ΔCt*
						123 is average	123 is average
		1	100					24.97 25.33 25.41 25.24	26.71 28.13 28.44 27.76	2.52	2.65
2	50			25.64 25.68 25.75 25.69	28.09 28.16 27.92 28.06	2.37	2.12
		3	40					25.80 26.18 25.89 25.96	27.70 28.33 28.51 28.18	2.22	1.93
4	30			26.08 25.94 26.14 26.05	28.31 28.18 28.15 28.21	2.16	1.88
		5	20					26.08 26.15 26.13 26.12	27.54 28.14 27.85 27.84	1.72	1.75

6

0

26.58 26.59 26.54 26.57

28.14 28.06 27.81 28.00

1.43

1.41

* the Δ Ct* that calculates of the Ct value that records from another part normal DNA and another part D.S.DNA mixing solutions.

Embodiment 2, with the high risk fetus of method examination D.S of the present invention

After separating the DNA component that obtains less than 500bp step by step with agarose gel electrophoresis, detect 16 and (survey AFP with euzymelinked immunosorbent assay (ELISA), hCG) examination is that the high risk pregnant woman of D.S and 24 (survey AFP with euzymelinked immunosorbent assay (ELISA), hCG) examination is the low-risk pregnant woman's of D.S DSCR3 and GAPDH gene C t value and a Δ Ct value, and concrete steps are as follows:

1, get blood before, sign Informed Consent Form with every pregnant woman.Every part of each 10ml of EDTA anticoagulation sample takes from euzymelinked immunosorbent assay (ELISA) and (surveys AFP, hCG) detecting is that 16 of high risk pregnant woman of D.S fetus and examination are 24 of the low-risk pregnant woman of D.S, through 2 centrifugal (1600g, 10 minutes, supernatant is again through 16000g, 10 minutes) obtain blood plasma.

2, plasma dna extracts: extract DNA in the blood plasma with German QIAamp mini Kit method, undertaken by shop instruction, measure concentration with ultraviolet spectrometry, it is standby to be diluted to 0.50 μ g/ μ l.

3, among the maternal blood plasma free DNA less than the preparation of the DNA component of 500bp: above-mentioned totally 40 parts of plasma dnas, use 1% agarose gel electrophoresis, respectively add dna solution 15 μ l, add DNA length standard thing simultaneously: 100bp ladder and Lamda DNA/Hind III enzyme are cut thing.Electrophoresis 80 volts 1 hour.The gel that will contain 500～80bp DNA downcuts, and reclaims wherein DNA of purifying with the Qiagen QIAEX II Gel Extraction Kit of company, is dissolved among the 15 μ l Tris-Hcl pH 8.0buffer.

4, the extraction of the genomic dna of 20 D.S. infant peripheral blood cells is with the step 1 of embodiment 1.

5, with real-time fluorescence quantitative PCR measure 24 with euzymelinked immunosorbent assay (ELISA) (survey AFP, hCG) detect among the maternal blood plasma free DNA of D.S fetus low yield risk less than the Δ Ct value of the genomic dna of the DNA component of 500bp and 20 D.S. infant peripheral blood cells.Outside the PCR reaction system removing template DNA difference, all the other are with the step 5 of embodiment 1.

6, the method for calculation of PCR reaction and Δ Ct value are with the step 6 and 7 of embodiment 1.

7, measure 16 described euzymelinked immunosorbent assay (ELISA) of using with real-time fluorescence quantitative PCR and (survey AFP, hCG) detect among the D.S high risk gravida peripheral blood plasma free DNA less than the Δ Ct value of the DNA component of 500bp: outside above-mentioned 16 parts of DNA sample PCR reaction system removing template DNA samples, all the other are with the step 5 of embodiment 1;

8, the method for calculation of PCR reaction and Δ Ct value are with the step 6 and 7 of embodiment 1.

The result shows 24, and to detect with euzymelinked immunosorbent assay (ELISA) be that the average absolute less than the Δ Ct value of the DNA component sample of 500bp is among the D.S low risk maternal blood plasma free DNA: 1.42 ± 0.20.The average absolute of the Δ Ct value of the genomic dna of 20 D.S. infant peripheral blood cells is: 2.58 ± 0.20.16 parts described with euzymelinked immunosorbent assay (ELISA) detect be among the high risk maternal blood plasma free of the D.S DNA less than the Δ Ct value such as the table 3 of the DNA component sample of 500bp:

It is less than the Δ Ct value of the DNA component sample of 500bp among the D.S excessive risk maternal blood plasma free DNA that 16 parts in table 3 detects with euzymelinked immunosorbent assay (ELISA)

NO.	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16
																	ΔCt	1.42	1.60	1.52	1.66	1.28	2.22	1.53	1.62	1.46	1.49	1.34	1.42	2.35	1.55	1.38	1.42

Table 3 shows that the Δ Ct of 6# and 13# obviously exceeds range of normal value (1.42+0.20), so this two routine pregnant woman can be judged as real D.S excessive risk.This is with consistent with the result of amniotic fluid karyotyping.Show simultaneously, (survey AFP, hCG) detect, have 14 examples to be false positive (false positive rate 81.5%) with euzymelinked immunosorbent assay (ELISA) for 16 parts among the high risk pregnant woman of D.S.

