CN111321227A - Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene - Google Patents
Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene Download PDFInfo
- Publication number
- CN111321227A CN111321227A CN202010156440.1A CN202010156440A CN111321227A CN 111321227 A CN111321227 A CN 111321227A CN 202010156440 A CN202010156440 A CN 202010156440A CN 111321227 A CN111321227 A CN 111321227A
- Authority
- CN
- China
- Prior art keywords
- gene
- mef2d
- znf384
- fusion gene
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a multiple fluorescence RT-PCR detection method of leukemia MEF2D gene and ZNF384 gene, the kit is used for specifically detecting MEF2D-BCL9 fusion gene or CREBP-ZNF 384 fusion gene, the detection method specifically comprises the following steps: s1, fluorescent PCR detection, S2, data collection processing and analysis, and S3, fusion gene detection result analysis, and relates to the technical field of biology. The multiple fluorescence RT-PCR detection method for the leukemia MEF2D gene and ZNF384 gene has high sensitivity: at least 5copies/ul of MEF2D fusion gene or ZNF384 fusion gene can be detected, and the specificity is high: the primers and the Taqman probes with high specificity are used, so that the fusion gene can be accurately detected, the false positive is low, and the whole process is monitored: simultaneously detecting reference genes, positive control and negative control, ensuring low false negative and false positive, low cost and high efficiency: the fusion gene is detected by using the fluorescent PCR with lower cost, and the multiple detections ensure the expansion of the flux of the fusion gene.
Description
Technical Field
The invention relates to leukemia fusion gene detection in the field of biotechnology, in particular to a multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene, and especially provides a multiplex fluorescence RT-PCR detection method and a detection kit for MEF2D and ZNF384 different fracture site fusion genes for Ph negative acute lymphoblastic leukemia (Ph- -ALL) patients.
Background
Leukemia is a disease of malignant clonal proliferation of myeloid hematopoietic stem cells, especially in children and young adults. The recurrent fusion gene with definite pathological significance in leukemia is the main variation causing the generation and the development of leukemia and is accompanied with the stable existence of leukemia cells. More than one hundred fusion genes are mentioned in WHO 2016 type blood tumor classification standard, and more than one hundred gene mutations are also mentioned. The identification of the fusion gene provides important molecular indexes for the diagnosis and typing of blood tumors, the selection of clinical treatment schemes, the monitoring of curative effects and the development of targeted drugs.
Acute B-lymphocytic leukemia (B-ALL) is the most common malignancy in children, where a large number of chromosomal rearrangements are abnormal, leading to the formation of multiple fusion genes. The four major fusion gene types (TEL-AML1, E2A-PBX1, BCR-ABL, MLL-AF4) in child B-ALL often occur in early stages of leukemia, and cause leukemia by interfering with normal hematopoietic function, kinase signaling pathways, etc. Therefore, the fusion gene has been widely applied to clinical risk stratification of B-ALL, for example, TEL-AML1 positive patients and E2A-PBX1 positive patients have better prognosis, the clinical risk stratification is classified as low risk, and BCR-ABL1 positive patients and MLL-AF4 positive patients are classified as high risk. In addition to common fusion genes, more and more researches report that fusion genes formed by rearrangement and translocation of MEF2D and ZNF384 exist in B-ALL and have important clinical significance.
The MEF2D gene is located in chromosome 1, belongs to MEF2 transcription factor family members, has a structural domain for binding and enhancing a transcription regulatory factor MCM1, and has a main function of regulating the differentiation of cells. Chromosomal rearrangements in acute leukemia can lead to abnormally high expression of MEF2D gene, which can promote the formation and development of leukemia. MEF2D gene rearrangement occurs more frequently in B-ALL, accounting for 4.1% and 6.5% in children and adolescent patients, respectively. While the incidence in young adults and adults is relatively low, 2.7% and 1.8%, respectively. The MEF2D gene rearrangement involved partner genes include BCL9, SS18, DAZAP1, HNRNPUL1, CSF1R and FOXJ2, most commonly MEF2D-BCL9 fusion genes, and the patients are negative to CD10 and positive to CD 38.
ZNF384 gene is located in chromosome 12, encodes zinc finger protein 384 transcription factor, and can bind and regulate promoters of extracellular matrix genes MMP1, MMP3, MMP7 and COL1A 1. ZNF384 rearrangements are common in B-ALL patients with expression of a chaperone antigen, accounting for 3% -4% and 7% in children and adult B-ALL patients, respectively. The partner genes frequently involved in ZNF384 gene rearrangement include TCF3, TAF15, CREBP, EP300, ARID1B, EWSR1, BMP2K, SYNRG, SMARCA2 and the like. ZNF384 gene rearrangements are most common in asian countries, occurring at about 4% of asian population. The study reports that ZNF384 and MEF2D gene rearrangement patients have poor prognosis and MEF2D has very poor prognosis.
