CN111500696B - Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum - Google Patents
Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum Download PDFInfo
- Publication number
- CN111500696B CN111500696B CN202010193108.2A CN202010193108A CN111500696B CN 111500696 B CN111500696 B CN 111500696B CN 202010193108 A CN202010193108 A CN 202010193108A CN 111500696 B CN111500696 B CN 111500696B
- Authority
- CN
- China
- Prior art keywords
- pcr
- base extension
- primer sequence
- sequence
- single base
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of a pregnant woman based on flight time mass spectrometry, which comprises a PCR reaction system and a single-base extension reaction system. The kit disclosed by the invention is combined with time mass spectrometry detection, and has the following advantages: 1. the detection accuracy is high; 2. the detection flux is high; 3. the detection sensitivity is high; 4. the detection site is flexible and variable; 5. the detection process is simple and convenient, and the operation time is short; 6. the detection cost is low; 7. the prenatal noninvasive detection has the advantages that the damage to the pregnant woman is extremely small, the psychological burden of the pregnant woman is reduced, and the detection sample is that the peripheral blood of the pregnant woman is easy to obtain; 8. the whole detection operation is easy to repeat, the sample application of the mass spectrum chip is completely automated, and the detection result is automatically analyzed through software, so that the error caused by manual misoperation can be reduced.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of a pregnant woman based on flight time mass spectrometry.
Background
Chromosomal aneuploidy abnormalities are common chromosomal disorders including trisomy 21, trisomy 18, trisomy 13, and the like. The 21-trisomy syndrome is the most common type, the annual incidence rate is 1/800-1/600, and accounts for about 70% -80% of children trisomy chromosome diseases, the incidence rate increases with the increase of the mother age, and children patients mainly show mental retardation, backward growth, partial combined malformation and multiple organ dysplasia, and heavy burden is brought to families and society. At present, high risk groups are clinically determined mainly by non-invasive prenatal screening measures; common non-invasive prenatal screening techniques include down's screening, ultrasonography, and second generation high throughput genetic sequencing techniques.
The Down's screening, namely maternal serological screening, is a technology for evaluating the risk of 21-trisomy and neural tube defects of a fetus by analyzing the levels of proteins and hormones generated by the fetus and placenta in the serum of the pregnant woman and combining the age, the body mass and the gestational period of the pregnant woman, and is characterized by low price, simple operation, low accuracy rate, high false positive rate and accuracy rate of only 60-70%;
ultrasonic screening comprises screening of body surface deformity and neural tube deformity in the middle of pregnancy by measuring the cervical diaphragma in the early gestation period, and the like, wherein multiple deformities usually exist in 21-trisomy children, the deformities are easy to be found in ultrasonic inspection, about 30 percent of 21-trisomy children are missed to be diagnosed due to no obvious ultrasonic structural abnormality, and the technical method has strict requirements on ultrasonic doctors and instruments for screening;
the second generation high-throughput gene sequencing technology is based on the characteristic that the free DNA of a fetus exists in the peripheral blood of a pregnant woman, the free DNA of the fetus is detected through high-throughput gene sequencing, and the free DNA of the fetus is compared with the existing database to detect a 21-trisomy infant, the accuracy rate of the method is high and can reach 99%, but the detection cost is 2500-3000 yuan/sample and the sample is not included in the medical insurance category due to the fact that the detection cost is high, and many high-risk pregnant women are often prohibited.
Through preliminary investigation, the plasma of pregnant women contains free fetal RNA (cff RNA) in addition to free fetal DNA, and with the continuous and intensive research on the cff RNA, the advantages of the cff RNA are continuously shown: compared with cff DNA, the cff RNA has more copy number, is easier to detect, has better stability and does not depend on fetal gender, and can be used for selecting the cff RNA to replace the cff DNA to become a novel target for noninvasive prenatal screening and diagnosis based on the characteristics.
