CN107190073B

CN107190073B - Application of hsa _ circRNA _104907 in diagnosis, treatment and prognosis of Down syndrome

Info

Publication number: CN107190073B
Application number: CN201710494479.2A
Authority: CN
Inventors: 眭维国; 戴勇; 常燕; 薛雯; 欧明林
Original assignee: 181st Hospital Of Chinese Pla
Current assignee: 181st Hospital Of Chinese Pla
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2020-12-15
Anticipated expiration: 2037-06-26
Also published as: CN107190073A

Abstract

The invention discloses a novel circular RNA: hsa _ circRNA _104907 having the sequence of SEQ ID NO: 1 is shown in the specification; also discloses RT-PCR primer for detecting the circular RNA. The expression of the circular RNA is significantly elevated in patients with Down syndrome compared to the normal population, and the elevation of expression is statistically relevant. Thus, the circular RNA has the potential to be a biomarker associated with down syndrome.

Description

Application of hsa _ circRNA _104907 in diagnosis, treatment and prognosis of Down syndrome

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a novel annular hsa _ circRNA _104907 and application thereof.

Background

Down Syndrome (DS), also known as Syndrome of 21-trisomy, is a birth defect type disease caused by chromosome 21 abnormality, and is the most common genetic disease of chromosome aneuploidy in birth defect diseases. Based on the unclear pathogenesis of Down syndrome, no effective treatment method for the disease exists at present, the birth intervention is an important means for reducing birth defects at present, and the birth intervention mainly depends on prenatal diagnosis and prenatal screening. The prenatal screening mainly detects certain indexes of the pregnant woman in the early pregnancy (7-12 weeks) and the middle pregnancy (15-20 weeks) and comprises screening of the age of the pregnant woman, ultrasonic screening, screening of fetal maternal serology, a combined screening scheme and the like so as to evaluate whether the fetus is at risk of DS. The traditional prenatal diagnosis mainly adopts invasive sampling means, including umbilical cord blood sampling, amniocentesis, chorionic villus sampling and the like, and uses the technologies of DS genetic diagnosis technology, DS molecular diagnosis technology, Fluorescence In Situ Hybridization (FISH), polymeric chain reaction (QF-PCR), Short Tandem Repeat (STR) and the like to analyze and diagnose the fetal sample. However, conventional prenatal screening has the disadvantages of low detection rate, high missed detection rate and false positive results, and prenatal diagnosis is prone to bleeding, abortion or other complications due to invasive sampling.

In order to improve the accuracy of prenatal screening and the safety of prenatal diagnosis, researchers have been exploring new DS non-invasive prenatal diagnostic methods. Noninvasive prenatal diagnosis has the advantages of simplicity, safety, reliability and the like, wherein the noninvasive prenatal diagnosis comprises a maternal-fetal cell pathway, a maternal-fetal free DNA pathway and a maternal-fetal free RNA pathway. However, since the genome in fetal nucleated cells covers the entire genetic information of the fetus, fetal nucleated cells present in the circulating blood of pregnant women have been the subject of research by the original researchers. However, the greatest problem of this method is that the fetal nucleated cells are very low in maternal blood content and cannot meet the requirements of analysis and diagnosis, and finally, the clinical application is limited.

In conclusion, based on the defects of the traditional prenatal screening and prenatal diagnosis and the defects of the existing noninvasive prenatal diagnosis method, the method has very important significance for exploring a new noninvasive Down syndrome fetal prenatal diagnosis marker.

Disclosure of Invention

The invention aims to disclose a novel circular hsa _ circRNA _ 104907.

The technical scheme adopted by the invention is as follows: discloses a circular RNA, the sequence of which is shown as SEQ ID NO: 1 is shown.

Preferably, the circular RNA is used as a target for detecting, treating and prognosing Down syndrome.

A Down syndrome detection kit contains a nucleic acid sequence which can be quantitatively detected and sequenced as SEQ ID NO: 1 in the above paragraph.

Preferably, the kit contains a real-time fluorescent quantitative detection sequence of SEQ ID NO: 1, or a primer sequence of the circular RNA.

Preferably, the sequence of the primer for detecting circular RNA is:

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5)。

the quantitative detection sequence is SEQ ID NO: 1 in the preparation of a down syndrome detection reagent.

Preferably, the quantitative detection sequence is SEQ ID NO: 1 is a primer sequence for real-time fluorescent quantitative detection of the circular RNA.

Further preferably, the circular RNA primer sequence is:

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5)。

the invention has the beneficial effects that: the expression of the CircRNA disclosed by the application of the invention has obvious expression difference in the bodies of patients with Down syndrome and normal people, and the current clinical auxiliary diagnosis technology for Down syndrome is not perfect, so that the CircRNA has the potential of being used as a biomarker related to Down syndrome.

Detailed Description

Example 1

During the research on Down syndrome, a circular RNA is found, whose sequence is:

GTGTGTTCCAGAGAACAAGCCTTCAGACATTTGCTATATTGACGCTGAGCTGTCAGGGGACTCAGGCTTATGAGGAGGTATTGTTACACAAAACAGTGTCTAGTGAAGACGACAAGAAAGAGGGGAAAGGATCGGAAAAAGAAGCTAAAATACTATAGAAAACCATGAGATCTATTCGATCTTTTGCTAATGATGATCGCCATGTTATGGTGAAACATTCAACAATCTATCCATCTCCGGAGGAACTTGAAGCTGTTCAGAATATGGTATCTACTGTTGAATGTGCTCTTAAACATGTCTCAGATTGGTTGGATGAAACAAATAAAGGCACAAAAACAGAGGGTGAGACAGAAGTGAAGAAAGATGAGGCCGGAGAAAACTATTCCAAGGATCAAGGTGGTCGGACATTGTGTGGTGTAATGAGGATTGGCCTGGTTGCAAAAGGCTTGCTGATTAAAGATGATATGGACTTGGAGCTGGTTTTAATGTGCAAAGACAAACCCACAGAGACCCTGTTAAATACAGTCAAAGATAATCTTCCTATTCAGATTCAGAAACTCACAGAAGAGAAATATCAAGTGGAACAATGTGTAAATGAGGCATCTATTATAATTCGGAATACAAAAGAGCCCACGCTAACTTTGAAGGTGATACTTACCTCACCTCTAATTAGGGACGAATTGGAGAAGAAGGATGGAG (SEQ ID NO: 1), which is designated hsa _ circRNA _ 104907.

Example 2 samples and treatment

12 cases of fetal umbilical cord blood specimens are obtained from laboratories of the clinical medicine research center of Min Hospital, Shenzhen, wherein 6 cases of umbilical cord blood specimens (2 men and 4 women) of fetuses with standard Down syndrome confirmed by G banding chromosome karyotype analysis and 6 cases of normal fetal umbilical cord blood (2 men and 4 women) are obtained, and the gestational ages are 18-22 weeks; 12 samples of peripheral blood of children were obtained from the key laboratory of metabolic disease research in Guangxi, the first eight team hospital, the liberation army of Chinese people in Guilin, including 6 samples of peripheral blood of children with Down syndrome (2 men and 4 women) and 6 samples of peripheral blood of healthy children (2 men and 4 women), all ages 0-15 years old. The study has been approved by ethical committees of people's hospitals in Shenzhen city and the first eight military hospitals of the liberation military in Guilin city, and all received informed consent from patients, and all subjects provided written informed consent.

The test was carried out in peripheral blood of DS children and healthy children by RT-PCR technique. Meanwhile, for mRNA corresponding to circRNA with different changes verified, the inventor adopts RT-PCR technology to detect in peripheral blood.

The RT-PCR verification comprises the following specific experimental steps:

(1) preparation of gradient diluted DNA template for standard curve drawing:

a, selecting a cDNA template which is determined to express the gene to carry out PCR reaction aiming at each gene to be measured and housekeeping gene:

flicking the bottom of the tube, mixing the solution, centrifuging briefly at 5000rpm, and setting PCR reaction: at 95 ℃ for 10 min; 40 PCR cycles (95 ℃, 10 sec; 60 ℃, 60 sec (fluorescence collection));

b, performing electrophoresis on the PCR product and 100bp DNA Ladder on 2% agarose gel, staining by ethidium bromide, and detecting whether the PCR product is a single specificity amplification band;

c 10-fold gradient dilution of PCR products: setting the concentration of PCR product to1, respectively diluted to 1X 10^-1、1×10^-2、1×10^-3、1×10^-4、1×10^-5、1×10^-6、1×10^-7、1×10^-8、1×10^-9Several gradients of DNA.

(2) Performing RT-PCR reaction:

a, respectively configuring all cDNA samples into an RT-PCR reaction system. The system is configured as follows:

flicking the bottom of the tube, mixing the solution, 5000rpm, and centrifuging for a short time;

b, loading sample:

8ul of the mixture was added to each well of the 384-PCR plate, followed by 2. mu.L of the corresponding cDNA. Sealing Film Sealing Film was carefully glued on and briefly mixed by centrifugation. Finally, the prepared PCR plate was placed on ice before setting up the PCR program;

c, placing the 384-PCR plate on a Realtime PCR instrument for PCR reaction:

all the indexes were carried out according to the following procedures: at 95 ℃ for 10 min; 40 PCR cycles (95 ℃, 10 sec; 60 ℃, 60 sec (fluorescence collection)). In order to establish the melting curve of the PCR product, after the amplification reaction is finished, the temperature is controlled according to the formula (95 ℃, 10 seconds, 60 ℃, 60 seconds, 95 ℃, 15 seconds); and slowly heated from 60 ℃ to 99 ℃ (instrument auto-run-Ramp Rate 0.05 ℃/sec).

(3) And (3) result and calculation:

the sample adding amount of each sample is 2 mu L during RT-PCR, however, because of the influence of RNA concentration quantitative error, RNA reverse transcription efficiency error and the like, the cDNA content of 2 mu L volume of each sample is not completely the same, in order to correct the difference, housekeeping gene beta-actin (the expression amount among different samples is basically constant) is used as an internal reference, the value of the gene to be detected of the sample is divided by the value of the internal reference of the sample, and the ratio obtained finally is the relative content of the gene to be detected of the sample.

Example 3 results of the experiment

The circRNA was verified in peripheral blood by RT-PCR using beta-actin as an internal reference. The PCR primer sequences are shown in Table 1:

TABLE 1RT-PCR primer List

The fold difference was calculated by the 2-. DELTA.Ct method, and the results are shown in Table 2.

TABLE 2circRNA validation results

The results show that the expression level of hsa _ circRNA _104907 is obviously increased in Down syndrome patients compared with that of healthy people, and the expression level are in a positive correlation.

SEQUENCE LISTING

<110> the first eight hospitals of the people liberation force of China

<120> use of hsa _ circRNA _104907 in the diagnosis, treatment and prognosis of Down syndrome

<130>

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 699

<212> DNA

<213> hsa_circRNA_104907

<400> 1

gtgtgttcca gagaacaagc cttcagacat ttgctatatt gacgctgagc tgtcagggga 60

ctcaggctta tgaggaggta ttgttacaca aaacagtgtc tagtgaagac gacaagaaag 120

aggggaaagg atcggaaaaa gaagctaaaa tactatagaa aaccatgaga tctattcgat 180

cttttgctaa tgatgatcgc catgttatgg tgaaacattc aacaatctat ccatctccgg 240

aggaacttga agctgttcag aatatggtat ctactgttga atgtgctctt aaacatgtct 300

cagattggtt ggatgaaaca aataaaggca caaaaacaga gggtgagaca gaagtgaaga 360

aagatgaggc cggagaaaac tattccaagg atcaaggtgg tcggacattg tgtggtgtaa 420

tgaggattgg cctggttgca aaaggcttgc tgattaaaga tgatatggac ttggagctgg 480

ttttaatgtg caaagacaaa cccacagaga ccctgttaaa tacagtcaaa gataatcttc 540

ctattcagat tcagaaactc acagaagaga aatatcaagt ggaacaatgt gtaaatgagg 600

catctattat aattcggaat acaaaagagc ccacgctaac tttgaaggtg atacttacct 660

cacctctaat tagggacgaa ttggagaaga aggatggag 699

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

gtggccgagg actttgattg 20

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

cctgtaacaa cgcatctcat att 23

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

tacaaaagag cccacgctaa ct 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

tgtctgaagg cttgttctct gg 22

Claims

1. A circular RNA having the sequence:

GTGTGTTCCAGAGAACAAGCCTTCAGACATTTGCTATATTGACGCTGAGCTGTCAGGGGACTCAGGCTTATGAGGAGGTATTGTTACACAAAACAGTGTCTAGTGAAGACGACAAGAAAGAGGGGAAAGGATCGGAAAAAGAAGCTAAAATACTATAGAAAACCATGAGATCTATTCGATCTTTTGCTAATGATGATCGCCATGTTATGGTGAAACATTCAACAATCTATCCATCTCCGGAGGAACTTGAAGCTGTTCAGAATATGGTATCTACTGTTGAATGTGCTCTTAAACATGTCTCAGATTGGTTGGATGAAACAAATAAAGGCACAAAAACAGAGGGTGAGACAGAAGTGAAGAAAGATGAGGCCGGAGAAAACTATTCCAAGGATCAAGGTGGTCGGACATTGTGTGGTGTAATGAGGATTGGCCTGGTTGCAAAAGGCTTGCTGATTAAAGATGATATGGACTTGGAGCTGGTTTTAATGTGCAAAGACAAACCCACAGAGACCCTGTTAAATACAGTCAAAGATAATCTTCCTATTCAGATTCAGAAACTCACAGAAGAGAAATATCAAGTGGAACAATGTGTAAATGAGGCATCTATTATAATTCGGAATACAAAAGAGCCCACGCTAACTTTGAAGGTGATACTTACCTCACCTCTAATTAGGGACGAATTGGAGAAGAAGGATGGAG(SEQ ID NO：1)。

2. a Down syndrome detection kit comprising a reagent capable of quantitatively detecting the circular RNA according to claim 1.

3. The Down syndrome detection kit of claim 2, wherein the kit comprises a primer sequence for real-time fluorescent quantitative detection of the circular RNA of claim 1.

4. The Down syndrome detection kit of claim 3, wherein the primer sequence of the circular RNA is:

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5)。

5. use of a reagent for quantitatively detecting the circular RNA as claimed in claim 1 in the preparation of a detection reagent for Down syndrome.

6. The use according to claim 5, wherein the reagent for quantitative determination of the circular RNA of claim 1 is a primer sequence for real-time fluorescent quantitative determination of the circular RNA of claim 1.

7. The use according to claim 6, wherein said primer sequence of said circular RNA is:

F：5’-TACAAAAGAGCCCACGCTAACT-3’(SEQ ID NO：4)；

R：5’-TGTCTGAAGGCTTGTTCTCTGG-3’(SEQ ID NO：5)。