Embodiment 3, with the high risk fetus of method examination D.S of the present invention

After separating DNA component step by step with agarose gel electrophoresis smaller or equal to 300bp, detecting no polymorphism on another gene fragment D21S1437 relevant closely with D.S on No. 21 karyomit(e) and No. 1 karyomit(e) does not have Ct value and the Δ Ct of another internal reference gene RABIF of trisome possibility, and concrete steps are as follows:

1, get blood before, sign Informed Consent Form with every pregnant woman.Every part of each 10ml of EDTA anticoagulation sample, (survey AFP, hCG) detecting is that 16 of high risk pregnant woman of D.S fetus and examination are 24 of the low-risk pregnant woman of D.S to take from the usefulness euzymelinked immunosorbent assay (ELISA), through 2 centrifugal (1600g, 10 minutes, supernatant was again through 16000g, 10 minutes) obtain blood plasma.With embodiment 2.

2, plasma dna extracts with embodiment 2 steps 2.

3, among the maternal blood plasma free DNA less than the preparation of the DNA component that equals 300bp with embodiment 2 steps 3.

4, the extraction of the genomic dna of 20 D.S. infant peripheral blood cells is with the step 1 of embodiment 1.

5, the primer and the probe of target gene D21S1437 fragment on No. 21 karyomit(e)s of amplification (in the sequence table sequence 15 from the 157th to the 280th deoxynucleoside acid sequence of 5 ' end) are as follows:

Upstream primer sequence 5 ' ATG TAC ATG TGT CTG GG AAG 3 ' (sequence 7),

Downstream sequence 5 ' CTC TAC ATA TTT ACT GCC AAC 3 ' (sequence 8);

Detect the probe of D21S1437 gene: 5 ' Fam-CTTCCTTCCTTCCTTCCTTCCTTC-Temra 3 ' (sequence 9).

6, the primer and the probe of the RABIF gene fragment on No. 1 karyomit(e) of amplification (in the sequence table sequence 16 from the 6th to the 68th deoxynucleoside acid sequence of 5 ' end) are as follows:

Upstream primer: 5 ' CTCAACATGGGCCCCACAT 3 ' (sequence 10);

Downstream primer: 5 ' AAGCCAGTGTGCCTGAAGCA 3 ' (sequence 11);

Detect the probe 5 ' VIC-TCCTAGTTTCCCCGGCTCATTATG-Temra (sequence 12) of RABIF gene.

7, with real-time fluorescence quantitative PCR measure 24 with euzymelinked immunosorbent assay (ELISA) (survey AFP, hCG) detect among the maternal blood plasma free DNA of D.S fetus low yield risk less than the Δ Ct value of the genomic dna of the DNA component that equals 300bp and 20 D.S. infant peripheral blood cells.The PCR reaction system is that all the other are with the step 5 of embodiment 2 primer and probe of above-mentioned steps 5 and 6 except that 2 pairs of primers and probe.Each 0.2 μ mol/L of above-mentioned 2 pairs of primers, concentration and probe concentration is 0.04 μ mol/L.The PCR reaction is with the step 6 of embodiment 1.ΔCt＝Ct _RABIF-Ct _D21S1437。

8, measure 16 described euzymelinked immunosorbent assay (ELISA) of using with real-time fluorescence quantitative PCR and (survey AFP, hCG) detect among the D.S high risk gravida peripheral blood plasma free DNA less than the Δ Ct value of the DNA component that equals 300bp: outside above-mentioned 16 parts of DNA sample PCR reaction system removing template DNA samples, all the other are with step 7; Δ Ct=Ct _RABIF-Ct _D21S1437

The result shows that detecting with euzymelinked immunosorbent assay (ELISA) with 24 is to be that template is carried out real-time fluorescence quantitative PCR (respectively making 3 parallel pipes) less than the DNA component that equals 300bp among the low-risk maternal blood plasma free of the D.S DNA, detect No. 1 on the karyomit(e) the RABIF gene fragment and No. 21 karyomit(e) on the average absolute of the Δ Ct value that obtains of target gene D21S1437 fragment be: 1.62 ± 0.20.

Genomic dna with 20 D.S. infant peripheral blood cells is that template is carried out real-time fluorescence quantitative PCR (respectively making 3 parallel pipes), detect No. 1 on the karyomit(e) the RABIF gene fragment and No. 21 karyomit(e) on the average absolute of the Δ Ct value that obtains of target gene D21S1437 fragment be: 2.70 ± O.20.