Disclosure of Invention
The invention aims to solve the technical problem of providing a kit for screening 21-trisomy syndrome by detecting free RNA in the peripheral blood of a pregnant woman based on flight time mass spectrometry, aiming at the defects in the prior art.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows: the kit for screening the 21-trisomy syndrome by detecting the free RNA in the peripheral blood of the pregnant woman based on the flight time mass spectrum comprises a PCR reaction system and a single-base extension reaction system;
wherein, the PCR reaction primer in the PCR reaction system and the reaction probe sequence in the base extension reaction system are as follows:
for site 1, snp ID: the Rs73902942 was found to be,
PCR forward primer sequence: acgttggataatcctggttatccgacac, PCR reverse primer sequence: acgttggatgcattggacattcccctttg, single base extension reaction probe sequence: AACTCCTAGGCCAGC;
for site 2,snp ID: the Rs12482116 of the formula (Rs 12482116),
PCR forward primer sequence: ACGTTGGATGGGGTGCTATGGTTAGTTAGG, PCR reverse primer sequence: ACGTTGGATGGACAGTTTCATCTTCTCCCGACC, single base extension reaction Probe sequence: GTCTGGGGACATGGTC;
for position 3,snp ID: the Rs61735054 of the species,
PCR forward primer sequence: ACGTTGGATGCATTGGACTCTATTTGGAGG, PCR reverse primer sequence: acgttggatagacacagctcttctgcac, single base extension reaction probe sequence: ccagatgccccctctgct;
for position 4,snp ID: the number of the Rs9977003,
PCR forward primer sequence: acgttggatatgttgctgaacgtggg, PCR reverse primer sequence: ACGTTGGATGCTTTGCCTTTCTAGTAATTC, single base extension reaction probe sequence: CGTACACCTTGTGGCCC;
for position 5,snp ID: the Rs3804026 protein was found to be,
PCR forward primer sequence: acgttggatgtgagagtaacgttggcgatg, PCR reverse primer sequence: acgttggatgtgaaacagatgggagtgtgc, single base extension reaction probe sequence: CTTTATGGTACCCTGGAA;
for position 6,snp ID: the Rs59066201 is used for preventing the abnormal conditions of the human body,
PCR forward primer sequence: acgttggatgcagaactggatttcagtgacc, PCR reverse primer sequence: acgttggataagaagcaacgactccaag, single base extension reaction probe sequence: CCTTCTGTGCCAGCTCAC;
for position 7,snp ID: the number of Rs9015 is as follows,
PCR forward primer sequence: ACGTTGGATGACAATTTGTTTGGCGGCCT, PCR reverse primer sequence: acgttggatagcacagcccaagtatcac, single base extension reaction probe sequence: ataaccccactgtctcatttca;
for position 8,snp ID: the Rs73364412 was found to be,
PCR forward primer sequence: acgttggatggatactctgatcaagggc, PCR reverse primer sequence: acgttggataggagacaatgctggcacaag, single base extension reaction probe sequence: gcaggacgatttcatctcc;
for position 9,snp ID: the Rs12106409 is used as a reference,
PCR forward primer sequence: ACGTTGGATGGACCTATACAAGACACTGG, PCR reverse primer sequence: ACGTTGGATGCTGTTTTCCATACCTATCGG, a single base extension reaction probe sequence: agaacactggatttcaagtta;
for position 10,snp ID: the concentration of the Rs8130833 is higher,
PCR forward primer sequence: acgttggatgtgaaccatgttttaggccag, PCR reverse primer sequence: ACGTTGGATGGTATTGCAACACCATTTGGG, single base extension reaction probe sequence: ggaggccagatattcgtc;
for position 11, snp ID: the concentration of the Rs4818219,
PCR forward primer sequence: acgttggatgagacagaattgtgtggc, PCR reverse primer sequence: ACGTTGGATGCATTCGACAAGTAGCAGCTC, single base extension reaction probe sequence: CCACAGCACCTAGCTCTCCAA;
for position 12, snp ID: the Rs12106401 (r) is,
PCR forward primer sequence: ACGTTGGATGGGAAGCAAACTGCATTGCTC, PCR reverse primer sequence: acgttggatgtgttccaccactgagtggc, single base extension reaction probe sequence: ATTCTGGAGTCCCCA;
for position 13, snp ID: the Rs61738364 was used as a standard,
PCR forward primer sequence: acgttggattgtcccttgagcccctttaag, PCR reverse primer sequence: ACGTTGGATGTGCAGTGGCCTCCAAATAGAA, single base extension reaction probe sequence: CCCCTTTAAGCAGCAGCCAC.
Preferably, the kit further comprises an SAP reaction system.
Preferably, the PCR reaction system comprises the PCR reaction primer, PCR special water, PCR Buffer, mgCl2 solution, dNTP Mix solution, PCR hot start enzyme and cDNA template.
Preferably, the PCR reaction system is used to provide for performing a PCR reaction to amplify a heterozygous SNP site: a DNA fragment in which the positions 1-13 are located.
Preferably, the single base extension reaction system comprises the probe, PCR water, base extension Buffer, dNTP Mix solution and single base extension reaction enzyme.
Preferably, the single base extension reaction system is used for performing a single base extension reaction to extend to the SAP mutation site hybridized at high frequency by binding a single base extension probe to the DNA template amplified by the PCR reaction.
Preferably, the SAP reaction system comprises PCR-specific water, SAP Buffer and SAP enzyme.
Preferably, the SAP reaction system is used to provide for an SAP reaction to remove residual dNTPs from the system after the PCR reaction.
