CN117867114A - Primer combination, method and kit for detecting ERBB2 gene expression level - Google Patents

Abstract

The invention discloses a primer combination, a kit and a method for detecting the expression level of an ERBB2 gene, which comprise an ERBB2 gene specific primer pair and an ERBB2 gene detection probe. The invention can rapidly and accurately detect the ERBB2 gene expression quantity, and can compare with the normal level to judge the expression quantity. The method has the advantages of good specificity, high sensitivity, capability of detecting samples with the copy number lower than 10/. Mu.l, obviously reduced detection limit compared with the prior art, simplicity and convenience in operation, high degree of automation, pollution prevention, larger linear range and the like, can detect ERBB2-low BC, and provides powerful support for a novel BC treatment method.

Description

Primer combination, method and kit for detecting ERBB2 gene expression level

Technical Field

The invention belongs to the fields of life science and biotechnology, in particular to a primer combination, a method and a kit for detecting the expression level of ERBB2 in human breast cancer by adopting a probe real-time fluorescence quantitative PCR technology.

Background

Breast Cancer (BC) is the most frequently occurring Cancer among women worldwide. It is a heterogeneous disease, consisting of different biological entities, with different prognosis and carcinogenicity. Gene expression profiling studies have identified six major internal sub-populations of BC. However, treatment decisions are generally based on traditional histopathological factors, and the major 4 prognostic distinct subtypes are recognized in clinical practice, namely, luminal type A, luminal type B (ERBB 2 negative), ERBB2 positive and Triple Negative BC (TNBC). In particular, at ERBB2 positive BC (approximately 15% of all BC), ERBB2 amplification results in ERBB2 overexpression, and this subtype of cancer is more aggressive and worse prognosis if untreated. However, the development of various drugs against ERBB2 has provided significant clinical benefit in early and late patients, altering the trajectory of its natural history.

ERBB2 detection guidelines written according to the American Society of Clinical Oncology (ASCO) and the American society of pathologists (CAP) in 2018 were updated 1 when at least one tumor sample IHC assay rated "ERBB23+" or ISH assay confirmed ERBB2 overexpression or gene amplification, BC was considered ERBB2 positive. 2. In the case of IHC ERBB2 scoring 2+, an additional ISH test is required to determine ERBB2 status, while in the case of specific ISH results the IHC slices are reviewed for comprehensive evaluation. 3. In the case where IHC scores of 0 and 1+, or ihc2+ were negative at the same time as ISH test, BC was considered ERBB2 negative, ERBB2 targeted therapy was not recommended, but dual probe ISH detected ERBB2/CEP17 ratio <2.0, except for the case where the average ERBB2 copy number per cell was 4.0-5.9, at which time ihc2+ tumors would be considered ERBB2 positive. Thus, a potential new nomenclature is proposed for IHC1+ or 2+ with ISH-, namely ERBB2 low expression/ERBB 2 weak positive BC (ERBB 2-low BC). In clinical practice, these tumors are reported to be ERBB2 negative, either to be classified as TNBC phenotype or as lumineal-like if Hormone Receptor (HR) expression phenotype, and drugs that interfere with ERBB2 pathway show no clinical benefit for such patients. However, recently, it was shown in new drug studies against ERBB2 that low-level expression of ERBB2 and BC subgroups in which ERBB2 amplification was not detected might also benefit from targeting ERBB 2. The benefits of ERBB2-low BC compared to ERBB2 overexpressed tumors may be achieved by atypical pharmacological mechanisms, including targeting cytotoxic drugs into cancer cells or attracting immunocompetent cells. The clinical development of novel anti-ERBB 2 drugs against ERBB2-low BC has the potential to improve the treatment of this fraction of patients, potentially expanding these therapies to BC patients currently considered unsuitable for anti-ERBB 2 treatment.

However, the limitations of the existing IHC platform in terms of methods may affect the results. Formalin fixation may artificially reduce the detected protein expression level, whereas semi-quantitative assays such as IHC may not be sensitive enough to accurately detect low levels of ERBB2 expression. Thus, an IHC score of 0 does not necessarily represent the complete absence of ERBB2 protein on the cell membrane, but rather no protein is detectable due to the artificial limitations of this technique. To address these uncertainties, several new quantitative analysis techniques are under development to increase the sensitivity of ERBB2 assessment. Among them, QPCR is one of the methods that, if validated, can improve our ability to identify ERBB2-low BC patients.

qPCR allows a more quantitative assessment of ERBB2 mRNA expression levels in BC samples and has been suggested to serve as a potential supplement or replacement for IHC/ISH, especially in tumors where standard IHC and ISH detection cannot be clearly identified as positive/negative. The main advantage of qPCR is that it can provide a more standardized, objective and automated assessment, as well as an increasing ability to detect in small samples (e.g. hollow needle biopsy samples). While current research, RT-qPCR appears to be somewhat contradictory to the results of the proposed technique. However, in the context of ERBB2-low BC, RT-qPCR detection is a potential complement to the semi-quantitative data obtained by IHC. The final clinical utility of this work will need to be assessed in prospective and retrospective clinical trials.

Because the current ERBB2 detection methods (i.e., IHC and ISH) are insufficient to identify tumors that have low ERBB2 expression or low levels of pathway activation, these tumors may benefit from some of the new therapies. There is a need to develop a method to detect potential ERBB2-low BC to support new BC treatment methods.

Disclosure of Invention

In view of the defect of detecting the expression of ERBB2 gene (also called HER2 gene) in the prior art, the invention designs a primer and a probe sequence for detecting an internal reference/target gene, and uses a fluorescent quantitative PCR technology to detect the expression of ERBB2 gene. By adjusting the concentration and proportion of primer probes of the two genes and optimizing the reaction system and reaction conditions of PCR, a primer combination, a method and a kit for detecting the expression level of ERBB2 genes are developed.

The technical scheme adopted by the invention is as follows:

the primer combination for detecting the expression level of the ERBB2 gene comprises an ERBB2 gene specific primer pair and an ERBB2 gene detection probe, wherein the sequences of an upstream primer ERBB2-F and a downstream primer ERBB2-R of the ERBB2 gene specific primer pair are as follows: ERBB2-F CGGTGTGAGAAGTGCAGCAA

ERBB2-R:CCTCTCGCAAGTGCTCCAT；

The sequence of ERBB2 gene detection Probe ERBB2-Probe is:

ERBB2-Probe:FAM-CCAGACCATAGCACACTCGGGCAC-BHQ1。

wherein FAM is a fluorescent reporter group and BHQ1 is a fluorescence quenching group.

Further, the primer combination for detecting the expression level of ERBB2 gene also comprises a specific primer pair of an internal reference gene GAPDH and an internal reference gene GAPDH detection probe, wherein the sequences of the specific primer pair of the internal reference gene GAPDH, namely an upstream primer GAPDH-F and a downstream primer GAPDH-R are as follows:

GAPDH-F:CCTGCACCACCAACTGCTTAG

GAPDH-R:CAGTCTTCTGGGTGGCAGTGA

the sequence of the reference gene GAPDH detection Probe GAPDH-Probe is as follows:

GAPDH-Probe:HEX-CATCCATGACAACTTTGGTATCGTG–BHQ1。

wherein HEX is a fluorescent reporter group and BHQ1 is a fluorescence quenching group.

The invention also provides a kit for detecting the expression level of the ERBB2 gene, which comprises the primer combination for detecting the expression level of the ERBB2 gene.

Further, the kit comprises a detection system PCR reaction liquid, wherein the detection system PCR reaction liquid comprises an upstream primer ERBB2-F of an ERBB2 gene specific primer pair, a downstream primer ERBB2-R, ERBB gene detection Probe ERBB2-Probe, a specific primer pair of an internal reference gene GAPDH, an upstream primer GAPDH-F, a downstream primer GAPDH-R and an internal reference gene GAPDH detection Probe GAPDH-Probe.

Different fluorescence is marked at the 5' end of the probes of the target gene ERBB2 and the reference gene GAPDH, wherein FAM is marked on the Probe ERBB2-Probe of the target gene ERBB2, HEX is marked on the Probe of the reference gene GAPDH, and the primers and probes of the target gene ERBB2 and the reference gene GAPDH can be mixed to react in a tube due to different fluorescence signals marked on the probes.

Further, in the PCR reaction liquid of the detection system, the concentration of ERBB2-F, ERBB2-R, GAPDH-F, GAPDH-R is 0.5-6 mu M, and the concentration of ERBB2-Probe and GAPDH-Probe is 0.2-3 mu M.

Furthermore, in the PCR reaction liquid of the detection system, the preferable molar ratio of ERBB2-F, ERBB2-R, ERBB2-Probe is 2:2:1; preferably, the molar ratio of GAPDH-F, GAPDH-R, GAPDH-Probe is 2:2:1.

The PCR reaction liquid of the detection system also comprises a PCR buffer solution, dNTPs and Mg ²⁺ The reaction materials necessary for PCR amplification reaction such as DNA polymerase.

In a preferred embodiment, the components of the detection system PCR reaction solution are 25. Mu.L of the reaction system: 2. Mu.L of cDNA to be detected, 23. Mu.L of reaction solution comprising THUNDERBIRD Probe qPCR Mix (2X), wherein the reaction solution comprises 0.8uM of each of the upstream and downstream primers of ERBB2 and 0.4uM of ERBB 2-probe; the GAPDH upstream and downstream primers were each 0.8uM and GAPDH-probe was 0.4uM.

The kit also comprises a positive control and a negative control, wherein the positive control is a solution containing an ERBB2 genome; the negative control is a solution without ERBB2 genome.

Further, the kit further comprises an RNA extraction reagent and a reverse transcription reagent.

The RNA extraction reagent is used for extracting RNA of a sample, and can be an RNA extraction reagent of a conventional technology or a commercial RNA extraction kit, such as QIAGEN RNeasy FFPE Kit paraffin RNA extraction kit.

The reverse transcription reagent is used for reverse transcription of the extracted sample RNA into cDNA, and commercial reverse transcription kits can be used.

The invention also provides application of the kit based on detecting the ERBB2 gene expression level in quantitative detection of the ERBB2 gene expression level.

Further, the invention provides a method for detecting the expression level of ERBB2 genes for in-vitro non-diagnosis purposes, which adopts the kit based on detecting the expression level of ERBB2 genes and comprises the following steps:

(1) Extracting RNA in a sample;

(2) Reverse transcribing the RNA into cDNA;

(3) Preparing a detection system PCR reaction solution by taking cDNA as a template according to the components of the kit, performing real-time fluorescence PCR detection, detecting fluorescence signals of ERBB2 genes and internal reference genes GAPDH, and taking positive quality control products and negative quality control products as contrast;

(4) Determining the relative expression level of ERBB2 gene in the sample according to the fluorescence signal of ERBB2 gene and the fluorescence signal of reference gene GAPDH.

In the step (3), the reaction procedure of the real-time fluorescence PCR detection is as follows: pre-denaturation at 95℃for 1min; fluorescent signals were collected at 58℃for 35s at 95℃for 15s,58℃for 35s,40 cycles.

In the step (4), determining the relative expression quantity of the ERBB2 gene in the sample, preparing plasmid solutions containing the ERBB2 gene and the GAPDH gene with different copy numbers by adopting an external standard method, detecting by real-time fluorescence PCR according to the same method to obtain ct values with different copy numbers, respectively preparing an ERBB2 gene standard curve and a GAPDH gene standard curve, and comparing the ct values obtained by sample detection with the standard curve to obtain the copy numbers of the ERBB2 gene and the GAPDH gene in the sample.

Further, the sample detection result may be determined by:

a) The positive judgment standard is that Ct is less than 36 and positive; ct is more than or equal to 35 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative;

b) The I value is calculated according to the following formula: i=erbb2 gene copy number/reference gene GAPDH copy number x 1000;

and judging the expression level of ERBB2 mRNA of the detection sample according to the positive result and the relative expression level I range of ERBB2 mRNA of the normal population.

The relative expression I range of ERBB2 mRNA of normal population can be obtained by detecting the copy number of ERBB2 gene and the copy number of GAPDH of internal reference gene in the samples according to the same method steps, calculating the I value and carrying out statistics according to a plurality of normal population samples.

In a preferred embodiment of the present invention, the I value is >1.349, and the expression level is judged to be high; the I value is less than 0.279, and the expression quantity is judged to be low expression; 0.279< I <1.349, judged normal.

The invention has the beneficial effects that:

1. the specific primer pair of the ERBB2 gene, the upstream primer is designed for the 13 th exon of the ERBB2 gene, the downstream primer is designed for the 14 th exon of the ERBB2 gene, and the probes span the 13 and 14 exons, so that the specificity of the primers and the probes is fully considered; the reason for this design of the invention is: since the template is cDNA, which means that only the exon portion does not contain the intron portion will serve as the template, but there is a possibility that some DNA will remain during RNA extraction, if primers are designed on only one exon, the DNA-templated product will be amplified, while the upstream and downstream primers are placed on different exons, avoiding the risk of amplification of impurity DNA templates. And the probes span the 13 and 14 exon designs to further avoid non-specificity of DNA templates.

2. In the design of the primer, the 3' end of the primer is avoided from using an A base and repeating more than 3 bases as much as possible, so that the mismatch probability of the primer is reduced; in the aspect of probe design, G base is used at the 5' end of the primer as far as possible, the mismatch probability of the primer is reduced, and the probe is positioned as close to the upstream and downstream as possible; meanwhile, when the primers and the probes are screened, the complementary pairing between the two primers and between the primers and the probes is avoided as much as possible, so that the specificity of the primers and the probes can be improved, and the amplification efficiency of the primers is improved.

3. The target gene and the internal reference probe are marked with different fluorescent signals, so that all primers can be put into one tube for amplification, the cost is saved, and the method can be more accurate.

4. The invention can rapidly detect the ERBB2 gene expression level in a sample, compares the detection result with the expression level of a normal person by using a double standard curve method, and can measure whether the expression level of the ERBB2 gene in a detected person is normal or not. Because the normal person is introduced to replace the original single individual detection, the ERBB2 gene expression in the detected person can be detected, and meanwhile, the expression level can be compared with the normal level, so that the clinical reference is provided for guiding the later-stage medication, and the method can be used for assisting the early diagnosis and early prevention of the breast cancer clinically and the screening of high-risk groups.

5. Compared with the prior ISH and immunohistochemical IHC, the real-time fluorescence PCR technology is combined with the Taqman probe, the invention has the advantages of good specificity, high sensitivity and low detection limit, can detect samples with the copy number lower than 10/mu l, has the advantages of improved detection precision, simple operation, high degree of automation, pollution prevention and larger linear range, can detect ERBB2-low BC, and provides powerful support for a new BC treatment method.

Drawings

FIG. 1 is a graph of the detection amplification of clinical samples H3 and H4.

FIG. 2 is an amplification plot of sensitivity experiments.

Detailed Description

The technical method provided by the present invention will be described and illustrated in detail below with reference to specific embodiments and the accompanying drawings, wherein the embodiments are only some embodiments of the present invention, and not limited to all embodiments of the present invention. The reagent components used in the following examples are all components in the kit of the present invention unless specifically indicated. Modifications and variations of the invention based on the present invention will occur to those skilled in the art, and such equivalent modifications are intended to fall within the scope of the claims of the invention as set forth in the claims.

Example 1

The nucleic acid detection kit for detecting ERBB2 mRNA of the present invention comprises:

RNA extract QIAGEN RNeasy FFPE Kit.

THUNDERBIRD Probe qPCR Mix (2×), 0.8uM for each of the ERBB2 upstream and downstream primers, and 0.4uM for each of the ERBB 2-probe; GAPDH upstream and downstream primers of 0.8uM each, GAPDH-probe of 0.4uM each; wherein, the sequences of the primer and the probe are as follows:

ERBB2-F:CGGTGTGAGAAGTGCAGCAA

ERBB2-R:CCTCTCGCAAGTGCTCCAT

ERBB2-Probe:FAM-CCAGACCATAGCACACTCGGGCAC-BHQ1

GAPDH-F:CCTGCACCACCAACTGCTTAG

GAPDH-R:CAGTCTTCTGGGTGGCAGTGA

GAPDH-Probe:HEX-CATCCATGACAACTTTGGTATCGTG–BHQ1；

positive control, genome solution containing ERBB 2;

negative control, no ERBB2 genome solution.

Example 2

Setting of a double standard curve

Establishment of ERBB2 gene standard curve

At a plasmid solution concentration of 10 containing ERBB2 gene ⁷ 、10 ⁶ 、10 ⁵ 、10 ⁴ 、10 ³ 、10 ² And (3) carrying out real-time quantitative PCR detection experiments by taking 10 copies/μl as a template, wherein the experimental steps are the same as those of the steps (3), (4) and (5) in the embodiment 3, and establishing a standard curve for ERBB2 gene detection.

Establishment of GAPDH gene standard curve

At a plasmid solution concentration of 10 containing GAPDH gene ⁷ 、10 ⁶ 、10 ⁵ 、10 ⁴ 、10 ³ 、10 ² Experiments were performed using 10 copies/. Mu.l as templates to establish a standard curve for ERBB2 gene detection.

Example 3

Detection program

(1) Extracting tissue RNA from paraffin sections by cutting out tissue or paraffin sheet samples in a 1.5ml centrifuge tube (scraping); adding 1ml of tissue transparent liquid, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; adding 500ml of tissue transparent liquid into the removed supernatant, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; removing the supernatant, adding 1ml of absolute ethyl alcohol, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; removing the supernatant, and placing in a 37-degree metal bath for 10min (uncovering) until the liquid is dry; reference is made to QIAGEN RNeasy FFPE Kit Paraffin RNA extraction kit instructions for extracting sample RNA.

(2) The RNA was inverted into cDNA with reference to the instructions of TOYOBO company Rever Tra Ace qPCR RT Kit kit.

(3) Preparing reagents, namely preparing each X ul of PCR reaction liquid of a detection system according to the parts of detection people, and subpackaging each 23ul of PCR reaction liquid:

x=23 ul reaction solution× (8 internal reference (standard curve) +8 target genes (standard curve) +n specimens+1 positive control+1 negative control+1 blank control).

(4) Adding sample, namely adding 2ul sample cDNA (or target gene, internal reference, positive control, negative control and blank control) to prepare 25 mu L of detection system PCR reaction solution; 2ul of positive control and negative control are directly added into the positive control and the negative control; the blank was added with 2ul of physiological saline or without any substance.

(5) Detection is performed on a real-time fluorescent PCR apparatus, and available apparatuses include ABI7300, 7500 (company of America Applied Biosystems), and the like. The reaction condition is that the reaction is pre-denatured for 1min at 95 ℃; fluorescent signals were collected at 58℃for 35sec at 15s at 95℃for 40 cycles at 58℃for 35 sec.

(6) And (3) adjusting the threshold line to be above the background signal and the negative amplification line, and automatically calculating the copy number according to the standard curve and the CT value by the system. The I value is calculated according to the following formula: i=copy number of target gene/copy number of reference gene x 1000. The final result is multiplied by 1000 for processing, since the number of copies of the reference gene is orders of magnitude larger.

Example 4

Determination of the relative expression level I Range of the control ERBB2 mRNA from the Normal sample

200 samples of normal breast tissue of clinical pathology department are selected, sample RNA is extracted according to the embodiment 3, reagents are prepared for detection, each sample is added into 2 μl of PCR reaction liquid of a detection system, each sample is repeated for 2 times, and positive and negative controls are simultaneously made; and each detection is used as a standard curve of the reference gene and the target gene.

By detecting 200 normal samples, statistics of I values (ERBB 2 expression quantity/GAPDH internal reference expression quantity multiplied by 1000) are obtained, and the average value and the standard deviation are calculated: the average value + -variance is 0.279-1.349 for normal people. By using the normal ratio as a reference, the high and low expression of the ERBB2 gene in a positive sample can be determined besides judging negative and positive. If the ratio is lower than 0.279, the expression is low; 0.279-1.349 is normal; higher than 1.349 is high expression.

Example 5

The application method of the kit comprises the following steps:

(1) Extracting tissue RNA from paraffin sections by cutting out tissue or paraffin sheet samples in a 1.5ml centrifuge tube (scraping); adding 1ml of tissue transparent liquid, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; adding 500ml of tissue transparent liquid into the removed supernatant, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; removing the supernatant, adding 1ml of absolute ethyl alcohol, shaking and uniformly mixing, and centrifuging at 13000rpm for 1min; removing the supernatant, and placing in a 37-degree metal bath for 10min (uncovering) until the liquid is dry; reference is made to QIAGEN RNeasy FFPE Kit Paraffin RNA extraction kit instructions for extracting sample RNA.

(2) The RNA was inverted into cDNA with reference to the instructions of TOYOBO company Rever Tra Ace qPCR RT Kit kit.

(3) Preparing reagents, namely preparing each X ul of PCR reaction liquid of a detection system according to the parts of detection people, and subpackaging each 23ul of PCR reaction liquid:

x=23 ul reaction solution× (8 internal reference (standard curve) +8 target genes (standard curve) +n specimens+1 positive control+1 negative control+1 blank control).

(4) Sample adding, namely adding 2ul cDNA into the PCR reaction liquid of the detection system; 2ul of positive control and negative control are directly added into the positive control and the negative control; the blank was added with 2ul of physiological saline or without any substance.

(5) Detection is performed on a real-time fluorescent PCR apparatus, and available apparatuses include ABI7300, 7500 (company of America Applied Biosystems), and the like. The reaction condition is that the reaction is pre-denatured for 1min at 95 ℃; fluorescent signals were collected at 58℃for 35sec at 15s at 95℃for 40 cycles at 58℃for 35 sec.

(6) The result is judged by adjusting the threshold line to be above the background signal and the negative amplification line, and the system is based on the standard

And automatically calculating the copy number by using the curve and the CT value. The calculation is performed according to the following formula:

i=copy number of target gene/copy number of reference gene

The judging method comprises the following steps:

1) GAPDH (reference gene) is used for judging whether the quality of the sample meets the detection requirement or not, and is more than or equal to 1.000X10) ³ The sample extraction is normal when the copy number is indicated; if less than 1.000 E.times.10 ³ The samples need to be re-extracted.

2) The relative expression level I of the normal sample control ERBB2 mRNA has been determined through experiments, and the ratio of the target gene/housekeeping gene is basically stabilized at about 0.279-1.349.

3) The positive judgment standard is that Ct is less than 36 and positive; ct is more than or equal to 35 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative.

4) The expression level of ERBB2 mRNA of the detection sample can be determined according to the positive result and the relative expression level I range of ERBB2 mRNA of normal people: the I value is larger than 1.349, and the expression quantity is judged to be high; the I value is less than 0.279, and the expression quantity is judged to be low expression; 0.279< I <1.349, judged normal.

Example 6

Clinical specimens are detected by the detection method of the invention

10 paraffin section samples of breast cancer patients (using single tube fluorescent quantitative PCR technique) were taken, genomic RNA was extracted, and reagents were prepared and tested as described in example 5.

Each sample was added to 2ul of the PCR reaction solution of the detection system. And simultaneously, positive and negative are respectively made, and blank control is made, and standard curves of the reference gene and the target gene are respectively one part. A 96-well fluorescent PCR instrument can detect 20 samples simultaneously, 2 replicates each, a positive control, a negative control and a blank control. The detection time was only 100 minutes.

And comparing the experimental result with the report result of the PCR group, and determining the accuracy of sample detection. The experimental results are shown in table 1 and fig. 1:

TABLE 1

FIG. 1 shows that the ERBB2 expression is normal in H3 samples and high in H4 samples when H3 and H4 samples are almost identical in the case of the reference GAPDH expression.

As can be seen from Table 1 above, 6 of 10 breast cancer samples were highly expressed, 4 were normally expressed, and no low expression was found. Because normal human values are introduced as references, the ERBB2 expression level of the tested person can be finally evaluated, so that the later treatment and medication are guided. The method has high result accuracy and has a certain guiding significance for clinic.

Example 7

Sensitivity experiment

The invention develops the kit for the purpose of providing support for a new BC treatment method for detecting ERBB2-low BC, so that the kit is required to have high sensitivity.

cDNA samples with low copy number of 18.94/. Mu.L were taken, diluted in a 1:2, 1:4 gradient, and the diluted samples were prepared and tested as described in example 5, below. The specific results are shown in FIG. 2 and Table 2. As can be seen from FIG. 2, the target gene is actually amplified by dilution at a multiple ratio and a sample of about 5 copies at the lowest can be detected, and the results in Table 2 show that the detection result is basically consistent with the theoretical copy number after dilution, and samples with the copy number lower than 10/. Mu.L can be detected, and the detection limit can be significantly reduced compared with the prior art by the minimum of 5 copies/. Mu.L.

TABLE 2

Claims (10)

1. The primer combination for detecting the expression level of the ERBB2 gene is characterized by comprising an ERBB2 gene specific primer pair and an ERBB2 gene detection probe, wherein the sequences of an upstream primer ERBB2-F and a downstream primer ERBB2-R of the ERBB2 gene specific primer pair are as follows:

ERBB2-F:CGGTGTGAGAAGTGCAGCAA；

ERBB2-R:CCTCTCGCAAGTGCTCCAT；

the sequence of ERBB2 gene detection Probe ERBB2-Probe is:

ERBB2-Probe:FAM-CCAGACCATAGCACACTCGGGCAC-BHQ1。

2. the primer combination of claim 1, wherein the primer combination for detecting the expression level of ERBB2 gene further comprises a specific primer pair of a reference gene GAPDH and a reference gene GAPDH detection probe, and the sequences of the specific primer pair upstream primer GAPDH-F and downstream primer GAPDH-R of the reference gene GAPDH are:

GAPDH-F:CCTGCACCACCAACTGCTTAG；

GAPDH-R:CAGTCTTCTGGGTGGCAGTGA；

the sequence of the reference gene GAPDH detection Probe GAPDH-Probe is as follows:

GAPDH-Probe:HEX-CATCCATGACAACTTTGGTATCGTG–BHQ1。

3. a kit for detecting the expression level of ERBB2 gene comprising the primer combination of claim 2.

4. A kit according to claim 3, characterized in that the kit comprises a detection system PCR reaction solution comprising an upstream primer ERBB2-F of the ERBB2 gene specific primer pair, a downstream primer ERBB2-R, ERBB2 gene detection Probe ERBB2-Probe, an upstream primer GAPDH-F of the reference gene GAPDH specific primer pair, a downstream primer GAPDH-R and a reference gene GAPDH detection Probe GAPDH-Probe.

5. The kit according to claim 4, wherein the concentration of ERBB2-F, ERBB2-R, GAPDH-F, GAPDH-R in the PCR reaction solution of the detection system is 0.5 to 6. Mu.M, and the concentration of ERBB2-Probe and GAPDH-Probe is 0.2 to 3. Mu.M.

6. The kit of claim 5, wherein the molar ratio of ERBB2-F, ERBB2-R, ERBB2-Probe in the PCR reaction solution of the detection system is 2:2:1; the molar ratio of GAPDH-F, GAPDH-R, GAPDH-Probe was 2:2:1.

7. The kit of claim 4, wherein the kit comprises a positive control and a negative control, the positive control being a solution comprising ERBB2 genome; the negative control is a solution without ERBB2 genome.

8. A method for detecting ERBB2 gene expression levels for in vitro non-diagnostic purposes, characterized in that said method employs a kit according to any one of claims 4 to 7 based on the detection of ERBB2 gene expression levels, comprising the steps of:

(1) Extracting RNA in a sample;

(2) Reverse transcribing the RNA into cDNA;

(3) Preparing a detection system PCR reaction solution by taking cDNA as a template according to the components of the kit, performing real-time fluorescence PCR detection, detecting fluorescence signals of ERBB2 genes and internal reference genes GAPDH, and taking positive quality control products and negative quality control products as contrast;

(4) Determining the relative expression level of ERBB2 gene in the sample according to the fluorescence signal of ERBB2 gene and the fluorescence signal of reference gene GAPDH.

9. The method of claim 8, wherein in step (3), the reaction procedure for real-time fluorescent PCR detection is: pre-denaturation at 95℃for 1min; fluorescent signals were collected at 58℃for 35s at 95℃for 15s,58℃for 35s,40 cycles.

10. The method of claim 8, wherein the sample detection result is determined by:

a) The positive judgment standard is that Ct is less than 36 and positive; ct is more than or equal to 35 and less than or equal to 38, is suspected positive and needs to be verified again; ct > 38, negative;

b) The I value is calculated according to the following formula: i=erbb2 gene copy number/reference gene GAPDH copy number x 1000;

and judging the expression level of ERBB2 mRNA of the detection sample according to the positive result and the relative expression level I range of ERBB2 mRNA of the normal population.