With 16 parts of described detections with euzymelinked immunosorbent assay (ELISA) is to be that template is carried out real-time fluorescence quantitative PCR (respectively making 3 parallel pipes) less than the DNA component that equals 300bp among the high risk maternal blood plasma free of the D.S DNA, detect No. 1 on the karyomit(e) the RABIF gene fragment and No. 21 karyomit(e) on the segmental Ct value of target gene D21S1437, calculate the Δ Ct of every part of sample, the results are shown in table 4:

It is less than the Δ Ct value of the DNA component sample that equals 300bp among the D.S excessive risk maternal blood plasma free DNA that table 4.16 part detects with euzymelinked immunosorbent assay (ELISA)

NO.	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16
																	ΔCt	1.56	1.46	1.65	1.78	1.56	2.10	1.63	1.58	1.56	1.42	1.58	1.81	2.38	1.56	1.69	1.58

Table 4 is the result show, 6# and 13# Δ Ct obviously exceed range of normal value (1.62+0.20), belongs to D.S excessive risk fetus.12# Δ Ct1.81 is near the upper limit (1.82) of the average absolute of normal Δ Ct value, but still (can repeat work for caution's sake once to key sample not in normal range; And suggestion 2-3 checked after week).As seen, it is consistent that utilization detects the result that the real-time fluorescence quantitative PCR of RABIF gene on D21S1437 gene on No. 21 karyomit(e)s and No. 1 karyomit(e) and embodiment 2 mensuration DSCR3 and GAPDH gene draw, promptly in 16 routine pregnant woman, 6# and 13# are D.S excessive risk fetuses, and other 14 all is low risks.The accuracy and the sensitivity of using method of the present invention not have wound examination D.S. fetus all reach well-content degree, do not find false positive and false negative in this 16 example.

In actual applications, to can also use embodiment 2 and embodiment 3 described two kinds of real-time fluorescence quantitative PCR systems to detect simultaneously with a sample, comprehensive two results make finishing screen and come to an end by more reliable.

Sequence table

<160>16

<210>1

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

tagcaagtca gaggtttcct t 21

<210>2

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

aacattgact gtggctcttg c 21

<210>3

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

cactctccag caagctcaaa ctgc 24

<210>4

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

ctgtccagtt aatttctgac c 21

<210>5

<211>22

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>5

ctttgtacat ggtattcacc ac 22

<210>6

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

aatgcttgct gctgcctagc tcag 24

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>7

atgtacatgt gtctgggaag 20

<210>8

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>8

ctctacatat ttactgccaa c 21

<210>9

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>9

cttccttcct tccttccttc cttc 24

<210>10

<211>19

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>10

ctcaacatgg gccccacat 19

<210>11

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>11

aagccagtgt gcctgaagca 20

<210>12

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>12

tcctagtttc cccggctcat tatg 24

<210>13

<211>210

<212>DNA

＜213〉Genus Homo people (Homo sapiens)

<400>13

ctatggggag tccctggcta catccattag caagtcagag gtttcctttt gtccccatga 60

tgccactctc cagcaagctc aaactgctgt cacaattgtt ttactgtacc taaaaaggaa 120

cagataaggc aagagccaca gtcaatgttt tctgtgaaat ggtcttggca aatagcatta 180

agaaatcttg ttgaatttca aagaaaaggt 210

<210>14

<211>240

<212>DNA

＜213〉Genus Homo people (Homo sapiens)

<400>14

cccttttgta ggagggactt agagaagggg tgggcttgcc ctgtccagtt aatttctgac 60

ctttactcct gccctttgag tttgatgatg ctgagtgtac aagcgttttc tccctaaagg 120

gtgcagctga gctaggcagc agcaagcatt cctggggtgg catagtgggg tggtgaatac 180

catgtacaaa gcttgtgccc agactgtggg tggcagtgcc cacatggccg cttctcctgg 240

<210>15

<211>300

<212>DNA

＜213〉Genus Homo people (Homo sapiens)

<400>15

ccatccatgt tcccgaaatg atcttgtnct ttttaatgcc tgtatagtat tccacagtgt 60

atatgtacaa aattttattt atccagtcta ccactgatgg acatttaggt tgattccatg 120

tctttnctat tgtgaatagt gctgcaatga acatacatgt acatgtgtct gggaaggagg 180

gaaggaagga cggaaggngg gaaggaagga aggaaggaag gaaggaagga aggaaggaag 240

gaaggaagga aggacgngtg ttggcagtaa atatgtagag aaattagaat acttatacat 300

<210>16

<211>100

<212>DNA

＜213〉Genus Homo people (Homo sapiens)