The beneficial effects of the invention are: the kit disclosed by the invention is combined with time mass spectrometry detection, and has the following advantages:
1. the detection accuracy rate is high: the mass spectrometer can accurately detect the mutation condition of the high-frequency heterozygous SNP locus according to different charge-to-mass ratios of charged particles (single base extension sequences) and different flight time distances in the vacuum cavity, and the detection accuracy is higher than 99%;
2. the detection flux is high: the detection of 11-fold heterozygous mutation sites is realized in a single hole, and 11-fold reactions in the optimized reaction system are not interfered with each other;
3. the detection sensitivity is high: the DNA template with the copy number as low as 10 can be detected by applying the molecular diagnosis principle, and the method is suitable for detecting the trace fetal free RNA in the peripheral blood of the pregnant woman;
4. the detection site is flexible and variable: different from the highly integrated design of gene chip detection, the high-frequency heterozygous mutation point number can be increased at any time by applying flight time mass spectrum detection, and only a primer and a probe need to be redesigned;
5. the detection process is simple and convenient, and the operation time is short: detection reports can be obtained within 9 hours, and labor cost is reduced;
6. the detection cost is low: the cost of each sample reagent plus consumable material does not exceed 300 yuan, and is far lower than the cost of second-generation sequencing detection;
7. the prenatal noninvasive detection has the advantages that the damage to the pregnant woman is extremely small, the psychological burden of the pregnant woman is reduced, and the detection sample is that the peripheral blood of the pregnant woman is easy to obtain;
8. the whole detection operation is easy to repeat, the sample application of the mass spectrum chip is completely automated, and the detection result is automatically analyzed through software, so that the error caused by manual misoperation can be reduced.
Drawings
FIG. 1 shows a flow of detection using the kit of the present invention in conjunction with a time-of-flight mass spectrometer;
FIG. 2 shows the results of the measurement in example 1.
Detailed Description
The present invention is further described in detail below with reference to examples so that those skilled in the art can practice the invention with reference to the description.
It will be understood that terms such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or combinations thereof.
The invention is based on that the PLAC4 gene on chromosome 21 is expressed as mRNA in placenta and fetal tissues, but can not be detected in blood cell RNA of pregnant women, and the PLAC4-mRNA can not be detected after delivery, thereby proving to have fetal specificity. The PLAC4 gene is positioned at 21q22.2, so that quantitative analysis of PLAC4-mRNA in the plasma of pregnant women can be used for diagnosis of fetal trisomy 21 syndrome. The ratio of the two alleles of the SNP on the PLAC4-mRNA sequence (gene heterozygous sites) was detected by time-of-flight mass spectrometry to assess fetal chromosome number: if a ratio of 1 for both alleles is detected: 1, it is a dimer (normal euploid-negative), if the detection result is 1:2 or 2:1, it is positive for infant with trisomy 21 syndrome.
In combination with time-of-flight mass spectrometry detection, the embodiment provides a kit for screening 21-trisomy syndrome based on time-of-flight mass spectrometry detection of free RNA in peripheral blood of a pregnant woman, and the kit comprises a PCR reaction system, an SAP reaction system and a single-base extension reaction system;
wherein, the PCR reaction primer in the PCR reaction system and the reaction probe sequence in the base extension reaction system are as follows:
for site 1,snp ID: the number of Rs73902942 is as follows,
PCR forward primer sequence: acgttggataatcctggttatccgacac, PCR reverse primer sequence: acgttggatgcattggacattcccctttg, single base extension reaction probe sequence: AACTCCTAGGCCAGC;
for site 2,snp ID: the number of Rs12482116 (Rs 12482116),
PCR forward primer sequence: ACGTTGGATGGGGTGCTATGGTTAGTTAGG, PCR reverse primer sequence: ACGTTGGATGGACAGTTTCATCTTCTCCCGACC, single base extension reaction Probe sequence: GTCTGGGGACATGGTC;
for position 3,snp ID: the Rs61735054 of the strain,
PCR forward primer sequence: ACGTTGGATGCATTGGACTCTATTTGGAGG, PCR reverse primer sequence: acgttggatgaacacaggcctttgcac, single base extension reaction probe sequence: ccagatgccccctctgct;
for position 4,snp ID: the number of the Rs9977003,
PCR forward primer sequence: acgttggatatgttgctgaacgtggg, PCR reverse primer sequence: ACGTTGGATGCTTTGCCTTTCTAGTAATTC, single base extension reaction probe sequence: CGTACACTTGTGGCCC;
for position 5,snp ID: the content of the Rs3804026,
PCR forward primer sequence: acgttggatgtgagagtaacgttggcgatg, PCR reverse primer sequence: acgttggattggaaacagatggagtggc, single base extension reaction probe sequence: CTTTATGGTACCCTGGAA;
