CN107190073A

CN107190073A - Applications of the hsa_circRNA_104907 in the diagnosis, treatment and prognosis of Down syndrome

Info

Publication number: CN107190073A
Application number: CN201710494479.2A
Authority: CN
Inventors: 眭维国; 戴勇; 常燕; 薛雯; 欧明林
Original assignee: 181ST HOSPITAL OF CHINESE PEOPLE'S LIBERATION ARMY
Current assignee: 181ST HOSPITAL OF CHINESE PEOPLE'S LIBERATION ARMY
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2017-09-22
Anticipated expiration: 2037-06-26
Also published as: CN107190073B

Abstract

The invention discloses a kind of new circular rna：Hsa_circRNA_104907, its sequence such as SEQ ID NO：Shown in 1；The RT PCR primers for detecting the circular rna are also further disclosed simultaneously.For normal population, the circular rna expresses notable rising in patient body in Down syndrome, and this expression rising with the correlation on statistical significance.Therefore, the circular rna has the potential as the related biomarker of Down syndrome.

Description

Hsa_circRNA_104907 is in the diagnosis, treatment and prognosis of Down syndrome Using

Technical field

The invention belongs to biological technical field, more particularly to a kind of new ring-type hsa_circRNA_104907 and its should With.

Background technology

Down syndrome (Down Syndrome, DS), i.e. 21- patau syndromes, also referred to as mongolism or Down are comprehensive Simulator sickness, is due to inborn defect class disease caused by No. 21 chromosome abnormality, is most common one in birth defect Plant chromosome aneuploid genetic disease.Pathogenesis based on Down syndrome is still unclear, currently for the disease still There is no effective treatment method, it is to reduce the important means of inborn defect at present that birth, which is intervened, and intervention of being born is depended on Pre-natal diagnosis and Prenatal Screening.Prenatal Screening is main in (15~20 weeks) detection pregnant woman of pregnant early stage (7~12 weeks) and second trimester Examination, Ultrasonic screening, the serological examination of fetomaternal and United screening scheme of certain index including pregnant woman age etc. To assess the risk whether fetus suffers from DS.Traditional pre-natal diagnosis then mainly uses invasive sampling means, including Umbilical cord takes blood, amniocentesis and chorionic villous sampling etc., utilizes DS genetic diagnosis technology, DS Molecular diagnosis technology, glimmering The technologies such as light in situ hybridization (FISH), PCR (QF-PCR) and STR (STR) are entered to fetus sample Row analyzing and diagnosing.However, traditional Prenatal Screening has, recall rate is low, loss is high and lacking for false positive easily occurs in result Point, pre-natal diagnosis is then because the means that intrusive mood is sampled easily produce bleeding, miscarriage or with other complication.

In order to improve the accuracy of Prenatal Screening and the security of pre-natal diagnosis, researchers are exploring new DS always Non-invasive methods for prenatal diagnosis.Non-invasive Prenatal Diagnosis has the advantages that easy, safety and reliable, including female blood tire Youngster's cellular pathways, female blood fetus dissociative DNA approach and female blood fetus dissociative RNA approach.Yet with fetal nucleated cell Genome covers the whole hereditary information of fetus, thus the fetal nucleated cell being present in pregnant woman's circulating becomes initially The research direction of researchers.But the greatest problem that this method is present is fetal nucleated cell content pole in maternal blood It is few, it is impossible to reach the requirement of analyzing and diagnosing, clinical practice is received certain limitation.

In summary, the defect based on traditional Prenatal Screening and pre-natal diagnosis, and existing Non-invasive Prenatal Diagnosis method Deficiency so that explore new non-invasive Down syndrome fetus pre-natal diagnosis mark and have very important significance.

The content of the invention

It is an object of the invention to disclose a kind of new ring-type hsa_circRNA_104907.

The technical solution used in the present invention is：A kind of circular rna is disclosed, its sequence such as SEQ ID NO：Shown in 1.

It is preferred that, the circular rna is detected as Down syndrome, treated, the application of prognosis target spot.

Detection sequence can be quantified for SEQ ID NO by containing in a kind of Down syndrome detection kit, the kit：1 Circular rna reagent.

It is preferred that, it is SEQ ID NO that real time fluorescent quantitative detection sequence is contained in the kit：The primer of 1 circular rna Sequence.

It is preferred that, detection circular rna primer sequence is：

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5).

Quantitative detection sequence is SEQ ID NO：The reagent of 1 circular rna is in Down syndrome detection reagent is prepared Using.

It is preferred that, quantitative detection sequence is SEQ ID NO：The reagent of 1 circular rna is that real time fluorescent quantitative detects the ring Shape RNA primer sequence.

It is further preferred that circular rna primer sequence is：

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5).

The beneficial effects of the invention are as follows：CircRNA disclosed in the present patent application is in Down syndrome patient and normal population Expression has obvious differential expression in vivo, and the clinical assistant diagnosis technology currently used for Down syndrome is not perfect, Therefore the CircRNA has the potential as the related biomarker of Down syndrome.

Embodiment

Embodiment 1

In the research process to Down's syndrome, a kind of circular rna is found, its sequence is：

GTGTGTTCCAGAGAACAAGCCTTCAGACATTTGCTATATTGACGCTGAGCTGTCAGGGGACTCAGGCTTATGAGGAG GTATTGTTACACAAAACAGTGTCTAGTGAAGACGACAAGAAAGAGGGGAAAGGATCGGAAAAAGAAGCTAAAATACT ATAGAAAACCATGAGATCTATTCGATCTTTTGCTAATGATGATCGCCATGTTATGGTGAAACATTCAACAATCTATC CATCTCCGGAGGAACTTGAAGCTGTTCAGAATATGGTATCTACTGTTGAATGTGCTCTTAAACATGTCTCAGATTGG TTGGATGAAACAAATAAAGGCACAAAAACAGAGGGTGAGACAGAAGTGAAGAAAGATGAGGCCGGAGAAAACTATTC CAAGGATCAAGGTGGTCGGACATTGTGTGGTGTAATGAGGATTGGCCTGGTTGCAAAAGGCTTGCTGATTAAAGATG ATATGGACTTGGAGCTGGTTTTAATGTGCAAAGACAAACCCACAGAGACCCTGTTAAATACAGTCAAAGATAATCTT CCTATTCAGATTCAGAAACTCACAGAAGAGAAATATCAAGTGGAACAATGTGTAAATGAGGCATCTATTATAATTCG GAATACAAAAGAGCCCACGCTAACTTTGAAGGTGATACTTACCTCACCTCTAATTAGGGACGAATTGGAGAAGAAGG ATGGAG(SEQ ID NO：1) hsa_circRNA_104907, is named.

The sample of embodiment 2 and processing

12 fetal cord blood specimens are obtained from Shenzhen people's hospital clinic study revenue centre laboratory, wherein Including 6 through G banding chromosome karyotypings be diagnosed as the umbilical cord blood specimen (2 male 4 female) of standard type Down syndrome fetus with And 6 normal fetus Cord bloods (2 male 4 female), pregnant age is 18-22 weeks；12 children peripheral blood specimens are from Guilin City Chinese People PLA the first 81 Army Hospital Guangxi metabolic disease research emphasis laboratory is obtained, and is integrated including 6 Tang Shi Infant periphery blood specimen (2 male 4 female) and 6 healthy children periphery blood specimens (2 male 4 female) are levied, the age is 0-15 Sui.Originally grind Study carefully the approval of Shenzhen people's hospital and Ethics Committee of Army Hospital of PLA of Guilin City first 81, and obtain The informed consent of patient, all subjects are provided which Written informed consent.

RT-PCR technology is respectively adopted to be verified in the peripheral blood of DS infants and healthy children.Simultaneously for checking MRNA corresponding to the circRNA of the otherness change drawn, inventor is examined using RT-PCR technology in peripheral blood Survey.

RT-PCR checking specific experiment step be：

(1) the gradient dilution DNA profiling for drawing standard curve is prepared：

A selects one to determine that the cDNA templates for expressing the gene are entered for each gene and house-keeping gene for needing to measure Performing PCR reacts：

Ttom of pipe is flicked, solution is mixed, the of short duration centrifugations of 5000rpm set PCR to react：95 DEG C, 10min；40 PCR are followed (95 DEG C, 10 seconds of ring；60 DEG C, 60 seconds (collection fluorescence))；

B is by PCR primer and 100bp DNA Ladder in 2% agarose gel electrophoresis, and ethidium bromide staining detects PCR Whether product is single specificity amplified band；

PCR primer is carried out 10 times of gradient dilutions by c：PCR primer concentration is set as 1,1 × 10 is diluted to respectively^-1、1×10^-2、1×10^-3、1×10^-4、1×10^-5、1×10^-6、1×10^-7、1×10^-8、1×10^-9, the DNA of these gradient concentrations.

(2) RT-PCR reactions are carried out：

RT-PCR reaction systems are respectively configured in all cDNA samples by a.System configurations are as follows：

Ttom of pipe is flicked, solution is mixed, 5000rpm, of short duration centrifugation；

B is loaded：

8ul mixed liquors are added in the corresponding each hole of 384-PCR plates, corresponding 2 μ L cDNA are added.Carefully it is stained with Sealing Film sealed membranes, and of short duration centrifugation mixing.Finally, ready PCR plate is placed on ice before PCR programs are set On；

Above-mentioned 384-PCR plates are placed in the enterprising performing PCR of Realtime PCR instruments and reacted by c：

All indexs are carried out by following procedure：95 DEG C, 10min；40 (95 DEG C, 10 seconds of PCR cycles；60 DEG C, 60 seconds (collection fluorescence)).In order to set up the melting curve of PCR primer, after amplified reaction terminates, by (95 DEG C, 10 seconds；60 DEG C, 60 seconds； 95 DEG C, 15 seconds)；And 99 DEG C (instrument carries out-Ramp Rate for 0.05 DEG C/sec automatically) are heated slowly to from 60 DEG C.

(3) result is with calculating：

The sample-adding amount of each sample is 2 μ L during RT-PCR, yet with by RNA concentration quantitatives error and RNA reverse transcriptions effect The influence of rate error etc., its content of the cDNA of 2 μ L volumes of each sample is not fully identical, to correct this difference, uses pipe Family gene β-actin (different sample room expression quantity substantially constants) are as internal reference, with the value of sample testing gene divided by this sample The value of internal reference, the ratio finally given is the testing gene relative amount of sample.

The experimental result of embodiment 3

Using β-actin as internal reference thing, above-mentioned circRNA is tested in peripheral blood with RT-PCR technology respectively Card.PCR primer sequence such as table 1：

Table 1RT-PCR list of primers

Fold differences are calculated using 2- Δ Δ Ct methods, as a result such as table 2.

Table 2circRNA the results

As a result show, compared to healthy population, in Down's syndrome patient, hsa_circRNA_104907 expression quantity Can significantly it raise, the two has obvious positively related relation.

SEQUENCE LISTING

<110>No.181 Hospital, PLA

<120>Applications of the hsa_circRNA_104907 in the diagnosis, treatment and prognosis of Down syndrome

<130>

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 699

<212> DNA

<213> hsa_circRNA_104907

<400> 1

gtgtgttcca gagaacaagc cttcagacat ttgctatatt gacgctgagc tgtcagggga 60

ctcaggctta tgaggaggta ttgttacaca aaacagtgtc tagtgaagac gacaagaaag 120

aggggaaagg atcggaaaaa gaagctaaaa tactatagaa aaccatgaga tctattcgat 180

cttttgctaa tgatgatcgc catgttatgg tgaaacattc aacaatctat ccatctccgg 240

aggaacttga agctgttcag aatatggtat ctactgttga atgtgctctt aaacatgtct 300

cagattggtt ggatgaaaca aataaaggca caaaaacaga gggtgagaca gaagtgaaga 360

aagatgaggc cggagaaaac tattccaagg atcaaggtgg tcggacattg tgtggtgtaa 420

tgaggattgg cctggttgca aaaggcttgc tgattaaaga tgatatggac ttggagctgg 480

ttttaatgtg caaagacaaa cccacagaga ccctgttaaa tacagtcaaa gataatcttc 540

ctattcagat tcagaaactc acagaagaga aatatcaagt ggaacaatgt gtaaatgagg 600

catctattat aattcggaat acaaaagagc ccacgctaac tttgaaggtg atacttacct 660

cacctctaat tagggacgaa ttggagaaga aggatggag 699

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

gtggccgagg actttgattg 20

<210> 3

<211> 23

<212> DNA

<213>Artificial sequence

<400> 3

cctgtaacaa cgcatctcat att 23

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<400> 4

tacaaaagag cccacgctaa ct 22

<210> 5

<211> 22

<212> DNA

<213>Artificial sequence

<400> 5

tgtctgaagg cttgttctct gg 22

Claims

1. a kind of circular rna, its sequence is：

GTGTGTTCCAGAGAACAAGCCTTCAGACATTTGCTATATTGACGCTGAGCTGTCAGGGGACTCAGGCTTATGA GGAGGTATTGTTACACAAAACAGTGTCTAGTGAAGACGACAAGAAAGAGGGGAAAGGATCGGAAAAAGAAGCTAAAA TACTATAGAAAACCATGAGATCTATTCGATCTTTTGCTAATGATGATCGCCATGTTATGGTGAAACATTCAACAATC TATCCATCTCCGGAGGAACTTGAAGCTGTTCAGAATATGGTATCTACTGTTGAATGTGCTCTTAAACATGTCTCAGA TTGGTTGGATGAAACAAATAAAGGCACAAAAACAGAGGGTGAGACAGAAGTGAAGAAAGATGAGGCCGGAGAAAACT ATTCCAAGGATCAAGGTGGTCGGACATTGTGTGGTGTAATGAGGATTGGCCTGGTTGCAAAAGGCTTGCTGATTAAA GATGATATGGACTTGGAGCTGGTTTTAATGTGCAAAGACAAACCCACAGAGACCCTGTTAAATACAGTCAAAGATAA TCTTCCTATTCAGATTCAGAAACTCACAGAAGAGAAATATCAAGTGGAACAATGTGTAAATGAGGCATCTATTATAA TTCGGAATACAAAAGAGCCCACGCTAACTTTGAAGGTGATACTTACCTCACCTCTAATTAGGGACGAATTGGAGAAG AAGGATGGAG(SEQ ID NO：1).

2. the circular rna described in claim 1 is detected as Down syndrome, treated, the application of prognosis target spot.

3. a kind of Down syndrome detection kit, it is characterised in that test right requirement 1 can be quantified by containing in the kit The reagent of described circular rna.

4. Down syndrome detection kit according to claim 3, it is characterised in that containing glimmering in real time in the kit The primer sequence of circular rna described in the quantitative test right requirement 1 of light.

5. Down syndrome detection kit according to claim 4, it is characterised in that the circular rna primer sequence It is：

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5).

6. application of the reagent of circular rna in Down syndrome detection reagent is prepared described in quantitative test right requirement 1.

7. application according to claim 6, it is characterised in that the reagent of circular rna is described in quantitative test right requirement 1 The primer sequence of circular rna described in real time fluorescent quantitative test right requirement 1.

8. application according to claim 7, it is characterised in that the circular rna primer sequence is：

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5).