<400>16

ctgtcctcaa catgggcccc acatggtcct agtttccccg gctcattatg cttcaggcac 60

actggctttc ttgccttcct caaacagcat tggtctgttc 100

Claims (10)

1, a kind of method of screening Down syndrome high risk fetus, be with real-time fluorescence quantitative PCR detect simultaneously in maternal blood blood plasma or the free serum DNA in the DNA component less than 500bp on non-No. 21 karyomit(e)s evolve with function on the Ct value of the gene fragment relevant on the Ct value, No. 21 karyomit(e) of stable gene fragment with the generation of mongolism, calculate the absolute value of the difference of described two Ct values, obtain pregnant woman to be measured | Δ Ct|;

With detect with described real-time fluorescence quantitative PCR at least 20 parts of normal fetus maternal blood blood plasma in bosom or the free serum DNA in the DNA component less than 500bp on non-No. 21 karyomit(e)s evolve with function on the Ct value of the gene fragment relevant on the Ct value, No. 21 karyomit(e) of stable gene fragment with the generation of mongolism, calculate the average absolute of the difference of described two Ct values, obtain cherishing normal fetus pregnant woman | the mean value of Δ Ct|;

As pregnant woman to be measured | Δ Ct| is greater than the normal fetus pregnant woman in bosom | the mean value of Δ Ct| and 2SD sum, then this pregnant woman to be measured fetus of cherishing is an excessive risk mongolism fetus; Described 2SD is the pregnant woman of the normal fetus in bosom | two times of standard deviations of Δ Ct|.

2, method according to claim 1 is characterized in that: described real-time fluorescence quantitative PCR is a multiple real time fluorescence quantifying PCR.

3, method according to claim 1 is characterized in that: the pcr template that described multiple real time fluorescence quantifying PCR detects maternal blood blood plasma to be measured or serum is less than the DNA component of 500bp in maternal blood blood plasma to be measured or the serum.

4, method according to claim 3 is characterized in that: the pcr template that described multiple real time fluorescence quantifying PCR detects maternal blood blood plasma to be measured or serum is less than the DNA component that equals 300bp in maternal blood blood plasma to be measured or the serum.

5, according to arbitrary described method in the claim 1 to 4, it is characterized in that: on described non-No. 21 karyomit(e)s evolve and function on stable gene be the GAPDH gene, the gene relevant with the generation of mongolism is the DSCR3 gene on described No. 21 karyomit(e)s.

6, method according to claim 5, it is characterized in that: in the described real-time fluorescence quantitative PCR, the primer of amplification DSCR3 gene fragment has the nucleotide sequence of sequence 1 and sequence 2 in the sequence table, detects the nucleotide sequence that the probe of DSCR3 gene fragment has sequence 3 in the sequence table.

7, method according to claim 5, it is characterized in that: in the described real-time fluorescence quantitative PCR, the primer of amplification GAPDH gene fragment has the nucleotide sequence of sequence 4 and sequence 5 in the sequence table, detects the nucleotide sequence that the probe of GAPDH gene fragment has sequence 6 in the sequence table.

8, according to arbitrary described method in the claim 1 to 4, it is characterized in that: on described non-No. 21 karyomit(e)s evolve and function on stable gene be the RABIF gene, the gene relevant with the generation of mongolism is D21S1437 on described No. 21 karyomit(e)s.

9, method according to claim 8, it is characterized in that: in the described real-time fluorescence quantitative PCR, the primer of amplification D21S1437 gene fragment has the nucleotide sequence of sequence 7 and sequence 8 in the sequence table, detects the nucleotide sequence that the probe of D21S1437 gene fragment has sequence 9 in the sequence table; The primer of amplification RABIF gene fragment has the nucleotide sequence of sequence 10 and sequence 11 in the sequence table, detects the nucleotide sequence that the probe of RABIF gene fragment has sequence 12 in the sequence table.

10, according to arbitrary described method in the claim 1 to 4, it is characterized in that: on described non-No. 21 karyomit(e)s evolve and function on stable gene be GAPDH and RABIF gene, the gene relevant with the generation of mongolism is DSCR3 and D21S1437 gene on described No. 21 karyomit(e)s;

When the absolute value of the difference of the Ct value of pregnant woman's to be measured GAPDH gene fragment and DSCR3 gene fragment greater than the normal fetus pregnant woman in bosom | the absolute value of the difference of the mean value of Δ Ct| and 2SD sum, the pregnant woman's to be measured RABIF gene fragment and the Ct value of D21S1437 gene fragment is greater than cherishing normal fetus pregnant woman | the mean value of Δ Ct| and 2SD sum, then this pregnant woman to be measured fetus of cherishing is an excessive risk mongolism fetus; Described 2SD is the pregnant woman of the normal fetus in bosom | two times of standard deviations of Δ Ct|.