for position 6,snp ID: the method is characterized in that the method comprises the steps of Rs59066201,
PCR forward primer sequence: acgttggatgcagaactggatttcagtgacc, PCR reverse primer sequence: acgttggataagaagcaacgactccaag, single base extension reaction probe sequence: ccttctgctgccagtcac;
for position 7,snp ID: the discharge flow of Rs9015 is shown in the specification,
PCR forward primer sequence: ACGTTGGATGACAATTTGTTTGGCGGCCT, PCR reverse primer sequence: acgttggatgaaccagcccaagtatcac, single base extension reaction probe sequence: ataaccccactgtctcatttca;
for position 8,snp ID: the Rs73364412 was found to be,
PCR forward primer sequence: acgttggatggatactctgatctaaggagc, PCR reverse primer sequence: acgttggataggagacaatgctggcacaag, single base extension reaction probe sequence: gcaggacgatttcatctcc;
for position 9,snp ID: the Rs12106409 is used as a reference,
PCR forward primer sequence: ACGTTGGATGGACCTATACAAGACAACTGG, PCR reverse primer sequence: ACGTTGGATGCTGTTTTCCATACCTATCGG, a single base extension reaction probe sequence: agaacactggatttcaagtta;
for position 10, snp ID: the concentration of the Rs8130833 is higher,
PCR forward primer sequence: acgttggatgtgaaccatgttttaggccag, PCR reverse primer sequence: ACGTTGGATGGTATTGCAACACCATTTGGG, single base extension reaction probe sequence: ggaggccagatattcgtc;
for position 11, snp ID: the concentration of the Rs4818219,
PCR forward primer sequence: acgttggatgagacagaattgtgtggc, PCR reverse primer sequence: ACGTTGGATGCATTCGACAAGTAGCAGCTC, single base extension reaction probe sequence: ccacagcacctaggctctccaa;
for position 12, snp ID: the Rs12106401 (r) is,
PCR forward primer sequence: ACGTTGGATGGGAAGCAAACTGCATTGCTC, PCR reverse primer sequence: acgttggatgtgttccaccactgagtggc, single base extension reaction probe sequence: ATTCTGGAGTCCCCA;
for position 13, snp ID: the Rs61738364 was used as a standard,
PCR forward primer sequence: acgttggattgtcccttgagcccctttaag, PCR reverse primer sequence: ACGTTGGATGCAGTGGCCTCCAAATAGAA, a single base extension reaction probe sequence: CCCCTTTAAGCAGCAGCCAC.
All loci 1-13 are located on human chromosome 21 and are high-frequency heterozygous SNP loci; preferably, sites 1-11 are reacted in one well, and sites 12 and 13 are reacted in the other well (too much single-well multiplex PCR easily causes the DNA cross-linking reaction to form primer dimer, which affects the detection result, and the optimized reaction system is preferably single-well 11-fold reaction).
The following examples are provided to further illustrate the present invention, and the reagents, consumables, devices, etc. (all commonly used and commercially available) used in the following examples in addition to the kit mainly include:
qiagen rna extraction reverse transcription kit (purchased);
consumables mainly comprise mass spectrum sample application chips, PCR96 pore plates without skirts, 8 pore strips, transparent sealing plate membranes, EP tubes and the like (purchased);
a vortex oscillator, a PCR 96-well plate centrifuge, a palm centrifuge, a 96-well PCR instrument, a MassARRAY RS1000 sample applicator, a MassARRAY analyzer (flight time mass spectrometer), a liquid transfer single gun, a discharge gun and the like.
Referring to fig. 1, the process of using the kit and matching with a time-of-flight mass spectrometer to carry out noninvasive screening of free RNA in peripheral blood of a pregnant woman for 21-trisomy syndrome mainly comprises the following steps: sampling, sample preparation, PCR reaction, amplification, purification (SAP reaction), primer extension (single base extension reaction), purification, spotting, mass spectrometry, typing report (forming detection result).
Example 1 kits and uses thereof
1. And (3) PCR reaction: the purpose of the step is to amplify the DNA fragment where the heterozygous SNP locus is located, and the PCR single-hole reaction system is 5ul;
1-1, sample pretreatment (sampling and sample preparation): firstly, extracting RNA from a pregnant woman peripheral blood sample according to the operational flow of a Qiagen RNA extraction reverse transcription kit specification, and then carrying out reverse transcription to obtain cDNA; diluting the cDNA sample to 5ng/ul for later use, storing the cDNA sample at-20 ℃ when not in use, and storing the cDNA sample at 4 ℃ when in use;
1-2, diluting the PCR forward primer and the PCR reverse primer (dry powder) by using TE buffer solution to prepare 1uM (each primer) PCR primer mixture, storing at-20 ℃, and storing all other reagents at-20 ℃;
1-3, the PCR mixed solution reaction system (total reaction system is 5 ul) is specifically as follows:
1-4, adding 5uL of prepared PCR mixed solution into each hole of a PCR96 hole plate by using a liquid transfer machine, and then mixing well; the plates were sealed with a sealing plate membrane, vortexed 2 times and centrifuged (4000 rpm, 5 seconds); placing the centrifuged plate into a PCR instrument;
1-5, setting thermal cycle of a PCR instrument:
at 95 ℃ for 2 minutes;
95 ℃,30 seconds, 56 ℃,30 seconds, 72 ℃,60 seconds; 45 cycles;
72 ℃ for 5 minutes; the temperature is reduced to 4 ℃.