Current methods for detecting fusion genes include karyotyping, Fluorescence In Situ Hybridization (FISH), real-time fluorescence PCR (RQ-PCR), and Next Generation Sequencing (NGS). Compared with chromosome karyotype analysis and fluorescence in situ hybridization, the sensitivity of real-time fluorescence PCR detection reaches 10-5-10-6The fusion gene can be detected more rapidly and accurately, which is also a practical method for detecting the fusion gene recommended in NCCN guidelines, ELN guidelines and expert consensus. The sensitivity of the second generation sequencing technology can reach 10-5-10-6However, the high cost and long detection period limit the application of the method in the detection of fusion genes. The multiplex fluorescence RT-PCR can amplify a plurality of target genes simultaneously, has the advantages of saving time, reducing cost and improving efficiency, in particularThe method is suitable for the items with less sample amount and more detection targets. Therefore, the multiplex fluorescence RT-PCR method has greater application value in the screening aspect of leukemia fusion genes.
In 2003, 10 fusion gene isomers commonly seen in Leukemia were detected by a European Against Cancer Program (EAC Program) in 25 laboratories, and a standardized MRD method and related fluorescent PCR primers and probes (Leukemia, 2003, 17, 2318-. The fusion gene formed by rearrangement and translocation of MEF2D and ZNF384 in B-ALL is mainly reported in the literature and mainly detected by a secondary sequencing method. An approved quantitative detection kit for detecting leukemia related fusion genes (BCR-ABL1, PML-RARA and AML1-ETO) by an RT-qPCR method exists in China, but a fusion gene kit for detecting MEF2D and ZNF384 rearrangement by a multiplex fluorescence RT-PCR method is rarely seen.
Based on multiple fluorescent RT-PCR, the invention provides a screening and detecting method for fusion genes of different fracture sites of MEF2D genes and ZNF384 genes in leukemia, wherein the method comprises 6 classes of fusion genes of 12 MEF2D (MEF2D-BCL9, MEF2D-SS18, MEF2D-DAZAP1, MEF 2D-HNPURNL 1, MEF2D-CSF1R, MEF2D-FOXJ2) and 9 classes of fusion genes of 22 ZNF384 (TCF3-ZNF384, TAF15-ZNF384, CREP 300-ZNF384, ARID1B-ZNF384, EWSR1-ZNF384, BMP2K-ZNF384, SYN-ZNF 384, SMCA 2-ZNF 384). The invention prepares the mixture of the specific primers and the specific Taqman probes for detecting the fusion gene into 11 tubes, each tube is provided with a plurality of pairs of primers and 2 probes, FAM and HEX are used for marking the fluorescent probes, each tube can detect fusion gene isomers with different numbers, and the type of the fusion gene is judged according to the fluorescent signals. The detection method is suitable for screening fusion genes formed by rearrangement and translocation of MEF2D and ZNF384 in acute lymphocytic leukemia, and the detection method is Ph-The diagnosis, the typing, the selection of clinical treatment schemes and the monitoring of curative effects of the B-ALL provide important clinical significance.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides a multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene, the invention screens the fusion genes of MEF2D gene and ZNF384 gene with high accuracy, high specificity and high detection rate by using multiplex fluorescence RT-PCR technology, and provides guidance for prognosis and targeted therapy of B-ALL patients.
(II) technical scheme
In order to achieve the purpose, the invention is realized by the following technical scheme: the multiplex fluorescence RT-PCR detection method of leukemia MEF2D gene and ZNF384 gene is characterized in that: the kit is used for specifically detecting MEF2D-BCL9 fusion genes or CREBBP-ZNF384 fusion genes, and the detection method specifically comprises the following steps:
s1, fluorescent PCR detection: 10ul of fluorescent PCR reaction solution, 5ul of plasmid template, 2ul of primer probe mixture and 3ul of nucleic-Free Water were sequentially added to 20ul of fluorescent PCR system, and the program was run on a Roche Z480 fluorescent PCR instrument: UNG reaction at 50 ℃ and 2min, reaction at 95 ℃ for 10min, reaction at 95 ℃ for 15sec and 60 ℃ for 30sec for 45 cycles, wherein the fluorescence FAM and HEX signals can be automatically collected by an instrument in the whole amplification process;
s2, data collection processing and analysis: after the fluorescent PCR amplification is finished, the amplification result of the reference gene GAPDH in R8 is analyzed first, if it is CTThe value is less than 30, which shows that the quality of the sample meets the requirement of the experiment and the whole detection process is true and effective, if the C is less than the CTIf the value is more than 35, re-detection is needed to verify the quality of the sample;
s3, analyzing the detection result of the fusion gene: MEF2D-BCL9Variant 1 fusion gene or CREBP-ZNF 384 fusion gene is specifically detected by the kit and analyzed.
Preferably, when the MEF2D-BCL9Variant 1 fusion gene is specifically detected by the kit in step S3, wherein the CT value of the internal reference GAPDH gene of the positive control is 24.35, the CT value of the MEF2D-BCL9Variant 1 fusion gene is 22.65, and the negative control has no amplified fluorescent signal of the internal reference GAPDH gene and the MEF2D-BCL9Variant 1 fusion gene, the determination criterion of negative and positive of the kit fusion gene is satisfied, which indicates that the fluorescent PCR detection of the MEF2D-BCL9 fusion gene can be specifically performed by using the kit.
Preferably, when the CREBBP-ZNF384 fusion gene is specifically detected by the kit in step S3, wherein the CT value of the internal reference GAPDH gene of the positive quality control is 28.55, the CT value of the CREBBP-ZNF384Variant 2 fusion gene is 32.34, and the negative control has no amplified fluorescent signals of the internal reference GAPDH gene and the CREBBP-ZNF384Variant 2 fusion gene, and meets the judgment criteria of negative and positive of the fusion gene in the kit, indicating that the fluorescent PCR detection of the CREBBP-ZNF384Variant 2 fusion gene can be specifically performed by using the kit.
Preferably, the gene transcripts involved in the primer probe for designing MEF2D fusion gene are respectively: MEF2D (NM _005920), BCL9(NM _004326), SS18(NM _005637), DAZAP1(NM _018959), HNRNPUL1(NM _007040), CSF1R (NM _005211), and FOXJ2(NM _ 018416).
Preferably, gene transcripts involved in ZNF384 fusion gene design primer probes are respectively as follows: ZNF384(NM _133476), TCF3(NM _003200), TAF15(NM _003487), CREBP (NM _004380), EP300(NM _001429), ARID1B (NM _017519), EWSR1(NM _013986), BMP2K (NM _198892), SYNRG (NM _007247) and SMARCA2(NM _ 003070).
Preferably, the components of the detection kit comprise: specific primers for detection, Taqman probes, a cDNA first strand synthesis reagent, a fluorescent PCR reaction solution, a negative control, a positive control and deionized water.
Preferably, the first strand cDNA synthesis is performed by using a commercial Promega reverse transcription kit, and the reagent components comprise 5 × Reaction Buffer, PCR Nucleotide Mix, Random Prime, and 25mM MgCl2RNARibonuclease Inhibitor, GoScript Reverse Transcriptase, and Nuclear-Free Water.
Preferably, the reaction system of the kit for performing fluorescence PCR amplification is 20ul, and the system components comprise: 10ul of fluorescent PCR reaction solution, 5ul of diluted cDNA template, 2ul of primer-probe mixture, and 3ul of nucleic-FreeWater.
Preferably, the kit provides a complete system for performing a simple, sensitive and contamination-free fluorescent PCR assay, the fluorescent reaction solution comprising a solution mixture of optimized buffer, dNTPs, Hot Start Taq DNA polymerase, UNG enzyme and MgCl2, and especially the UNG enzyme prevents contamination of the PCR process.
Preferably, the concentration of all the specific primer working solutions is 2umol/ml, the concentration of the working solution of the Taqman probe is 3umol/ml, 2ul of the primer working solution and the probe working solution are added respectively, and finally the total amount of the primers/the total amount of the probes in the reaction system is ensured to be 2: 3.
The invention carries out comparison analysis and reference of related literature data on the basis of MEF2D gene, ZNF384 gene and related partner gene sequences known in Genbank, selects upstream sequences and downstream sequences of the fusion gene fracture sites to design specific multiplex primers and Taqman probes, the Tm value of the designed primers is 55-65 ℃, the GC content is 40-60%, the primers are reasonably distributed into 11 tubes after optimization test, and primer dimer is avoided as much as possible. The Tm value of the probe is 65-70 ℃, and is usually 5-10 ℃ higher than that of the primer, so that the probe is prevented from generating non-specific sequence combination and forming DNA folding and secondary structure per se.
Based on the design principle, the specific multiplex primers and Taqman probes for detecting 12 MEF2D fusion gene isomers and 22 ZNF384 fusion gene isomers are shown as follows:
based on the primer probe nucleotide sequence designed above, the reference gene used in the present invention is GAPDH stably expressed. The sequences of the primers and probes used for amplifying the GAPDH gene are respectively as follows: GAPDH-F (CCAGGTGGTCTCCTCTGACTTC), GAPDH-R (GTGGTCGTTGAGGGGCAATG) and a probe GAPDH-P (HEX-ACAGCGACACCCACTCCTCCACCTT-BHQ1), wherein the 5 'end of a Taqman probe of an internal reference gene GAPDH is connected with a fluorescent reporter group HEX, the 3' end of the Taqman probe of the internal reference gene GAPDH is connected with a BHQ1 reporter group, and a false negative result caused by the poor sample quality is eliminated by detecting the internal reference gene GAPDH.
The specific primer sequence used in the invention is purified in a PAGE form, and the Taqman probe is purified in an HPLC form. The 5 'end of the Taqman hydrolysis probe marked by the FAM is connected with a fluorescent reporter group 6-FAM, and the 3' end of the Taqman hydrolysis probe is connected with a BHQ1 reporter group; the 5 'end of the Taqman hydrolysis probe marked by the HEX is connected with a fluorescent reporter group HEX, and the 3' end of the Taqman hydrolysis probe is connected with a BHQ1 reporter group.
The invention utilizes a Promega Reverse transcription kit to carry out cDNA first strand synthesis, wherein 1-5 ug of total RNA is required for Reverse transcription, the detection technical process of the kit comprises the steps of taking 1.5ul of random primer mixed liquor of 50ug/ml and 15ul of RNA product, carrying out reaction at 70 ℃ for 5min to open the secondary structure of the RNA, placing at least 2min on ice after the reaction is finished, adding 6ul of 5 × ReactionBuffer, 3.8ul of 25mM MgCl2, 1.5ul of PCR Nucleotide Mix, 0.3ul of RNA Ribonucleic inhibitor, 1ul of GoScript Reverse Transcriptase, 0.9ul of nucleic acid-Free Water to a final volume of 30 ul., carrying out Reverse transcription at 25 ℃ for 5min, 42 ℃ for 60min, carrying out MEF2D fusion gene and ZNF384 fusion gene detection after the cDNA obtained by Reverse transcription is diluted at 70 ℃ for 15 min.
When the kit of the invention is used for fluorescence PCR detection, a positive control (fusion gene positive plasmid) and a negative control (nucleic-Free Water) are simultaneously carried out.
The detection of the invention is carried out on a Roche Z480 fluorescence PCR instrument by running a program which comprises the following steps: UNG reaction at 50 deg.C for 2min, and then at 95 deg.C for 10 min; then, 45 cycles of 95 ℃ for 15sec and 60 ℃ for 30sec were performed.
The kit adopts multiple fluorescent RT-PCR to detect MEF2D fusion genes and ZNF384 fusion genes generated at different fracture sites in leukemia, only when the reference gene GAPDH has a HEX normal fluorescent amplification signal, and the fluorescent signal of FAM or HEX can be detected in 1 tube, and when the negative control has no fluorescent signal, the result of a sample to be detected is effective and positive.
(III) advantageous effects
The invention provides a multiplex fluorescence RT-PCR detection method of leukemia MEF2D gene and ZNF384 gene. The method has the following beneficial effects:
(1) the multiple fluorescence RT-PCR detection method of the leukemia MEF2D gene and the ZNF384 gene has high sensitivity: at the lowest, 5copies/ul of MEF2D fusion gene or ZNF384 fusion gene could be detected.
(2) The multiple fluorescence RT-PCR detection method of the leukemia MEF2D gene and the ZNF384 gene has high opposite sex: the high specificity primer and the Taqman probe are used, so that the fusion gene can be accurately detected, and the false positive is low.
(3) The multiple fluorescence RT-PCR detection method of the leukemia MEF2D gene and ZNF384 gene comprises the following steps of: and simultaneously detecting an internal reference gene, a positive control and a negative control, and ensuring low false negative and false positive.
(4) The multiple fluorescence RT-PCR detection method of the leukemia MEF2D gene and the ZNF384 gene has low cost and high efficiency: the fusion gene is detected by using the fluorescent PCR with lower cost, and the multiple detections ensure the expansion of the flux of the fusion gene.
Drawings
FIG. 1 is a schematic diagram showing the structure of different cleavage sites and fusion gene isomers of a representative fusion gene (MEF2D-BCL9, MEF2D-DAZAP1, MEF2D-HNRNPUL1) of the present invention;
FIG. 2 is a schematic diagram showing the structure of different break sites and fusion gene isomers of representative fusion genes (TAF15-ZNF384, CREBP-ZNF 384) of the present invention;
FIG. 3 is a graph showing the fluorescence amplification curve of MEF2D-BCL9 detected by the detection kit of the present invention in one embodiment;
FIG. 4 is a graph of fluorescence amplification curves for detecting CREBP-ZNF 384 using the detection kit of the invention in example two.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1-4, the embodiment of the present invention provides three technical solutions: the multiplex fluorescence RT-PCR detection method of leukemia MEF2D gene and ZNF384 gene specifically comprises the following embodiments:
example 1
The kit provided by the invention is used for specifically detecting MEF2D-BCL9 fusion gene.
In this example, the feasibility and specificity of the detection method were verified by determining the positive quality control containing MEF2D-BCL9 fusion gene (the positive plasmid containing MEF2D-BCL9Variant 1). The specific detection method of this embodiment is as follows:
s1, fluorescent PCR detection: 10ul of the fluorescent PCR reaction solution, 5ul of the plasmid template, 2ul of the primer-probe mixture, and 3ul of nucleic-Free Water were sequentially added to 20ul of the fluorescent PCR system. The program was run on a Roche Z480 fluorescent PCR instrument: UNG reaction at 50 deg.C for 2min, and then at 95 deg.C for 10 min; then, 45 cycles of 95 ℃ for 15sec and 60 ℃ for 30sec were performed. The instrument can automatically collect fluorescence FAM and HEX signals in the whole amplification process;
s2, data collection processing and analysis: after the fluorescent PCR amplification is finished, firstly analyzing the amplification result of the reference gene GAPDH in R8, and if the CT value is less than 30, the quality of the sample is proved to meet the experimental requirements, and the whole detection process is real and effective; if the CT value is more than 35, retesting is needed to verify the quality of the sample;
s3, analyzing the detection result of the fusion gene: the result of the fluorescence amplification curve of the kit for specifically detecting the MEF2D-BCL9Variant 1 fusion gene is shown in the attached figure 3, wherein the CT value of the internal reference GAPDH gene of a positive quality control product is 24.35, the CT value of the MEF2D-BCL9Variant 1 fusion gene is 22.65, and the negative control has no amplification fluorescence signals of the internal reference GAPDH gene and the MEF2D-BCL9Variant 1 fusion gene, so that the judgment standard of the negative and positive of the fusion gene of the kit is met, and the kit is used for specifically detecting the fluorescence PCR of the MEF2D-BCL9 fusion gene.
Example 2
The kit provided by the invention is used for specifically detecting the CREBP-ZNF 384 fusion gene.
In this example, the feasibility and specificity of the detection method were verified by determining the positive quality control containing CREBBP-ZNF384 fusion gene (the positive plasmid containing CREBP-ZNF 384Variant 2). The specific detection method of this embodiment is as follows:
s1, fluorescent PCR detection: 10ul of fluorescent PCR reaction solution, 5ul of plasmid template, 2ul of primer probe mixture and 3ul of nucleic-Free Water were sequentially added to 20ul of fluorescent PCR system, and the program was run on a Roche Z480 fluorescent PCR instrument: UNG reaction at 50 deg.C for 2min, and then at 95 deg.C for 10 min; then, 45 cycles of 95 ℃ for 15sec and 60 ℃ for 30sec were performed. The instrument can automatically collect fluorescence FAM and HEX signals in the whole amplification process;
s2, data collection processing and analysis: after the fluorescent PCR amplification is finished, firstly analyzing the amplification result of the reference gene GAPDH in R8, and if the CT value is less than 30, the quality of the sample is proved to meet the experimental requirements, and the whole detection process is real and effective; if the CT value is more than 35, retesting is needed to verify the quality of the sample;
s3, analyzing the detection result of the fusion gene: the result of the fluorescence amplification curve of the kit for specifically detecting the CREBP-ZNF 384 fusion gene is shown in the attached figure 4, wherein the CT value of the internal reference GAPDH gene of the positive quality control product is 28.55, the CT value of the CREBP-ZNF 384Variant 2 fusion gene is 32.34, and the negative control has no amplification fluorescence signals of the internal reference GAPDH gene and the CREBP-ZNF 384Variant 2 fusion gene, thereby meeting the judgment standard of the negative and positive of the fusion gene of the kit and indicating that the kit can be used for specifically carrying out the fluorescence PCR detection of the CREBP-ZNF 384Variant 2 fusion gene.
Example 3
The kit provided by the invention is used for detecting clinical B-ALL samples.
In this example, 20 clinical samples of peripheral blood or bone marrow blood from B-ALL patients were collected and subjected to fluorescent PCR detection of MEF2D and ZNF384 fusion genes using the detection kit.
The kit method is used for detecting the B-ALL clinical sample, and comprises the operation steps of extraction of leucocyte RNA in a blood sample, reverse transcription of RNA into cDNA and multiplex fluorescence RT-PCR detection. The specific operation method is as follows:
s1, blood sample RNA extraction: it is proposed to use the Trans RNA Pure Blood Kit, following the Kit instructions for the extraction of total RNA from Blood samples;
s2, reverse transcription of RNA into cDNA: promega GoScript is proposedTMA Reverse Transcriptase kit is prepared by taking 1.5ul of 50ug/ml random primer mixed solution and 15ul of RNA, reacting for 5min at 70 ℃ to promote the opening of an RNA secondary structure, placing on ice for at least 2min after the Reaction is finished, adding 6ul of 5 × Reaction Buffer, 3.8ul of 25mM MgCl2, 1.5ul of PCR Nucleotide Mix, 0.3ul of RNA ribosomal primer Inhibitor, 1ul of GoScript Transcriptase, 0.9ul of Nucleotide-Free Water to a final volume of 30 ul., carrying out Reverse transcription at 25 ℃ for 5min, 42 ℃ for 60min, carrying out Reverse transcription at 70 ℃ for 15min, diluting the obtained cDNA, and screening and detecting MEF2D fusion genes and ZNF384 fusion genes;
s3, fluorescent PCR detection: 10ul of the fluorescent PCR reaction solution, 5ul of the plasmid template, 2ul of the primer-probe mixture, and 3ul of nucleic-Free Water were sequentially added to 20ul of the fluorescent PCR system. The program was run on a Roche Z480 fluorescent PCR instrument: UNG reaction at 50 deg.C for 2min, and then at 95 deg.C for 10 min; then, 45 cycles of 95 ℃ for 15sec and 60 ℃ for 30sec were performed. The instrument can automatically collect fluorescence FAM and HEX signals in the whole amplification process;
s4, data collection processing and analysis: after the fluorescent PCR amplification is finished, firstly analyzing the amplification result of the reference gene GAPDH in R8, and if the CT value is less than 30, the quality of the sample is proved to meet the experimental requirements, and the whole detection process is real and effective; if the CT value is more than 35, retesting is needed to verify the quality of the sample;
s5, analyzing the detection result of the fusion gene: 20 clinical samples of B-ALL were tested by the MEF2D fusion gene and ZNF384 fusion gene of the kit under the condition that the internal reference gene GAPDH, the negative control and the positive control are normal, wherein MEF2D-BCL9 fusion gene is tested in 2 samples, EP300-ZNF384 fusion gene is tested in 1 sample, CREBP-ZNF 384 fusion gene is tested in 1 sample, and the other 16 samples are negative, and the results are shown in Table 1 and Table 2.
TABLE 1 CT value test results for MEF 2D-related fusion gene and reference gene in B-ALL patient samples
TABLE 2 CT value test results of ZNF384 related fusion gene and reference gene in B-ALL patient samples
The results show that the kit can detect the fusion genes of different fracture sites of MEF2D gene and ZNF384 gene in B-ALL patients with high sensitivity, high specificity, high efficiency and low cost, provides guidance for diagnosis and typing, selection of clinical treatment schemes, curative effect monitoring and targeted treatment of the B-ALL patients, and has wide clinical application value.
It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (10)
1. The multiplex fluorescence RT-PCR detection method of leukemia MEF2D gene and ZNF384 gene is characterized in that: the kit is used for specifically detecting MEF2D-BCL9 fusion genes or CREBBP-ZNF384 fusion genes, and the detection method specifically comprises the following steps:
s1, fluorescent PCR detection: 10ul of fluorescent PCR reaction solution, 5ul of plasmid template, 2ul of primer probe mixture and 3ul of nucleic-Free Water were sequentially added to 20ul of fluorescent PCR system, and the program was run on a Roche Z480 fluorescent PCR instrument: UNG reaction at 50 ℃ and 2min, reaction at 95 ℃ for 10min, reaction at 95 ℃ for 15sec and 60 ℃ for 30sec for 45 cycles, wherein the fluorescence FAM and HEX signals can be automatically collected by an instrument in the whole amplification process;
s2, data collection processing and analysis: after the fluorescent PCR amplification is finished, the amplification result of the reference gene GAPDH in R8 is analyzed first, if it is CTThe value is less than 30, which shows that the quality of the sample meets the requirement of the experiment and the whole detection process is true and effective, if the C is less than the CTIf the value is more than 35, re-detection is needed to verify the quality of the sample;
s3, analyzing the detection result of the fusion gene: MEF2D-BCL9Variant 1 fusion gene or CREBP-ZNF 384 fusion gene is specifically detected by the kit and analyzed.
2. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: when the MEF2D-BCL9Variant 1 fusion gene is specifically detected by the kit in the step S3, the CT value of the internal reference GAPDH gene of the positive quality control is 24.35, the CT value of the MEF2D-BCL9Variant 1 fusion gene is 22.65, and the negative control has no amplified fluorescent signals of the internal reference GAPDH gene and the MEF2D-BCL9Variant 1 fusion gene, so that the judgment standard of negative and positive of the kit fusion gene is met, and the fluorescent PCR detection of the MEF2D-BCL9 fusion gene can be specifically performed by using the kit.
3. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: in the step S3, when the CREBBP-ZNF384 fusion gene is specifically detected by the kit, the CT value of the internal reference GAPDH gene of the positive quality control is 28.55, the CT value of the CREBBP-ZNF384Variant 2 fusion gene is 32.34, and the negative control has no amplified fluorescent signal of the internal reference GAPDH gene and the CREBBP-ZNF384Variant 2 fusion gene, so that the judgment standard of the negative and positive of the fusion gene in the kit is met, which indicates that the kit can be used to specifically perform the fluorescent PCR detection of the CREBBP-ZNF384Variant 2 fusion gene.
4. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the gene transcripts involved in the MEF2D fusion gene design primer probe are respectively: MEF2D (NM _005920), BCL9(NM _004326), SS18(NM _005637), DAZAP1(NM _018959), HNRNPUL1(NM _007040), CSF1R (NM _005211), and FOXJ2(NM _ 018416).
5. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the gene transcripts related to the ZNF384 fusion gene design primer probe are respectively as follows: ZNF384(NM _133476), TCF3(NM _003200), TAF15(NM _003487), CREBP (NM _004380), EP300(NM _001429), ARID1B (NM _017519), EWSR1(NM _013986), BMP2K (NM _198892), SYNRG (NM _007247) and SMARCA2(NM _ 003070).
6. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the detection kit comprises the following components: specific primers for detection, Taqman probes, a cDNA first strand synthesis reagent, a fluorescent PCR reaction solution, a negative control, a positive control and deionized water.
7. The method for multiplex fluorescence RT-PCR detection of MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the first strand cDNA synthesis employs a commercial Promega reverse transcription kit, and the reagent components comprise 5 × Reaction Buffer, PCR Nucleotide Mix, Random Prime, and 25mM MgCl2RNA ribonuclear inhibitor, GoScript Reverse Transcriptase and nucleic-Free Water.
8. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the reaction system of the kit for carrying out fluorescence PCR amplification is 20ul, and the system components comprise: 10ul of fluorescent PCR reaction solution, 5ul of diluted cDNA template, 2ul of primer-probe mixture, and 3ul of nucleic-FreeWater.
9. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the fluorescent reaction solution comprises an optimized buffer solution, dNTP, Hot Start Taq DNA polymerase, UNG enzyme and MgCl2 solution mixture.
10. The multiplex fluorescence RT-PCR detection method for MEF2D and ZNF384 genes in leukemia according to claim 1, wherein the method comprises the following steps: the concentration of all the specific primer working solutions is 2umol/ml, the concentration of the working solution of the Taqman probe is 3umol/ml, 2ul of the primer working solution and the probe working solution are added respectively, and finally the total amount of the primers/the total amount of the probes in the reaction system is ensured to be 2: 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010156440.1A CN111321227A (en) | 2020-03-09 | 2020-03-09 | Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010156440.1A CN111321227A (en) | 2020-03-09 | 2020-03-09 | Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111321227A true CN111321227A (en) | 2020-06-23 |
Family
ID=71165612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010156440.1A Pending CN111321227A (en) | 2020-03-09 | 2020-03-09 | Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111321227A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112522403A (en) * | 2020-12-09 | 2021-03-19 | 济南艾迪康医学检验中心有限公司 | Primer and probe for detecting ZNF384 related fusion gene by using multiple fluorescence PCR technology and application |
| CN113684261A (en) * | 2021-09-02 | 2021-11-23 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by using fluorescent quantitative PCR |
| CN114262758A (en) * | 2022-01-10 | 2022-04-01 | 广州达安基因股份有限公司 | Kit for detecting novel coronavirus mutant strain and detection method |
| CN114480649A (en) * | 2022-01-28 | 2022-05-13 | 广州血康陆道培生物技术有限公司 | Primer group, kit and method for detecting E2A-ZNF384 fusion gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609632A (en) * | 2018-12-21 | 2019-04-12 | 北京优迅医学检验实验室有限公司 | Reagent, kit and the application of detection fusion gene |
| CN110551821A (en) * | 2019-09-29 | 2019-12-10 | 杭州艾迪康医学检验中心有限公司 | primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR (polymerase chain reaction) |
-
2020
- 2020-03-09 CN CN202010156440.1A patent/CN111321227A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609632A (en) * | 2018-12-21 | 2019-04-12 | 北京优迅医学检验实验室有限公司 | Reagent, kit and the application of detection fusion gene |
| CN110551821A (en) * | 2019-09-29 | 2019-12-10 | 杭州艾迪康医学检验中心有限公司 | primers, probe and kit for detecting MEF2D gene rearrangement by using fluorescent quantitative PCR (polymerase chain reaction) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112522403A (en) * | 2020-12-09 | 2021-03-19 | 济南艾迪康医学检验中心有限公司 | Primer and probe for detecting ZNF384 related fusion gene by using multiple fluorescence PCR technology and application |
| CN113684261A (en) * | 2021-09-02 | 2021-11-23 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by using fluorescent quantitative PCR |
| CN113684261B (en) * | 2021-09-02 | 2024-04-30 | 济南艾迪康医学检验中心有限公司 | Primer, probe and kit for detecting ZNF384 gene rearrangement by utilizing fluorescence quantitative PCR |
| CN114262758A (en) * | 2022-01-10 | 2022-04-01 | 广州达安基因股份有限公司 | Kit for detecting novel coronavirus mutant strain and detection method |
| CN114262758B (en) * | 2022-01-10 | 2024-04-05 | 广州达安基因股份有限公司 | Kit for detecting novel coronavirus mutant strain and detection method |
| CN114480649A (en) * | 2022-01-28 | 2022-05-13 | 广州血康陆道培生物技术有限公司 | Primer group, kit and method for detecting E2A-ZNF384 fusion gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200370127A1 (en) | Biomarkers in Peripheral Blood Mononuclear Cells for Diagnosing or Detecting Lung Cancers | |
| JP6369857B2 (en) | Method for obtaining information on hepatocellular carcinoma, and marker and kit for obtaining information on hepatocellular carcinoma | |
| CN111321227A (en) | Multiplex fluorescence RT-PCR detection method for leukemia MEF2D gene and ZNF384 gene | |
| US9758829B2 (en) | Molecular malignancy in melanocytic lesions | |
| JP6269492B2 (en) | Method for obtaining information on hepatocellular carcinoma, and marker and kit for obtaining information on hepatocellular carcinoma | |
| CN116761899A (en) | Colorectal cancer molecular typing and survival risk gene group, diagnostic product and application | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| CN106498028B (en) | Diagnostic method and kit for T790M mutation of EGFR | |
| KR102637032B1 (en) | Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof | |
| EP1889922A1 (en) | Methods for diagnosis of pediatric common acute lymphoblastic leukemia by determining the level of gene expression | |
| WO2007137366A1 (en) | Diagnostic and prognostic indicators of cancer | |
| CN110295232B (en) | microRNA biomarkers for colorectal cancer | |
| CN104131102B (en) | A kind of judge that NSCLC patient is to the test kit of Gefitinib therapeutic response | |
| CN109402259B (en) | Kit for detecting leukemia fusion gene and gene mutation | |
| CN109182514B (en) | Lung cancer diagnosis or metastasis diagnosis marker LncRNA Loc729658 and kit and application thereof | |
| EP2622097B1 (en) | Prognostic methods, compositions and kits for prediction of acute lymphoblastic leukemia (all) relapse | |
| JP6871271B2 (en) | Methods and compositions for classifying DLBCL | |
| CN111566229A (en) | Breast cancer molecular typing and distant metastasis risk gene group, diagnosis product and application | |
| AU2017353410B2 (en) | Early detection of preliminary stages of testicular germ cell tumors | |
| WO2007088971A1 (en) | Gene group applicable to cancer prognostication | |
| Raut et al. | Cancer‐specific risk prediction with a serum microRNA signature | |
| CN117778582A (en) | Nucleic acid combination for detecting gastric cancer, kit and application | |
| CN116622851A (en) | DNA methylation composition for detecting liver cancer, kit and application | |
| CN113943814A (en) | Primer probe composition, kit and method for early screening of liver cancer | |
| CN117867114A (en) | Primer combination, method and kit for detecting ERBB2 gene expression level |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |