CN105695567B

CN105695567B - A kind of kit for detecting foetal chromosome aneuploidy, primer and probe sequence and detection method

Info

Publication number: CN105695567B
Application number: CN201510857412.1A
Authority: CN
Inventors: 刘涛
Original assignee: Beijing Yushengda Medical Technology Co Ltd
Current assignee: Inner Mongolia inno Biotechnology Co.,Ltd.
Priority date: 2015-11-30
Filing date: 2015-11-30
Publication date: 2019-04-05
Anticipated expiration: 2035-11-30
Also published as: CN105695567A

Abstract

Kit, primer and probe sequence and the detection method that the present invention provides a kind of for detecting foetal chromosome aneuploidy.Wherein kit includes: according to No. 13, No. 18 and No. 21 chromosomal gene sequence of the mankind, the multipair specific primer of design and a plurality of specificity T aqman probe；And the reaction system for carrying out digital pcr；Wherein, the nucleotides sequence of the multipair specific primer and a plurality of specificity T aqman probe is classified as SEQ ID NO:1-90；Wherein detection method includes (1) according to No. 13, No. 18 and No. 21 chromosomal gene sequence of the mankind, designs multipair specific primer and a plurality of specificity T aqman probe；(2) pregnant 12-23 weeks maternal blood is acquired to extract for plasma dna；(3) reaction system of digital pcr amplification gene sequence is prepared；(4) chromosome number calculating 13,18 and No. 21 chromosome numbers of fetus are detected by digital pcr and calculates separately the copy number of 13,18 and 21 chromosomes using FAM the and VIC fluorescence of each reaction member of digital pcr detection chip.It efficiently quick and precisely noninvasive can complete to be conducive to clinical application and popularization to 13,18 and No. 21 chromosome number purpose detections of fetus using mentioned reagent box and method.

Description

A kind of kit for detecting foetal chromosome aneuploidy, primer and probe sequence Column and detection method

Technical field

The present invention relates to chromosome detection, in particular to the detection of fetus dissociative nucleic acid in female blood, especially with number The method of round pcr detection fetal aneuploidy.

Background technique

Birth defect is current prenatal and postnatal care problem in urgent need to solve, and chromosome abnormality is lead to birth defect important Reason.According to statistics, the incidence of neonatal chromosome disorder is about 0.5.In numerous chromosome diseases, chromosome is non-whole Deformity caused by times body and life obstacle are particularly evident.Wherein again with 21- three-body (Down syndrome), 18- three-body (Ai Dehuashi Syndrome) and three kinds of autosome aneuploids of 13- three-body (pa pottery Cotard) it is most commonly seen, the disease incidence in newborn Respectively 1/800,1/6000 and 1/10000.Although chromosome aneuploidy disease can occur in all pregnant woman ages, with Pregnant woman age increases, and the incidence of chromosome aneuploidy disease also can obviously rise.Currently, effective treatment method there is no Fetal chromosomal disease is cured, and the birth of each patau syndrome infant can cause huge spirit to family and society And financial burden, it is to control prenatal diagnosis most at present that progress Prenatal Screening, which avoids the birth of infant with diagnosis, Effective measures.

At present there are many ways to detection prenatal diagnosis, two major classes are broadly divided into, one kind is invasive diagnosis, Main villous membrane puncture, amniocentesis and through umbilical vein puncture technology, such method determines chromosome by fetal cell Caryogram is the goldstandard of diagnosing fetal chromosomal aneuploid disease, but these technologies increase unnecessary intrusion, to fetus There is a degree of injury with pregnant woman, with risks such as about 1% miscarriage, intrauterine infection, premature labors.Due to above-mentioned risk, so Invasive method cannot be used for extensive screening, be only suitable for doing the confirmation of high risk individual；Another kind of is non-invasive screening, according to sieve The difference for the marker looked into, the accounting sequencing screening that non-invasive screening divides traditional screening serum and a new generation high-throughput again.Serum Screening is that the protein marker detected in maternal serum is test object, due to the modulated complexity of protein expression, detection Accuracy is very poor, so screening serum has very high false positive rate and omission factor, the practical significance of detection is little.

(Lo YM, Corbetta N, Chamberlain PF, the et al.Presence of fetal such as Lo in 1997 DNA in maternal plasma and serum.Lancet, 1997,350 (9076): 485-487) it finds in pregnant woman blood plasma It is middle to there is free foetal DNA, and fetus dissociative DNA content accounts for the 3~6% of Maternal plasma total DNA, and content is with pregnant week Growth and increase, to pregnant advanced stage there are one the process that sharply increases, the studies above is the birth of noninvasive pre-natal diagnosis technology Provide premise.In this theoretical basis, the high-flux sequence platform of illumina company and life technologies company It has been applied to noninvasive DNA pre-natal diagnosis.Although the noninvasive DNA pre-natal diagnosis technology based on high-flux sequence, there is accuracy High, the advantages that flux is high；But high-throughput operating platform is more demanding, and only third-party large-scale sequencing company can be completed at present This detection.The step of high-flux sequence progress noninvasive antenatal detection includes: that plasma dna extracts, and library construction, quality inspection quantitatively mixes Library is sequenced on two generation sequenators, information analysis processing.Think that complete independently high-flux sequence carries out noninvasive antenatal detection and needs height The professional of the equipment investment of volume and each operating procedure.

Digital pcr technology is by the way that micro-example is made big multiple dilution and liquid separation (partitioning), until each Testing molecule number contained in sample does not exceed 1 copy, then all samples are carried out PCR amplification under the same conditions, And to a kind of technology that the sample that amplified reaction has occurred is counted one by one.Digital pcr is a kind of nucleic acid molecules absolute quantitation Technology, it is more more accurate than real-time PCR, can to fetus dissociative DNA carry out accurate quantification analysis, and do not depend on sex of foetus and Genetic polymorphism, or even allow the pollution of mother body D NA and the presence of chimera.Digital pcr has brilliant sensitivity, standard Exactness and repeatability, detection in terms of rare mutation detection, copy number variation, gene have apparent excellent More property.(Lo YM, Lun FM, Chan KC, the et al.Digital PCR for the molecular detection such as Lo Of fetal chromosomal aneuploidy.Proc Natl Acad Sci USA, 2007,104 (32): 13116- 13121) digital pcr is utilized, by detecting PLAC4 mRNA SNP, and to compare No. 21 chromosomes corresponding on No. 1 chromosome The mode diagnosis of fetal aneuploidy of the opposite chromosome dosage in site.Although the above method can diagnose chimera, it is needed It wants fetal aneuploidy DNA content that need to reach 25% or more of foetal DNA total content, greatly limits the application of this method.

On the basis of the above, digital pcr technology and its application in fetal chromosomal detection are gradually goed deep into.Typically now The digital pcr instrument used is mainly the QuantStudio of Thermo Fisher Scientific company^TM 3D、 The QX200 of the Raindrop digital PCR System and Bio-RAD company of RainDance company.The number of three producers The common feature of PCR instrument be all be a considerable number of dispersed droplets, difference is that Thermo Fisher Scientific is public What department utilized is chip micropore, and Ling Liang company is the droplet of Water-In-Oil.

Currently, there are many Fetal genomes or nucleotide detection based on the development of digital pcr technology, such as: patent Fetal genome analysis is carried out by maternal biological sample disclosed in WO2011057094A, by analysis from maternal sample The fetal DNA fragments of product are to identify the allele at certain gene locus, respective equipotential at these gene locus of comprehensive analysis The amount of the DNA fragmentation of gene, to determine the relative quantity of the haplotype of these locus, and determine from the heredity of parental gene group which Kind haplotype, thus in the full-length genome of antenatal building fetus or the genome of selected gene region, it is true based on above-mentioned map Determine the risk that fetus suffers from hereditary disease or other diseases or inhereditary feature.However the implementation of the above method is relied primarily on and is analyzed with data And processing system, need powerful background analysis instrument to support, it is also desirable to which professional data analyst is unfavorable for clinical application Popularization.United States Patent (USP) US2011151442A1 then discloses the molecular detecting method of fetal aneuploidy, and this method uses number Word round pcr is expanded and is detected to the single target sequence from fetal tissue's sample, for detecting chromosome aneuploidy Body or variation.However, the above method based on sample be fetal tissue, although overcome amniocentesis detection in need cell to train Feeding problem, but the acquisition of fetal tissue will necessarily bring potential infection or other adverse effects, and the patent is in PCR Single primer sequence is used for each target sequence in amplification, the accuracy and sensitivity of result certainly will be will affect.It is domestic Patent is mainly application of the multiple number round pcr in chromosome aneuploid screening disclosed in ZL201510274271.0, It separates removal cell using the pregnant object peripheral blood of fetus dissociative DNA as test sample, from peripheral blood sample, and thin from removal Enrichment DNA in the sample of born of the same parents, obtains DNA sample, and above-mentioned sample is divided into control group and experimental group carries out multiple digital pcr Amplification, determines chromosome number according to amplification.The patented technology avoids the acquisition and data of sample in above-mentioned patent The drawbacks of analysis aspect, but since primer logarithm is using less in its amplification method, thus to sample DNA content in expanding It is more demanding, be only capable of accurately detecting trisomy 21 foetal DNA less than 5% and 10%.

Therefore, it is desired to be able to provide one kind can with Noninvasive, high sensitivity, identify that fetal chromosomal is non-to high accuracy The kit and method of euploid, in order to which clinical popularization is quoted.

Summary of the invention:

The object of the invention is to detect inaccuracy and high flux examination to overcome the problems, such as that screening serum technology exists Technical operation requires high, the huge disadvantage of input cost, provides a kind of easy to operate, inexpensive, quick, high accuracy reagent Box, primer and its application method are used for digital pcr detection of platform fetal chromosomal Number Variation.

In order to realize detection chromosome number purpose purpose of the invention, one aspect of the present invention, which devises, provides one kind for examining The kit and primer for surveying fetal chromosomal number ploidy design amplification according to the gene order of the 13rd, 18 and No. 21 chromosome Primer and taqman probe.The DNA of parent and fetus dissociative is not that complete chromosome and large fragment exist in blood plasma, so Multiple detection sites can be designed on item chromosome, can more accurately detect the number of 13,18 and No. 21 chromosome in this way Mesh.The amplimer and spy of 10 site qualifications are separately designed and filtered out in the present invention on 13,18 and No. 21 chromosomes Needle.Non-uniformity distribution 10 detection sites of design on every chromosome, there are two benefits for design in this way: first, it improves The accuracy of detection, will not be due to the random errors affect testing result of a detection site；Second, if chromosome is part Three-body can also make accurate judgement.

Wherein, since 2/3 or more the fragment length of blood plasma is to exist in 166bp or so in order to more utilize in blood plasma Short-movie section, the present invention limits the amplification range of detection between 60-100bp, can guarantee in this way in design primer and probe The template number of detection improves the accuracy of monitoring.

Wherein, in order to more improve the utilization of template, so that the temperature of withdrawing from a secret society or underworld gang of taqman probe is higher than amplification again and draw The annealing temperature of object joined LNA or MGB modification when designing probe.

Wherein, in order to improve the accuracy of detection, the interference of detection signal, 3 ' two of end end of amplimer are reduced Thio-modification is used between base, can prevent the exo-acting of polymerase in this way, improves the specificity of amplification, is reduced unnecessary Amplification generates.

Wherein, in order to improve the accuracy of detection, the selection for detecting object of reference is with other dyeing of same detection sample Body is to be detected ploidy referring to comparing calculation.While the accuracy of detection, for the simplicity and economy of detection Property, for the detection site probe of 13 and No. 18 chromosome labeled as VIC, the detection site probe of No. 21 chromosome is labeled as FAM.Inspection Three chromosomes for surveying a sample are completed with two digital pcr reactions, and a pipe is the detection combination of 13 and No. 21 chromosome, separately One be 18 and No. 21 chromosome detection combination.The probability that 21- three-body occurs is much higher than 13- three-body and 18- three-body, and two kinds The simultaneous probability of three-body it is small again it is small, it is this combination be equivalent to 21 chromosomes be detected twice, this can more promote 21 dyeing Body accuracy.

Specifically: the present invention is claimed a kind of for detecting the kit of foetal chromosome aneuploidy, comprising: according to No. 13, No. 18 and No. 21 chromosomal gene sequence of the mankind, the multipair specific primer separately designed and a plurality of specificity Taqman probe；And the reaction system for carrying out digital pcr.

Wherein the multipair specific primer and a plurality of specificity T aqman probe sequence are SEQ ID NO:1-90.

Wherein the multipair specific primer and a plurality of specificity T aqman probe sequence are divided into two groups: first groups and include The nucleotide sequence of SEQ ID NO:1-60, second group include SEQ ID NO:1-30,61-90 nucleotide sequence.

In addition, the present invention also protects specific primer and Taqman probe for detecting foetal chromosome aneuploidy, Its nucleotides sequence is classified as SEQ ID NO:1-90.

Wherein the specific primer and Taqman probe are divided into two groups, first group include SEQ ID NO:1-60 nucleosides Acid sequence, second group include SEQ ID NO:1-30,61-90 nucleotide sequence.

To achieve the purpose of the present invention, another aspect of the present invention provides a kind of for detecting fetal chromosomal number method, The present invention carries out stringent experiment screening in the primer and probe that digital pcr detects, and filters out with roughly the same amplification efficiency, The combination primer to mix and the primer and probe not interfered with each other.Meanwhile the present invention is also to the primer and probe of amplification Concentration is optimized.

Wherein, in order to which the detection for filtering out roughly the same amplification efficiency is reacted, the present invention setting on item chromosome The primer and probe of 20 detections is counted, each detection is individually tested, and amplification efficiency height, while amplification efficiency phase are filtered out Close primer and probe detects reaction.It is mixed in two groups of detections of test after filtering out the primer and probe for individually expanding and meeting the requirements Close the single detection site performance in primer and probe.The combination of first group of primer and probe for detect No. 21 chromosomes with 18 Each 10 detections of number chromosome number purpose；Second group of primer and probe combination is for detecting No. 21 chromosomes and No. 13 chromosome numbers Each 10 detections of purpose.

Wherein, in order to promote the accuracy and sensibility of detection, the present invention carries out the concentration of the primer and probe of detection Optimization.Present invention discover that the concentration that primer and probe when one site of detection needs is high, the final concentration needed is 200nM. Above and below the concentration for detecting No. 21 chromosomes and No. 18 chromosome number purpose 10 detections primer and probes in the present invention Limiting range is 20-100nM；It is equally used for primer and the spy of No. 21 chromosomes of detection and each 10 detections of No. 13 chromosome number purposes The concentration limits range of needle is 20-100nM.

Wherein, further, present invention discover that performance when the combined concentration of two groups of primer and probes is 50nM is optimal.

Specifically, a kind of method that the present invention requests external Noninvasive detection foetal chromosome aneuploidy, including such as Lower step:

(1) according to No. 13, No. 18 and No. 21 chromosomal gene sequence of the mankind, 10 pairs of specific primers are separately designed With 10 specificity T aqman probes；

(2) pregnant 12-23 weeks maternal blood is acquired to extract for plasma dna；

(3) reaction system of digital pcr amplification gene sequence is prepared；

(4) chromosome number is detected by digital pcr and calculates 13,18 and No. 21 chromosome numbers of fetus, utilize digital pcr FAM the and VIC fluorescence of each reaction member of detection chip calculates separately the copy number of 13,18 and 21 chromosomes.

The wherein sequence of 30 pairs of specific primers and 30 specificity T aqman probes are as follows: SEQ ID NO:1-90.

The wherein extraction step of the maternal plasma DNA are as follows: a, extraction maternal blood 10ml are anticoagulant in EDTA Guan Zhong, mixing 8 times of turning upside down, room temperature preservation；B, peripheral blood blood plasma is separated, 10min is centrifuged at room temperature with 1600g, after centrifugation Supernatant (blood plasma) is dispensed into 1.5ml centrifuge tube, 10min removal residual cells is centrifuged at room temperature with 16000g again, collects It is centrifuged obtained supernatant and is merged into spare；C, it extracts the DNA collected in blood plasma obtained and is quantified.

Wherein the preparation of the reaction system of the digital pcr amplification gene sequence includes by primer and probe sequence SEQ ID NO:1-90 divides the step of being first group and second group.

Wherein described first group include SEQ ID NO:1-60 nucleotide sequence, described second group includes SEQ ID NO: The nucleotide sequence of 1-30,61-90, and first group is used to detect 21 and No. 18 chromosomes, and second group for detecting 21 and 13 Number chromosome.

To achieve the purpose of the present invention, detection of the invention may operate on the digital pcr instrument of any production, such as The fluorescence signal channel that fruit is collected is enough, and two groups of detections reaction of detection of the invention can synthesize to be detected in a pipe, this hair The design of bright detection is 13,18 and No. 21 chromosomes of detection, but simultaneously only limit detects this three chromosomes, according to the present invention to set Meter thought can detecte other chromosomes.

The beneficial effects of the present invention are embodied in:

1. kit provided by the invention may be implemented rapidly and accurately to detect chromosome number.Kit of the invention is only Pregnant woman blood plasma DNA need to be detected on digital pcr, be not required to complicated data analysis, entire detection process time-consuming is short；This hair Bright kit can detect 10 specific fragments of every chromosome simultaneously, avoid because of alkali in sample quality problem and amplification procedure The detection error that base mutation generates.

2. preparation method provided by the invention is simple, at low cost.Only need the preparation of single step reaction system that can go up machine testing, pole The big human input reduced in detection process is suitble to situation of all-level hospitals to promote the use of, not by capital investment and peopleware Limitation.

3. the present invention is the copy number of DNA in direct detection pregnant woman blood plasma, be it is noninvasive under the conditions of most accurate and direct inspection The method for surveying fetal chromosomal ploidy.

Detailed description of the invention

Chromosome location schematic diagram is reacted in two groups of detections of Fig. 1

The primer and probe design diagram of Fig. 2 detection position

Fig. 3 different primers concentration results figure

Fig. 4 does not have to concentration and probe concentration result figure

Fig. 5 .chr18 and chr21 primer mixing fluorescent quantitation result figure

Fig. 6 .chr13 and chr21 primer mixing fluorescent quantitation result figure

Specific embodiment

Above scheme is described further below in conjunction with specific embodiment.It should be understood that these embodiments are for illustrating The present invention and be not limited to limit the scope of the invention.Implementation condition used in the examples can be done according to the condition of specific producer Further adjustment, the implementation condition being not specified is usually the condition in routine experiment.

The design of embodiment 1 detection primer and probe

One aspect of the present invention devise provide it is a kind of for detecting the kit of fetal chromosomal number ploidy, 13,18 With design amplimer and taqman probe on No. 21 chromosomes.The DNA of parent and fetus dissociative is not complete in blood plasma Chromosome and large fragment exist, it is possible to design multiple detection sites on item chromosome, can more accurately examine in this way Survey the number of 13,18 and No. 21 chromosome.In the present invention 10 are separately designed and filtered out on 13,18 and No. 21 chromosomes The amplimer and probe of site qualification.

In order to filter out the detection reaction of roughly the same amplification efficiency, design of the present invention on item chromosome 20 The primer and probe of detection, each detection are individually tested, and filter out amplification efficiency height, while drawing similar in amplification efficiency Object and probe in detecting reaction.After filtering out the primer and probe for individually expanding and meeting the requirements, two groups of detection mix primers are being tested With the single detection site performance in probe.First group of primer and probe combination is for detecting dyeing with No. 18 for No. 21 chromosomes Each 10 detections of body number；Second group of primer and probe combination is each for detecting No. 21 chromosomes and No. 13 chromosome number purposes 10 detections.As shown in Figure 1, the distribution of the combination and detection site of the detection of two pipes substantially on chromosome.

Since the fragment length of blood plasma is largely in 166bp or so, in order to more utilize short-movie present in blood plasma Section, the present invention limit the amplification range of detection between 60-100bp, can guarantee detection in this way in design primer and probe Template number improves the accuracy of monitoring.As shown in Fig. 2, detection the smaller detected segment of segment it is more, detection it is accurate Property can be higher, the detection segment that the present invention designs all be shorter than 100bp.

According to described above and experiment screening, the present invention, which filters out, is suitble to detection Chr13, Chr18 and Chr21 chromosome The primer of ploidy combines, and 30 groups of primer and probes, sequence are respectively as follows: altogether

Chr21-3-F(SEQ ID NO:1):TCATCAGGAGAACGCTGTTG

Chr21-3-R(SEQ ID NO:2):GGGCAACGTTAGGTCAAGAT

Chr21-3-probe(SEQ ID NO:3):FAM-CAAAAGGTGCATTACAGTTGCATGG-BHQ1

Chr21-5-F(SEQ ID NO:4):CTTACAATGCTTTGATGAGGCA

Chr21-5-R(SEQ ID NO:5):TGTGTGTTGATGGCAGAGTTT

Chr21-5-probe(SEQ ID NO:6):FAM-CCCCACGGACTTGGGAATAAGG-BHQ1

Chr21-6-F(SEQ ID NO:7):GGAAACTGAGTAAGGCCCAC

Chr21-6-R(SEQ ID NO:8):GGGGGTGAGGACATAGCTT

Chr21-6-probe(SEQ ID NO:9):FAM-TACCTCCAGTGAACAGCTTCAGGC-BHQ1

Chr21-8-F(SEQ ID NO:10):GGCAGGACACGATTACCAAT

Chr21-8-R(SEQ ID NO:11):AATGATGGATGGTTGGGCTC

Chr21-8-probe(SEQ ID NO:12):FAM-CACCCCGTGTCATTTGGATTAGAC-BHQ1

Chr21-11-F(SEQ ID NO:13):CAAGCGCTTCTGCTGAAAGT

Chr21-11-R(SEQ ID NO:14):TCAGGCACGAAGAACTGTCC

Chr21-11-probe(SEQ ID NO:15):FAM-AGGTCCCATGCTCCACCCGA-BHQ1

Chr21-14-F(SEQ ID NO:16):CGGCTACATTTCCCGTGAGT

Chr21-14-R(SEQ ID NO:17):GCAGACAGGGAGCAAGAGAG

Chr21-14-probe(SEQ ID NO:18):FAM-CCAACGTGGACCAGTCGGCC-BHQ1

Chr21-15-F(SEQ ID NO:19):GTGCTGAGAAGGACACCTCC

Chr21-15-R(SEQ ID NO:20):TACAGCCGAGCACTGACAAG

Chr21-15-probe(SEQ ID NO:21):FAM-AGAAGGGGACAGCGCCACCT-BHQ1

Chr21-16-F(SEQ ID NO:22):GCACTTGGTGAAGACAAGGC

Chr21-16-R(SEQ ID NO:23):ACATCCTCAAGAGCTGTGGC

Chr21-16-probe(SEQ ID NO:24):FAM-ATCACGCGGCCGAGACATGG-BHQ1

Chr21-18-F(SEQ ID NO:25):GTGTCAGCAAGCTGGGTTTG

Chr21-18-R(SEQ ID NO:26):CCCGAGAGTCACTGGTTCAC

Chr21-18-probe(SEQ ID NO:27):FAM-AGTGTCTTCCAAGCGACGGTGT-BHQ1

Chr21-19-F(SEQ ID NO:28):ACAAGGTCGGCAACTCCTTT

Chr21-19-R(SEQ ID NO:29):GCCGTCTCCATCATTGTCCA

Chr21-19-probe(SEQ ID NO:30):FAM-AGCAGGAGGTTGTGGACAAAGTCA-BHQ1

Chr18-4-F(SEQ ID NO:31):CAAACAGACTTGGGCCTCTTA

Chr18-4-R(SEQ ID NO:32):CCTTTTTGCTCCCTCTCCAC

Chr18-4-probe(SEQ ID NO:33):VIC-CCTGGAGAGAGACTGGTGGCTGG-TAMRA

Chr18-6-F(SEQ ID NO:34):AGTCCCAATGCCTCACTTTG

Chr18-6-R(SEQ ID NO:35):GCCAAGGTAGAGTTGACCAG

Chr18-6-probe(SEQ ID NO:36):VIC-CGGGTGCGTGGTGGGCTTCA-TAMRA

Chr18-8-F(SEQ ID NO:37):ATCTTCATCAAGTCCGCCAC

Chr18-8-R(SEQ ID NO:38):TCTCGTAGTCGAAAGCCTTG

Chr18-8-probe(SEQ ID NO:39):VIC-CTCCAGGACGCTGTTGGTACAC-TAMRA

Chr18-12-F(SEQ ID NO:40):AGTGGAGTGAGCAGCAAGAC

Chr18-12-R(SEQ ID NO:41):CAGGAGCTCATACGGCAGAG

Chr18-12-probe(SEQ ID NO:42):VIC-ACTGGGGGCACCTGCATTCC-TAMRA

Chr18-13-F(SEQ ID NO:43):TGGGATGAAGGTCCAACAGC

Chr18-13-R(SEQ ID NO:44):AAGCTGGGAATACACCGCAA

Chr18-13-probe(SEQ ID NO:45):VIC-CTGGAGCCGGCAGCAGTGAG-TAMRA

Chr18-14-F(SEQ ID NO:46):GCACACTTCTCTGCACCTCT

Chr18-14-R(SEQ ID NO:47):TCGTAGCACCCTCCATCAGA

Chr18-14-probe(SEQ ID NO:48):VIC-TGCACAGCAATGCCAGTGAGTCC-TAMRA

Chr18-16-F(SEQ ID NO:49):TTTCGGTGACTTCCGCATCA

Chr18-16-R(SEQ ID NO:50):CGGTCTCCTAAAAGCAGGCA

Chr18-16-probe(SEQ ID NO:51):VIC-CCAGAGCATCAGGCCGCCAC-TAMRA

Chr18-17-F(SEQ ID NO:52):TCCAGACATTCTCGCTTCCC

Chr18-17-R(SEQ ID NO:53):TGTGCCCAAGTTTCACTGGA

Chr18-17-probe(SEQ ID NO:54):VIC-ACCCACGAAACTGCCCTGGC-TAMRA

Chr18-18-F(SEQ ID NO:55):CCCTCCACCCTTGGACTTTC

Chr18-18-R(SEQ ID NO:56):TCTGTCTCTGCAGCTGTGTG

Chr18-18-probe(SEQ ID NO:57):VIC-CGGCACCCTTGCGCTTTTGC-TAMRA

Chr18-19-F(SEQ ID NO:58):ACGTCGCTGATGGAGAAAGG

Chr18-19-R(SEQ ID NO:59):GTGAGACACAAGAGACGCGA

Chr18-19-probe(SEQ ID NO:60):VIC-CCCGCAGAAGGAACGGCCTG-TAMRA

Chr13-1-F(SEQ ID NO:61):AAAACCCAGAAGGTCCGCAT

Chr13-1-R(SEQ ID NO:62):GCTTCGAAGATGACCCGGAA

Chr13-1-probe(SEQ ID NO:63):VIC-AGGCTCCCTGTGGTGGACCT-TAMRA

Chr13-2-F(SEQ ID NO:64):CTCCTCCCCAGCTCTTCTCT

Chr13-2-R(SEQ ID NO:65):GCCTTTCCCTTGAGTCCCTC

Chr13-2-probe(SEQ ID NO:66):VIC-CTGCAGGCTGCACCTCTGGC-TAMRA

Chr13-7-F(SEQ ID NO:67):GTTTAACGACCGCACAGCTC

Chr13-7-R(SEQ ID NO:68):TTTCATGGATGCCTTGGGCT

Chr13-7-probe(SEQ ID NO:69):VIC-TGGCCTCTATCGTTATGCTGCAGA-TAMRA

Chr13-8-F(SEQ ID NO:70):TCAAATCGAAGAGTTGTGAACTG

Chr13-8-R(SEQ ID NO:71):GAGAGATAATGGCTTGCGTGC

Chr13-8-probe(SEQ ID NO:72):VIC-CCCATTGAAAAGACCGAGCCTTGT-TAMRA

Chr13-10-F(SEQ ID NO:73):CAGGGACACACGCATCACTA

Chr13-10-R(SEQ ID NO:74):CTGGGGACTCAGCAAGAGTG

Chr13-10-probe(SEQ ID NO:75):VIC-CCCTGGCTGCAGTGGGAGGA-TAMRA

Chr13-11-F(SEQ ID NO:76):CGAGATACGGGCACATACGG

Chr13-11-R(SEQ ID NO:77):ACAGCGGCAAAAGCTTCTCT

Chr13-11-probe(SEQ ID NO:78):VIC-TGCTGCCGGAGCGTTACATCA-TAMRA

Chr13-12-F(SEQ ID NO:79):CAGGCAGGAGGACTATGCAG

Chr13-12-R(SEQ ID NO:80):GGCACCACATCACCACAAAC

Chr13-12-probe(SEQ ID NO:81):VIC-AGGCATGCAAGGTGCTGGGC-TAMRA

Chr13-17-F(SEQ ID NO:82):AGAATGTGGATGGCCGTGTT

Chr13-17-R(SEQ ID NO:83):TGAGCCTGCGGAGAGAGTAG

Chr13-17-probe(SEQ ID NO:84):VIC-ACAGGCGACCTTTCAGCAGAGA-TAMRA

Chr13-19-F(SEQ ID NO:85):AACTGCATGTGGGCTATGGG

Chr13-19-R(SEQ ID NO:86):GCGCTAGATGACACCCTCTC

Chr13-19-probe(SEQ ID NO:87):VIC-CCCTGGTCATGTGCCCCTTCGCAGC-TAMRA

Chr13-20-F(SEQ ID NO:88):TGGAGAGATGCCAGTGACCT

Chr13-20-R(SEQ ID NO:89):GCTACCTGCCCCTTTGTCAT

Chr13-20-probe(SEQ ID NO:90):VIC-ACTGCCTGGTGCAGTGTCCAC-TAMRA

2 maternal blood of embodiment is extracted for plasma dna

A, pregnant 12-23 weeks maternal blood 10ml is extracted in EDTA anticoagulant tube, mixing 8 times of turning upside down, room temperature preservation； B, peripheral blood blood plasma is separated, 10min is centrifuged at room temperature with 1600g, supernatant (blood plasma) is dispensed into 1.5ml centrifuge tube after centrifugation In, it is centrifuged 10min removal residual cells at room temperature with 16000g again, collects and be centrifuged obtained supernatant and be dispensed into 1.5ml centrifugation The volume of Guan Zhong, every pipe packing blood plasma are 450 μ L；C, it extracts the DNA collected in blood plasma obtained and is quantified.Wherein mention Take plasma dna using adsorption column method, the specific steps are the serum samples for saving 450ul refrigerator to melt in room temperature.16000g, often Temperature centrifugation 5min, takes 400-430ul to be transferred in the centrifuge tube of new 1.5ml.The Proteinase K solution of 40 μ l is added, mixes Of short duration centrifugation afterwards；The buffer GB and 1ul Carrier RNA (can first be made into mixed liquor adding) of 400 μ l is added, gently overturns It mixes, 56 DEG C of warm bath 10min, and jog sample frequently；The dehydrated alcohol of 400 μ l is added (if room temperature is more than 25 DEG C, please by second Alcohol is set to be pre-chilled on ice) it is gently mixed by inversion sample, it is placed at room temperature for 5min；Previous step acquired solution is shifted into 700ul a to suction In attached column CR2,12,000rpm (~13,400 × g) are centrifuged 30sec, abandon waste liquid (can repeatedly shift)；Into adsorption column CR2 500 μ l buffer GD, 12,000rpm (~13,400 × g) are added and are centrifuged 30sec, abandon waste liquid；600 are added into adsorption column CR2 μ l rinsing liquid PW (dehydrated alcohol has been added), 12,000rpm (~13,400 × g) are centrifuged 30sec, abandon waste liquid；Repeat rinsing behaviour Make primary, abandoning waste liquid；12,000rpm (~13,400 × g) are centrifuged 2min, adsorption column CR2 are transferred in new collecting pipe, room Temperature places 2-5min；50 μ l eluents are vacantly added dropwise to adsorbed film middle position, are placed at room temperature for 2-5min, 12,000rpm (~ 13,400 × g) centrifugation 2min, collects eluent.Qubit quantitatively extracts gained sample DNA concentration.

The preparation of 3 reaction system test template of embodiment

Complete genome DNA is extracted as reaction system using Tiangeng poba gene group DNA extraction kit (DP318-02) Test template is measured DNA using nanodrop, the OD range 1.7~2.0 of DNA, and dilution final concentration is standby to 25ng/ μ l With.

The determination of the best primer and probe of embodiment 4

According to No. 13, No. 18 and No. 21 karyological character sequence of human genome, thought according to the present invention point It She Ji not 20 primer and probe combinations.Utilize the primer pair and probe combinations and system of No. 13, No. 18 and No. 21 chromosome Standby negative control be template carry out PCR reaction (in 20 μ L systems the final concentration of each component be respectively 1 × PCR Buffer, 0.25mM dNTP, 1U/ reaction dna polymerase, 500nM primer, 250nM probe, 25ng template DNA and surplus are water), PCR is anti- Answer condition are as follows: 95 DEG C initial denaturation 10 minutes, one circulation；40 amplification cycles, 95 DEG C are denaturalized 15 seconds, and 60 DEG C are annealed and extend 60 Second, PCR product carries out electrophoresis detection.As a result the primer pair of SEQ ID No:1-SEQ ID No:90 composition and probe combinations amplification High-efficient, band is special.

The determination of the best primer concentration of embodiment 5

Nucleotides sequence column with SEQ ID No:1-SEQ ID No:60 are primer and probe and feminine gender prepared by embodiment 1 Control is that template carries out the different PCR of primer concentration, identical (final concentration of the 1 of each ingredient in 20 μ L systems of remaining component condition × PCR Buffer, 0.25mM dNTP, 1U/ reaction dna polymerase, 100nM probe, 25ng template DNA, surplus is water), draw Object concentration is respectively 20nM, 50nM, 100nM, 200nM and 300nM.PCR reaction condition is same as Example 3, amplified production into Row electroresis appraisal, as a result as shown in Figure 1.From the figure 3, it may be seen that primer concentration has the amplification of purpose band in 20~100nM range, Expanding effect is best when primer concentration is 50nM.

The determination of the best concentration and probe concentration of embodiment 6

Nucleotides sequence column with SEQ ID No:1-SEQ ID No:60 are primer and probe and feminine gender prepared by embodiment 1 Control is the PCR that template carries out different probe concentration, identical (final concentration of the 1 of each ingredient in 20 μ L systems of remaining component condition × PCR Buffer, 0.25mM dNTP, 1U/ reaction dna polymerase, 50nM probe, 25ng template DNA, surplus is water), primer Concentration is respectively 50nM, 100nM and 150nM.PCR reaction condition is same as Example 1, and amplified production carries out electroresis appraisal, knot Fruit is as shown in Figure 4.As shown in Figure 4, concentration and probe concentration has purpose band in 50nM~150nM range, is 50nM in concentration and probe concentration When it is optimal.

The determination of 7 primer and probe of embodiment combination amplification optimal reaction system

With the nucleotides sequence column of SEQ ID No:1-SEQ ID No:60 for primer and probe, with the yin of the preparation of embodiment 1 Property control be template carry out quantitative fluorescent PCR verifying (final concentration of 1 × PCR Buffer of each ingredient in 20 μ L systems, 0.25mM dNTP, 1U/ reaction dna polymerase, 50nM primer, 50nM probe, 25ng template DNA, surplus is water).Fluorescent quantitation PCR reaction condition: 60 DEG C are annealed and are extended 60 seconds, a circulation；95 DEG C initial denaturation 10 minutes, one circulation；40 amplifications follow Ring, 95 DEG C are denaturalized 15 seconds, and 60 DEG C are annealed and extended 60 seconds, as a result as shown in Figure 5.As shown in Figure 5, primer and probe combination amplification Efficiency is best.

The determination of 8 primer and probe of embodiment combination amplification optimal reaction system

It is to draw with the nucleotides sequence column of SEQ ID No:1-SEQ ID No:30 and SEQ ID No:61-SEQ ID No:90 Object and probe are template progress quantitative fluorescent PCR verifying (each ingredient in 20 μ L systems using negative control prepared by embodiment 1 Final concentration of 1 × PCR Buffer, 0.25mM dNTP, 1U/ reaction dna polymerase, 50nM primer, 50nM probe, 25ng template DNA, surplus are water).Quantitative fluorescent PCR reaction condition: 60 DEG C are annealed and are extended 60 seconds, a circulation；95 DEG C of initial denaturations 10 are divided Clock, a circulation；40 amplification cycles, 95 DEG C are denaturalized 15 seconds, and 60 DEG C are annealed and extended 60 seconds, as a result as shown in Figure 6.By Fig. 6 It is found that primer and probe combination amplification efficiency is best.

The method that embodiment 9 carries out Chromosome Analysis using the application kit

Chromosome number is detected by digital pcr, detection method provided by the invention includes

(1) according to the gene order of No. 13, No. 18 and No. 21 chromosome of the mankind, separately design 10 pairs of specific primers and 10 specificity T aqman probes.

(2) pregnant woman blood plasma DNA is extracted

(3) reaction system of digital pcr amplification gene sequence is prepared.

(4) chromosome number is detected by digital pcr and calculates 13,18 and No. 21 chromosome numbers of fetus.Utilize digital pcr FAM the and VIC fluorescence of each reaction member of detection chip, calculates separately the copy number of three chromosome.

The reaction system of digital pcr are as follows:

The reaction condition of the digital pcr is 96 DEG C of initial denaturations 10 minutes；39 60 DEG C of circulation extend 2 minutes, 98 DEG C of changes Property 30 seconds；60 DEG C extend 2 minutes.After reaction in digital pcr detection of platform FAM and VIC fluorescence signal, and pass through QuantStudio^TM 3D AnalysisSuite^TMSoftware calculates the copy number of every chromosome.13rd, 18, No. 21 dye The copy number of colour solid is denoted as A1, B1, C1 respectively, and calculates separately ratio C 1/A1 and C1/B1, is denoted as R1 and R2 respectively.

When R1 and R2 are equal to or are approximately equal to 1, then show that fetal chromosomal is normal；

When R1 and R2 are all larger than or are approximately equal to 1.025, then show that fetus is trisomy 21；

When R1, which is at or about 1, R2, is Less than or equal to about 0.975, then show that fetus is 18 three-bodies；

When R2, which is at or about 1, R1, is Less than or equal to about 0.975, then show that fetus is 13 three-bodies.

All bibliography quoted in this specification and patent application are herein incorporated by reference, just as each Publication or patent application are specifically and individually incorporated herein by reference the same.Although having led to for the purpose being expressly understood that The mode for crossing explanation and embodiment, is described in detail foregoing invention, but under the teachings of the present invention, to ordinary skill people For member, it is obvious that certain changes and modification can be carried out to the present invention without departing from the spirit of appended claims Or range.

Claims

1. a kind of for detecting the kit of foetal chromosome aneuploidy, comprising: according to the mankind No. 13, No. 18 and the 21st Number chromosomal gene sequence, the multipair specific primer of design and a plurality of specificity T aqman probe；And for carrying out number The reaction system of PCR；Wherein the nucleotides sequence of the multipair specific primer and a plurality of specificity T aqman probe is classified as SEQIDNO:1-90。

2. kit as described in claim 1, wherein the multipair specific primer and a plurality of specificity T aqman probe sequence Column be divided into two groups: first groups include SEQIDNO:1-60 nucleotide sequence, second group includes SEQIDNO:1-30,61-90 Nucleotide sequence.

3. the specific primer and Taqman probe, nucleotides sequence for detecting foetal chromosome aneuploidy are classified as SEQIDNO:1-90。

4. it is as claimed in claim 3 for detecting the specific primer and Taqman probe of foetal chromosome aneuploidy, Described in specific primer and Taqman probe be divided into two groups, first group include SEQIDNO:1-60 nucleotide sequence, second Group includes the nucleotide sequence of SEQIDNO:1-30,61-90.