2. SAP reaction: the purpose of this step is to remove the residual dNTP in the system after PCR reaction, the SAP mixed liquid is 2uL, the whole reaction system is 7uL (add the prepared 2uLSAP reaction mixed liquid into the previous 5uLPCR mixed liquid reaction system), the system concentration ratio and the operation steps are as follows:
2-1, specifically, the SAP mixed solution reaction system comprises:
| name of reagent | Concentration in 7uL reaction (PCR + SAP) | 2uLSAP mixture reagent volume |
| PCR special water | N/A | 1.53 |
| SAP Buffer | 0.243mM | 0.17 |
| SAP enzyme (shrimp alkaline phosphatase) | 0.5U/rxn | 0.3 |
| Total volume | 7uL | 2uL |
2-2, adding 2uLSAP mixed solution into each hole (the total volume is 7 mu L after the mixed solution is added); the plates were sealed with a sealing membrane, vortexed 2 times and centrifuged (4000 rpm, 5 seconds);
2-3, placing the plate on a PCR instrument, setting up the following program and operating: 1 cycle-37 ℃ for 40 minutes; 5 minutes at 85 ℃; cooling to 4 ℃;
3. single base extension reaction: the purpose of the step is to extend to a high-frequency heterozygous SAP mutation site by combining a single-base extension probe with a DNA template amplified by PCR reaction so as to prepare for sample application of a mass spectrum chip; adding 2uL of the mixed solution of the single base extension reagent into the 7uL system in the previous step for reaction, wherein the final reaction system is 9uL; the method specifically comprises the following steps:
3-1, preparing a single-base extension reaction probe mixed solution, wherein the concentration ratio of each probe in the mixed solution is as follows: the concentration of probes at sites 1, 2 and 12 is 8uM; the concentration of probes at sites 3, 4, 5, 6, 7 and 13 is 10uM; the concentration of probes at sites 8, 9, 10 and 11 is 15uM;
3-2, single base extension reaction mixed liquor and a reaction final system:
| reagent | Concentration in the 9uL reaction | 2uL Single base extension mix volume (uL) |
| PCR special water | N/A | 0.619 |
| Single base extension Buffer | 0.22X | 0.2 |
| ddNTP Mix solution | 1X | 0.2 |
| Probe mixed solution | 8/10/15uM | 0.94 |
| Single base extension reaction enzyme | 1X | 0.041 |
| Total volume | 9uL | 2 |
3-3, adding 2uL of the prepared single-base extension reaction mixed solution into a 7uL system (the final reaction volume is 9 uL) of the previous reaction, sealing the 96-well plate by using a membrane, oscillating in a vortex for 2 times and centrifuging (4000 rpm, 5 seconds);
3-4, placing the 96-well plate in a PCR instrument to carry out the following setting and operation: 30 seconds at 94 ℃;40 cycles, 94 ℃,5 seconds; 5 seconds at 52 ℃;80 ℃,5 seconds (wherein the two steps of 52 ℃ and 80 ℃ are embedded with 5 cycles); 3 minutes at 72 ℃; cooled to 4 ℃.
4. Sample desalting (purification), spotting to chip and mass spectrometer data:
4-1, adding 41ul of special PCR water into each sample hole of the sample plate, and then centrifuging;
and 4-2, desalting the sample by using CPM, spotting the sample on a mass spectrum chip, and acquiring data by using a mass spectrometer.
5. Data acquisition and result analysis to form a typing report
5-1, counting 13 high-frequency heterozygous locus allele ratios according to flight time mass spectrum experiment results, wherein the ratio is 1, and the result shows that the allele ratios are 2 ploids and negative; the appearance ratio is 1;
5-2, according to the steps of the embodiment, 13 positive samples of the 21-trisomy positive standard and the positive clinical sample are detected, so that the methodology of the invention is verified, the detection result shows that the detection accuracy reaches 100%, and the detection result is shown in fig. 2 by taking the positive standard as an example; in FIG. 2, the left side is a normal euploid sample, the right side is a 21-trisomy positive standard quality spectrum detection result, and the SNP heterozygous site is A/G; the normal euploid detection ratio is 1, the mass spectrum detection peak value is the same, and the 21-trisomy has 2A bases due to the fact that one more chromosome is a triploid, and the mass spectrum peak value ratio is 2, and the result shows that the 21-trisomy is positive.
While embodiments of the invention have been disclosed above, it is not limited to the applications listed in the description and the embodiments, which are fully applicable in all kinds of fields of application of the invention, and further modifications may readily be effected by those skilled in the art, so that the invention is not limited to the specific details without departing from the general concept defined by the claims and the scope of equivalents.
Sequence listing
<110> institute of biomedical engineering technology of Suzhou, china academy of sciences
<120> kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum
<160> 39
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
acgttggatg aaatcctggt tactcgacac 30
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acgttggatg cactggacat tctccctttg 30
<210> 3
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
aactcctagg ccagc 15
<210> 4
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
acgttggatg gggtgctatg gttagttagg 30
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
acgttggatg gacagtttca tcttccgacc 30
<210> 6
<211> 16
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
gtctggggac atggtc 16
<210> 7
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
acgttggatg cattggactc tatttggagg 30
<210> 8
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
acgttggatg agaacacagc ctttctgcac 30
<210> 9
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
ccagatgccc ctctgct 17
<210> 10
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
acgttggatg atcttggtgc tgaacgtgtg 30
<210> 11
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
acgttggatg ctttgccttt ctagtaattc 30
<210> 12
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
cgtacacctt gtggccc 17
<210> 13
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
acgttggatg tagagagtaa cgtggcgatg 30
<210> 14
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
acgttggatg gtgaaacaga tggagtgtgc 30
<210> 15
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
ctttatggta ccctggaa 18
<210> 16
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
acgttggatg cagaatcgga ttcagtgacc 30
<210> 17
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
acgttggatg aaagaagcaa cgactccaag 30
<210> 18
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
ccttctgctg ccagctcac 19
<210> 19
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
acgttggatg acaaatttgt ttggcggcct 30
<210> 20
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
acgttggatg acacagccca atagtatcac 30
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
ataaccactg tctcattca 19
<210> 22
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
acgttggatg ggatacctga tctaaggagc 30
<210> 23
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
acgttggatg agagacaatg ctggcacaag 30
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
gcaggacgat ttcattctcc 20
<210> 25
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
acgttggatg gacctataca agacaactgg 30
<210> 26
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
acgttggatg ctgttttcca tacctatcgg 30
<210> 27
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
agacaactgg attcaagtta 20
<210> 28
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
acgttggatg tagaaccatg tttaggccag 30
<210> 29
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
acgttggatg gtattgcaac accatttggg 30
<210> 30
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
ggaggccaga tatattcgtc 20
<210> 31
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
acgttggatg agcagacaga attgtgtggc 30
<210> 32
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
acgttggatg cattcgacaa gtagcagctc 30
<210> 33
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
ccacagcacc tagctctcca a 21
<210> 34
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
acgttggatg ggaagcaaac tgcattgctc 30
<210> 35
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
acgttggatg atttccacca ctgagtgtgc 30
<210> 36
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
attctggagt cccca 15
<210> 37
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
acgttggatg tcccttgagt cccctttaag 30
<210> 38
<211> 30
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
acgttggatg tgcagtggcc tccaaataga 30
<210> 39
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
cccctttaag cagccac 17
Claims (8)
1. A kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of a pregnant woman based on flight time mass spectrometry is characterized by comprising a PCR reaction system and a single base extension reaction system;
wherein, the PCR reaction primer in the PCR reaction system and the reaction probe sequence in the base extension reaction system are as follows:
for site 1, snp ID: the Rs73902942 was found to be,
PCR forward primer sequence: acgttggataatcctggttatccgacac, PCR reverse primer sequence: acgttggatgcattggacattcccctttg, single base extension reaction probe sequence: AACTCCTAGGCCAGC;
for position 2,snp ID: the number of Rs12482116 (Rs 12482116),
PCR forward primer sequence: ACGTTGGATGGGGTGCTATGGTTAGTTAGG, PCR reverse primer sequence: acgttggattggacagttctcatctccgaccs, single base extension reaction probe sequence: GTCTGGGGACATGGTC;
for position 3,snp ID: the Rs61735054 of the strain,
PCR forward primer sequence: ACGTTGGATGCATTGGACTCTATTTGGAGG, PCR reverse primer sequence: acgttggatagacacagctcttctgcac, single base extension reaction probe sequence: ccagatgcc ccctctgct;
for position 4,snp ID: the number of the Rs9977003,
PCR forward primer sequence: acgttggatatgttgctgaacgtggg, PCR reverse primer sequence: ACGTTGGATGCTTTGCCTTTCTAGTAATTC, single base extension reaction probe sequence: CGTACACTTGTGGCCC;
for position 5,snp ID: the Rs3804026 protein was found to be,
PCR forward primer sequence: acgttggatgtgagagtaacgttggcgatg, PCR reverse primer sequence: acgttggattggaaacagatggagtggc, single base extension reaction probe sequence: CTTTATGGTACCTGGAA;
for position 6,snp ID: the Rs59066201 is used for preventing the abnormal conditions of the human body,
PCR forward primer sequence: acgttggatgcagactgattcagtgacc, PCR reverse primer sequence: acgttggataagaagcaacgactccaag, single base extension reaction probe sequence: CCTTCTGTGCCAGCTCAC;
for position 7,snp ID: the number of Rs9015 is as follows,
PCR forward primer sequence: ACGTTGGATGACAAATTTTGTTTGGCGGCCT, PCR reverse primer sequence: acgttggatagcacagcccaagtatcac, single base extension reaction probe sequence: ataacccactgtccattca;
for position 8,snp ID: the Rs73364412 was found to be,
PCR forward primer sequence: acgttggatggatactctgatctaaggagc, PCR reverse primer sequence: acgttggataggagacaatgctggcacaag, single base extension reaction probe sequence: gcaggacgatttcatctcc;
for position 9,snp ID: the Rs12106409 gene was identified as Rs12106409,
PCR forward primer sequence: ACGTTGGATGGACCTATACAAGACAACTGG, PCR reverse primer sequence: ACGTTGGATGCTGTTTTCCATACCTATCGG, a single base extension reaction probe sequence: agaacactggatttcaagtta;
for position 10, snp ID: the concentration of the Rs8130833 is higher,
PCR forward primer sequence: acgttggatgtaaccatgttttaggccag, PCR reverse primer sequence: ACGTTGGATGGTATTGCAACACCATTTGGG, single base extension reaction probe sequence: ggaggccagatattcgtc;
for position 11, snp ID: the number of Rs4818219 (r),
PCR forward primer sequence: acgttggatgagacagaattgtgtggc, PCR reverse primer sequence: ACGTTGGATGCATTCGACAAGTAGCAGCTC, single base extension reaction probe sequence: CCACAGCACCTAGCTCTCCAA;
for position 12, snp ID: the Rs12106401 (r) is,
PCR forward primer sequence: acgttggatggaagcaaactgcattgctc, PCR reverse primer sequence: acgttggatgtgttccaccactgagtggc, single base extension reaction probe sequence: ATTCTGGAGTCCCCA;
for position 13, snp ID: the Rs61738364 was used as a standard,
PCR forward primer sequence: acgttggattgtcccttgagcccctttaag, PCR reverse primer sequence: ACGTTGGATGCAGTGGCCTCCAAATAGAA, a single base extension reaction probe sequence: CCCCTTTAAGCAGCAGCCAC.
2. The kit for screening 21-trisomy syndrome based on free RNA in peripheral blood of pregnant women based on time-of-flight mass spectrometry, as claimed in claim 1, wherein the kit further comprises an SAP reaction system.
3. The kit for screening 21-trisomy syndrome based on time-of-flight mass spectrometry for detecting free RNA in peripheral blood of pregnant women, according to claim 1, wherein the PCR reaction system comprises the PCR reaction primers, PCR water, PCR Buffer, mgCl2 solution, dNTP Mix solution, PCR hot start enzyme and cDNA template.
4. The kit for screening 21-trisomy syndrome based on free RNA in pregnant woman peripheral blood based on time-of-flight mass spectrometry as claimed in claim 3, wherein the PCR reaction system is used for providing a PCR reaction for amplifying heterozygous SNP sites: a DNA fragment in which the sites 1-13 are located.
5. The kit for screening 21-trisomy syndrome based on time-of-flight mass spectrometry for detecting free RNA in peripheral blood of pregnant women, according to claim 1, wherein the single base extension reaction system comprises the probe, PCR water, base extension Buffer, dNTP Mix solution and single base extension reaction enzyme.
6. The kit for screening 21-trisomy syndrome based on free RNA in pregnant woman peripheral blood based on time-of-flight mass spectrometry as claimed in claim 5, wherein the single base extension reaction system is used for performing a single base extension reaction to extend to the SAP mutation site of high frequency heterozygosity by combining a single base extension probe with a DNA template amplified by a PCR reaction.
7. The kit for screening 21-trisomy syndrome based on time-of-flight mass spectrometry for detecting free RNA in peripheral blood of pregnant women, according to claim 2, wherein the SAP reaction system comprises PCR water, SAP Buffer and SAP enzyme.
8. The kit for screening 21-trisomy syndrome based on time-of-flight mass spectrometry for detecting free RNA in peripheral blood of pregnant women, according to claim 7, wherein the SAP reaction system is used for providing an SAP reaction to remove residual dNTPs in the system after the PCR reaction.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010193108.2A CN111500696B (en) | 2020-03-18 | 2020-03-18 | Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010193108.2A CN111500696B (en) | 2020-03-18 | 2020-03-18 | Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111500696A CN111500696A (en) | 2020-08-07 |
| CN111500696B true CN111500696B (en) | 2023-03-14 |
Family
ID=71869307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010193108.2A Active CN111500696B (en) | 2020-03-18 | 2020-03-18 | Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111500696B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458155B (en) * | 2020-11-30 | 2022-09-23 | 华南理工大学 | Polyploid detection method and system based on time-of-flight mass spectrum |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104870654A (en) * | 2012-12-19 | 2015-08-26 | 阿瑞奥萨诊断公司 | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| CN105324666A (en) * | 2013-05-16 | 2016-02-10 | 百世嘉（上海）医疗技术有限公司 | Fetal diagnostics using fetal cell capture from maternal blood |
| CN110832086A (en) * | 2018-04-02 | 2020-02-21 | 伊鲁米那股份有限公司 | Compositions and methods for making controls for sequence-based genetic testing |
-
2020
- 2020-03-18 CN CN202010193108.2A patent/CN111500696B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104870654A (en) * | 2012-12-19 | 2015-08-26 | 阿瑞奥萨诊断公司 | Noninvasive detection of fetal aneuploidy in egg donor pregnancies |
| CN105324666A (en) * | 2013-05-16 | 2016-02-10 | 百世嘉（上海）医疗技术有限公司 | Fetal diagnostics using fetal cell capture from maternal blood |
| CN110832086A (en) * | 2018-04-02 | 2020-02-21 | 伊鲁米那股份有限公司 | Compositions and methods for making controls for sequence-based genetic testing |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111500696A (en) | 2020-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6369857B2 (en) | Method for obtaining information on hepatocellular carcinoma, and marker and kit for obtaining information on hepatocellular carcinoma | |
| CN105695567B (en) | A kind of kit for detecting foetal chromosome aneuploidy, primer and probe sequence and detection method | |
| US20150361502A1 (en) | Method for screening cancer | |
| JP2004528027A (en) | Diagnostic test | |
| Picchiassi et al. | The best approach for early prediction of fetal gender by using free fetal DNA from maternal plasma | |
| CN109694907B (en) | Noninvasive prenatal screening trisomy syndrome kit and application thereof | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN111321227A (en) | Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene | |
| CN111500696B (en) | Kit for screening 21-trisomy syndrome by detecting free RNA in peripheral blood of pregnant woman based on flight time mass spectrum | |
| CN110964799A (en) | Kit for detecting genotyping of human platelet surface antigens HPA and HLA-AB | |
| CN107475378B (en) | PATL2 gene for detecting female primary infertility and kit for detecting gene mutation | |
| CN110993025B (en) | Method and device for quantifying fetal concentration and method and device for genotyping fetus | |
| CN109439704B (en) | Method and kit for detecting leukemia related gene variation | |
| CN110923306A (en) | Primer, probe, kit and method for noninvasive prenatal detection of fetal 21-trisomy syndrome based on digital PCR (polymerase chain reaction) | |
| CN107841552B (en) | Primer combination, MLPA probe, gene chip and kit for detecting microdeletion or/and microduplication of congenital heart disease | |
| CN111235261A (en) | Kit for detecting human platelet-specific antigen HPA 1-29 genotyping | |
| CN116287197A (en) | SNP molecular marker for detecting cfDNA of donor of pregnant organ transplant patient, detection method and device | |
| CN115216539A (en) | Maternal cell pollution detection kit and application thereof | |
| CN109504754A (en) | A method of detection folic acid metabolism ability | |
| CN112899358A (en) | Noninvasive prenatal fetal chromosome aneuploidy detection method and kit thereof | |
| CN110857451B (en) | Primer combination, MLPA probe, gene chip and kit for detecting microdeletion or/and microduplication of recurrent abortion | |
| CN110951857B (en) | Method and kit for noninvasively detecting fetal trisomy 21, 18 and 13 syndrome based on digital PCR (polymerase chain reaction) | |
| CN111334568A (en) | Multiple connection probe amplification probe combination and kit for screening congenital heart disease gene copy number variation and susceptible persons | |
| CN109182514B (en) | Lung cancer diagnosis or metastasis diagnosis marker LncRNA Loc729658 and kit and application thereof | |
| CN110616261A (en) | Kit and method for detecting EGFR gene T790M mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |