CN109355380A - Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality - Google Patents
Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality Download PDFInfo
- Publication number
- CN109355380A CN109355380A CN201811635612.2A CN201811635612A CN109355380A CN 109355380 A CN109355380 A CN 109355380A CN 201811635612 A CN201811635612 A CN 201811635612A CN 109355380 A CN109355380 A CN 109355380A
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- chromosome
- primer
- sites
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of primer, kit and detection methods for detecting maternal peripheral blood chromosome abnormality.The primer includes the corresponding primer pair of gene expanded on target chromosome.The kit includes primer combination, probe combinations, PCR reaction solution and Taq polymerase above-mentioned.The detection method includes: to mix the cfDNA of peripheral blood sample to be detected with PCR reaction solution using drop microreactor, and generate multiple digital PCR reaction solution drop；Pcr amplification reaction is carried out to drop using aforementioned agents box, and determines the multiple of target chromosome according to the ratio of the positive number of sites of ALEXAFLUOR488 signal and the positive number of sites of HEX signal.The present invention can carry out that extreme early screening, sample requirement amount are few, only need that the plasma sample of 2mL, operating process are simple and quick, detection cycle is short and data analyze intuitive and convenient and low in cost to 8-10 week pregnant woman using multiple digital round pcr.
Description
Technical field
The present invention relates to outside medicine and biology techniques field, more particularly to a kind of multiple digital round pcr detection parent
Primer, probe, the kit of all blood chromosome abnormalities, and the side using kit detection maternal peripheral blood chromosome abnormality
Method.
Background technique
Prenatal diagnosis refer to it is common include 21- patau syndrome (Down syndrome or mongolism),
E trisomy (Edward's syndrome), 13- patau syndrome (pa pottery Cotard) and X, Y sex chromosome are non-whole
Times body etc., there is presently no the effective ways for treating the chromosomal disorders.Prenatal Screening and pre-natal diagnosis are current eugenic weights
Task is wanted, while being also the important means for preventing chromosome aneuploid fetal birth.As pregnant woman blood plasma middle reaches isolated human fetal is de-
Oxygen ribonucleic acid (cfDNA) is found, and the fast development of gene next generation's high throughput sequencing technologies makes the analytical technology of cfDNA
Promote the good development of antenatal noninvasive genetic test (NIPT).
With the popularization and application of NIPT (noninvasive antenatal detection) technology, more and more high risks and medium risk pregnant woman choosing
It selects using this noninvasive antenatal DNA detection technique, carries out the screening of fetal Down syndrome, and NIPT mostly uses high pass now
It measures sequence and information analysis techniques realizes that relative cost is higher, and process is complicated, detection cycle is long.
Digital pcr (digital PCR dPCR) is the novel nucleic acid molecule quantitative technique to grow up early 20th century, is led to
It crosses minim DNA molecule limiting dilution and liquid separation, each reaction chamber is made averagely to contain one or zero target molecule, all reactions
Room is quantified after carrying out monomolecular amplification by analysis of fluorescence signal.Due to its cycle threshold independent of amplification curve
(CT), it need not also use reference gene and standard curve, compared with general measure round pcr, there is higher accuracy, sensitive
Property and repeatability, tumor marker early detection, virus load detect etc. fields be widely applied.The detection of prenatal foetal science of heredity
It is the important component for preventing birth defect, traditional Interventional pre-natal diagnosis such as villus punctures, amniocentesis and navel are quiet
There are 1%~3% risk of miscarriage for arteries and veins puncture, and are unavoidably mixed into maternal tissue when prenatal foetal tissue sampling, affect
The accuracy of fetal genetic material diagnosis；Though noninvasive pre-natal diagnosis can avoid risk of miscarriage, pregnant early stage fetus dissociative DNA
(cfDNA) content is low, and the presence of a large amount of mother body D NA proposes high requirement to nucleic acid extraction technology and inspection technology, and digital pcr
Have the characteristics that recognize a small amount of target molecule in a large amount of background moleculars, be applied to noninvasive pre-natal diagnosis, there is easy to operate, detection
Time short and at low cost advantage.
Currently, the existing product for being applied to fetal chromosomal Tang Shi screening in detection maternal peripheral blood is mainly applied to
NGS platform, rely on NGS platform development chromosome abnormality detection kit existing for major defect be sample requirement amount it is more, one
As need the plasma sample of 4mL or so, operating process it is tediously long it is complicated, personnel requirement is high, detection cycle is long, needs special data
Analysis personnel and expensive, entire detection process needs several days time, and requires the pregnant time of pregnant woman at 12 weeks or so,
Using having greater limitations.
Summary of the invention
The main object of the present invention provides a kind of drawing for detection maternal peripheral blood chromosome abnormality aiming at the above status
Object, probe, to overcome deficiency in the prior art.
Another main purpose of the invention is to provide a kind of kit for detecting maternal peripheral blood chromosome abnormality.
Another object of the present invention also resides in the use for providing aforementioned agents box in detection maternal peripheral blood chromosome abnormality
On the way.
Another object of the present invention, which also resides in, provides a kind of detection method of maternal peripheral blood chromosome abnormality.
For realization aforementioned invention purpose, the technical solution adopted by the present invention includes:
The embodiment of the invention provides a kind of primer combinations for detecting maternal peripheral blood chromosome abnormality comprising amplification mesh
The corresponding primer pair of gene on chromosome is marked, the sequence of each primer is respectively such as SEQ ID NO.1~10 institute in the primer pair
Show.
Further, the gene on the target chromosome include BACE2, BRWD1, C21orf119, CBR1 and
COL6A2。
Further, the sequence of the forward primer of BACE2 is expanded as shown in SEQ ID NO.1, and the sequence of reverse primer is such as
Shown in SEQ ID NO.2, the sequence of the forward primer of BRWD1 is expanded as shown in SEQ ID NO.3, the sequence of reverse primer is such as
Shown in SEQ ID NO.4, the sequence of the forward primer of C21orf119 is expanded as shown in SEQ ID NO.5, the sequence of reverse primer
As shown in SEQ ID NO.6, the sequence of the forward primer of CBR1 is expanded as shown in SEQ ID NO.7, the sequence of reverse primer is such as
Shown in SEQ ID NO.8, the sequence of the forward primer of COL6A2 is expanded as shown in SEQ ID NO.9, the sequence of reverse primer is such as
Shown in SEQ ID NO.10.
The embodiment of the invention also provides a kind of probe combinations for detecting maternal peripheral blood chromosome abnormality comprising target
The corresponding Taqman probe of gene on chromosome, the sequence of the Taqman probe is respectively such as SEQ ID NO.11~15 institute
Show.
Further, for the sequence of the corresponding Taqman probe of BACE2 as shown in SEQ ID NO.11, BRWD1 is corresponding
The sequence of Taqman probe is as shown in SEQ ID NO.12, the sequence such as SEQ ID of the corresponding Taqman probe of C21orf119
Shown in NO.13, the sequence of the corresponding Taqman probe of CBR1 is as shown in SEQ ID NO.14, the corresponding Taqman probe of COL6A2
Sequence as shown in SEQ ID NO.15.
The embodiment of the invention also provides it is a kind of detect maternal peripheral blood chromosome abnormality kit, it includes: it is aforementioned
Detection maternal peripheral blood chromosome abnormality primer combination, it is above-mentioned detection maternal peripheral blood chromosome abnormality probe groups
Conjunction, PCR reaction solution and Taq polymerase.
In some embodiments, the kit also includes: the corresponding primer pair of gene on amplification control chromosome, institute
The sequence of each primer in primer pair is stated respectively as shown in NO.16~25 SEQ ID；
And the corresponding Taqman probe of gene on control chromosome, the sequence of the Taqman probe is respectively such as SEQ
Shown in NO.26~30 ID.
The embodiment of the invention also provides kits above-mentioned in the product of preparation detection maternal peripheral blood chromosome abnormality
In purposes.
Further, include: using the method for the product testing maternal peripheral blood chromosome abnormality
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution
Drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive of ALEXA FLUOR488 signal
The positive number of sites of number of sites and HEX signal, and according to the sun of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of property number of sites determines the multiple of target chromosome.
The embodiment of the invention also provides a kind of products comprising aforementioned agents box, and the products application is in outside detection parent
The method of all blood chromosome abnormalities, which comprises
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution
Drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive of ALEXA FLUOR488 signal
The positive number of sites of number of sites and HEX signal, and according to the sun of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of property number of sites determines the multiple of target chromosome.
Compared with prior art, the invention has the advantages that
It is detected in a kind of extreme early provided by the invention, safe noninvasive, accurate slave maternal peripheral blood quickly, economic
Primer, reagent and the detection method of fetal Down syndrome, using multiple digital round pcr, to pregnant woman's pregnant time require compared with
Short, 8-10 weeks pregnant woman can carry out the plasma sample that extreme early screening, sample requirement amount is few, only needs 2mL, operating process letter
List is quickly, detection cycle is short and data analyze intuitive and convenient and cost is the half of NGS method, can complete in 2 days noninvasive
Antenatal extreme early screening.
Detailed description of the invention
Fig. 1 is that a kind of multiple digital round pcr detection maternal peripheral blood chromosome is different in a typical embodiments of the invention
Normal testing result schematic diagram.
Specific embodiment
More detailed explanation will hereafter be made to technical solution of the present invention.It is understood, however, that in model of the present invention
In enclosing, above-mentioned each technical characteristic of the invention and it is ok between each technical characteristic specifically described in below (e.g. embodiment)
It is combined with each other, to form a new or preferred technical solution.Due to space limitations, I will not repeat them here.
The present invention will be further described according to specific example, but it is only that illustrative purpose is restricted without playing
Effect.
Before being described to example, it is necessary to which some remarks explanations are provided:
The difference that will cause experimental result using the reagent of different manufacturers, different batches, belongs to normal phenomenon.
When carrying out small scale experiments, to guarantee the repeatability between parallel laboratory test, it is proposed that after configuration reagent, mix well simultaneously
Packing, to guarantee the homogeneity of each experiment reagent.
The one aspect of the embodiment of the present invention provides a kind of primer combination for detecting maternal peripheral blood chromosome abnormality,
Including expanding the corresponding primer pair of gene on target chromosome, the sequence of each primer is respectively such as SEQ ID in the primer pair
Shown in NO.1~10.
Further, the target chromosome is No. 21 chromosomes.
Further, the gene on the target chromosome include BACE2, BRWD1, C21orf119, CBR1 and
COL6A2。
Further, the sequence of the forward primer of BACE2 is expanded as shown in SEQ ID NO.1, the sequence of reverse primer
As shown in SEQ ID NO.2, the sequence of the forward primer of BRWD1 is expanded as shown in SEQ ID NO.3, the sequence of reverse primer is such as
Shown in SEQ ID NO.4, the sequence of the forward primer of C21orf119 is expanded as shown in SEQ ID NO.5, the sequence of reverse primer
As shown in SEQ ID NO.6, the sequence of the forward primer of CBR1 is expanded as shown in SEQ ID NO.7, the sequence of reverse primer is such as
Shown in SEQ ID NO.8, the sequence of the forward primer of COL6A2 is expanded as shown in SEQ ID NO.9, the sequence of reverse primer is such as
Shown in SEQ ID NO.10.
The other side of the embodiment of the present invention additionally provides a kind of probe groups for detecting maternal peripheral blood chromosome abnormality
It closes comprising the corresponding Taqman probe of gene on target chromosome, the sequence of the Taqman probe is respectively such as SEQ ID
Shown in NO.11~15.
Further, the target chromosome is No. 21 chromosomes.
Further, the gene on the target chromosome include BACE2, BRWD1, C21orf119, CBR1 and
COL6A2。
Further, for the sequence of the corresponding Taqman probe of BACE2 as shown in SEQ ID NO.11, BRWD1 is corresponding
The sequence of Taqman probe is as shown in SEQ ID NO.12, the sequence such as SEQ ID of the corresponding Taqman probe of C21orf119
Shown in NO.13, the sequence of the corresponding Taqman probe of CBR1 is as shown in SEQ ID NO.14, the corresponding Taqman probe of COL6A2
Sequence as shown in SEQ ID NO.15.
Further, the corresponding Taqman probe of gene on the target chromosome is using ALEXA FLUOR 488
Fluorescent marker.
Wherein specifically, the primer and probe sequence of target chromosomal gene of the invention is as follows:
The other side of the embodiment of the present invention additionally provides a kind of kit for detecting maternal peripheral blood chromosome abnormality,
It includes: the primer combination of detection maternal peripheral blood chromosome abnormality above-mentioned, detection maternal peripheral blood chromosome above-mentioned are different
Normal probe combinations, PCR reaction solution and Taq polymerase.
In some embodiments, the kit also includes: the corresponding primer pair of gene on amplification control chromosome, institute
The sequence of each primer in primer pair is stated respectively as shown in NO.16~25 SEQ ID；
And the corresponding Taqman probe of gene on control chromosome, the sequence of the Taqman probe is respectively such as SEQ
Shown in NO.26~30 ID.
Further, the control chromosome includes No. 1 chromosome and No. 2 chromosomes.
Further, the gene on the control chromosome includes ACTL8, AGT, BAI2, C1orf101 and CAP1.
In some embodiments, the sequence of the forward primer of ACTL8 is expanded as shown in SEQ ID NO.16, reverse primer
Sequence expands the sequence of the forward primer of AGT as shown in SEQ ID NO.18, the sequence of reverse primer as shown in SEQ ID NO.17
Column expand the sequence of the forward primer of BAI2 as shown in SEQ ID NO.20, the sequence of reverse primer as shown in SEQ ID NO.19
Column expand the sequence of the forward primer of C1orf101 as shown in SEQ ID NO.22, reverse primer as shown in SEQ ID NO.21
Sequence as shown in SEQ ID NO.23, expand the sequence of the forward primer of CAP1 as shown in SEQ ID NO.24, reverse primer
Sequence as shown in SEQ ID NO.25.
In some embodiments, for the sequence of the corresponding Taqman probe of ACTL8 as shown in SEQ ID NO.26, AGT is corresponding
Taqman probe sequence as shown in SEQ ID NO.27, the sequence such as SEQ ID NO.28 of the corresponding Taqman probe of BAI2
It is shown, the sequence of the corresponding Taqman probe of C1orf101 as shown in SEQ ID NO.29, the corresponding Taqman probe of CAP1
Sequence is as shown in SEQ ID NO.30.
Further, on the control chromosome the corresponding Taqman probe of gene using HEX fluorescent marker.
Wherein specifically, the primer and probe sequence of control chromosomal gene of the invention is as follows:
| Gene Name | Forward primer | Reverse primer | Taqman probe |
| ACTL8 | acagagtaggctgcggcacc | tcctgaccggagtggtggtt | gacacctttagctaccccatcg |
| AGT | tgagagtacctgtgagcagc | atagccaggcccagctgctg | ttggaccacacagctgacag |
| BAI2 | agtggttagaatggggtccct | agggaagccagccacatct | agtgagaagaggtgtccagcct |
| C1orf101 | ccacccgagagttttccat | cggcctcttgctccgttg | taccttcatgctgctgtcct |
| CAP1 | aggctaacattgaaggtatgt | tcagcgtaacaaattgtg | tgagtgtctgtggcca |
The other side of the embodiment of the present invention additionally provides aforementioned agents box and detects maternal peripheral blood chromosome in preparation
Purposes in abnormal product.
In some embodiments, include: using the method for the product testing maternal peripheral blood chromosome abnormality
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution
Drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive of ALEXA FLUOR488 signal
The positive number of sites of number of sites and HEX signal, and according to the sun of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of property number of sites determines the multiple of target chromosome.
Further, the size of the amplified production of multiplexed PCR amplification of the invention reaction is 75~150bp.
Further, when the ratio of the positive number of sites of the positive number of sites and HEX signal of 488 signal of ALEXA FLUOR
When equal to 1, target chromosome is identical as the control multiple of chromosome in sample to be detected, when ALEXA FLUOR488 signal
When the ratio of the positive number of sites of positive number of sites and HEX signal >=1.15, target chromosome is three times in sample to be detected
Body, it is to be checked as the ratio < 1.15 of the positive number of sites of 488 signal of ALEXA FLUOR and the positive number of sites of HEX signal
Target chromosome is diploid in the sample of survey.
The other side of the embodiment of the present invention additionally provides a kind of product comprising aforementioned agents box, the products application
In the method for detection maternal peripheral blood chromosome abnormality, which comprises
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution
Drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive of ALEXA FLUOR488 signal
The positive number of sites of number of sites and HEX signal, and according to the sun of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of property number of sites determines the multiple of target chromosome.
Further, the size of the amplified production of multiplexed PCR amplification of the invention reaction is 75~150bp.
Further, when the ratio of the positive number of sites of the positive number of sites and HEX signal of 488 signal of ALEXA FLUOR
When equal to 1, target chromosome is identical as the control multiple of chromosome in sample to be detected, when ALEXA FLUOR488 signal
When the ratio of the positive number of sites of positive number of sites and HEX signal >=1.15, target chromosome is three times in sample to be detected
Body, it is to be checked as the ratio < 1.15 of the positive number of sites of 488 signal of ALEXA FLUOR and the positive number of sites of HEX signal
Target chromosome is diploid in the sample of survey.
Wherein, one of case is preferably implemented as one, the present invention provides a kind of for noninvasive antenatal Down's syndreme screening
Method, the specific steps are as follows:
1) 8 weeks pregnant woman of pregnant time are acquired with EDTA anticoagulant tube or Streck Cell-Free DNA heparin tube BCT
Peripheral blood 10mL；
2) pass through centrifugal treating, the red blood cell and leucocyte removed in blood retains upper plasma；
3) cfDNA in upper plasma is extracted；
4) multiple digital pcr reaction mixture is prepared；
5) it is generated using the micro-fluidic chip of the absolute quantitation digital nucleic acid analysis system of efficient drop microreactor multiple
Digital pcr reacts drop；The drop of generation is collected as in 0.2mL PCR reaction tube；
6) PCR reaction tube is put into progress PCR reaction in PCR instrument；
7) include two groups of primer sets in PCR reaction system: the primer and probe of the gene design of target chromosome, probe are adopted
With 488 fluorescent marker of ALEXA FLUOR；Compare the primer and probe of the gene design of chromosome, probe uses HEX fluorescence mark
Note；
8) it is observed with different optical filters, the positive number of sites of record ALEXA FLUOR488 signal is F1 and HEX signal
Positive number of sites be recorded as V1；
9) ratio of F1/V1 is calculated, to determine the multiple of target chromosome；
10) as the ratio of F1/V1 is equal to or is approximately equal to 1, show that the target chromosome of sample to be detected is contaminated with compareing
The multiple of colour solid is identical；
11) such as the ratio of F1/V1 is more than or equal to 1.15, shows that the target chromosome of fetus dissociative DNA in sample to be tested is
Triploid；
12) such as ratio of F1/V1 shows that the target chromosome of fetus dissociative DNA in sample to be tested is two times less than 1.15
Body.
Below in conjunction with attached drawing and several preferred embodiments the technical solution of the present invention is further explained explanation, but its
In experiment condition and setup parameter be not construed as the limitation to basic technical scheme of the present invention.And protection scope of the present invention
It is not limited to the following embodiments.
Embodiment 1
Basic Design theory based on multiple digital pcr detection platform detection maternal blood chromosome abnormality
1. on chromosome (No. 21 chromosome) to be measured in the selection and control chromosome (No. 1 chromosome) of target region to be measured to
The selection for surveying target gene, there are a large amount of SNP, INDEL, tandem repetitive sequence and high CG content areas on the DNA based on chromosome
Domain guarantees the amplification efficiency of primer, during primer and probe design, to avoid these regions as far as possible, according to this original
The target region to be measured on No. 21 chromosomes and No. 1 chromosome has then been determined.
2. the selection of the control target region on target region to be measured and control chromosome on chromosome to be measured, the present invention are to be measured
Physical distance between target gene is greater than 500bp, and on chromosome to be measured target region selection number and the target that compares on chromosome
Regional choice number is identical, and the present invention has selected 1 target region on 5 genes.
3. the annealing region of primer is between 58-62 DEG C, and probe moves back for the primer and probe of target region design
Fiery temperature is between 68-72 DEG C, and between the primer extension product length range 75-150bp of design, and the primer of all designs passes through
Blast analysis, specificity meet the requirements, and by comparing dimer knot will not occur between each other for all 10 pairs of primer and probes
Mispairing is not present between primer for structure.
4. the probe of target region to be measured selects same fluorochrome label, target region to be measured has selected ALEXA in the present invention
5 ' ends of probe are marked in FLUOR488, and 3 ' end quenching groups of probe select MGB, control target region selection in the present invention
5 ' ends of probe are marked in HEX.
5. the primer and probe of all designs is prepared into primed probe mixed liquor, the reaction of primer and probe is final concentration of
0.5uM-2.0uM。
6. preparing PCR reaction solution, the component of PCR reaction solution includes: the Tris-HCl of 50-100mM, and 50-100mM KCl is molten
Liquid, 50-80mM NH4Cl solution, 1.0-2.5mM MgCl2Solution and PCR reinforcing agent.
Embodiment 2
1. taking pregnant time 8 weeks or more maternal blood 10mL in EDTA anticoagulant tube or Streck Cell-Free
In DNA heparin tube BCT, it is mixed by inversion immediately after acquisition ten times；
2.EDTA anticoagulation must be completed within 4 hours blood plasma separation, Streck Cell-Free DNA heparin tube BCT can
With room temperature preservation 14 days；
3. usingCirculatingNucleic AcidKit (Qiagen, cat no.55114, USA) is mentioned
Take cfDNA；
4. preparing PCR reaction mixture: including PCR reaction solution, amplimer mixed liquor, probe mixed liquor, Taq
Archaeal dna polymerase；
5. prepared PCR mixed liquor is mixed with mineral oil and surfactant；
6. being put into the drop formation chip of Suzhou Hui Zhen Biotechnology Co., Ltd；
7. chip being put into the efficient drop microreactor of Suzhou Hui Zhen Biotechnology Co., Ltd and carrying out drop formation；
8. drop formation number range is between 10000-1000000；
9. the drop generated is collected into 8 PCR reaction tubes, PCR reaction tube is put into progress PCR reaction in PCR instrument；
It is as follows that PCR reacts thermal circulation parameters:
10. the drop of PCR after reaction is added in the drop detection chip of Suzhou Hui Zhen Biotechnology Co., Ltd,
And automatically record the positive number of sites of ALEXA FLUOR 488 and the positive number of sites of HEX；
The positive number of sites of 11.ALEXA FLUOR 488 is denoted as F1, and the positive number of sites of HEX is denoted as V1, calculates F1/V1
Ratio, testing result is as shown in Figure 1.
In conclusion by above-mentioned technical proposal, a kind of extreme early provided by the invention, safety it is noninvasive, accurate fast
Primer, reagent and the detection method that fetal Down syndrome is detected in speed, economic slave maternal peripheral blood, using multiple number
Round pcr, pregnant woman's pregnant time is required it is shorter, 8-10 week pregnant woman can carry out extreme early screening, sample requirement amount it is few,
It needs that plasma sample, the operating process of 2mL are simple and quick, detection cycle is short and data analysis intuitive and convenient and cost is NGS
The half of method can complete noninvasive antenatal extreme early screening in 2 days.
It should be appreciated that the technical concepts and features of above-described embodiment only to illustrate the invention, its object is to allow be familiar with this
The personage of item technology cans understand the content of the present invention and implement it accordingly, and it is not intended to limit the scope of the present invention.It is all
Equivalent change or modification made by Spirit Essence according to the present invention, should be covered by the protection scope of the present invention.
Sequence table
<110>Suzhou En Kejin Biotechnology Co., Ltd
<120>primer, kit and the detection method of maternal peripheral blood chromosome abnormality are detected
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 1
tgcgcctgcc ccagaag 17
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 2
cagctttaca ttcagccca 19
<210> 3
<211> 22
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 3
tactcgaaga tgtgcagcta cg 22
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 4
tgtgaaggca agccacctg 19
<210> 5
<211> 17
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 5
tcgcatgaag agcttgc 17
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 6
agacttccgc aaactgat 18
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 7
atgtcgtccg gcatccatgt 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 8
gcatcatgag cgtcagagcc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 9
atgctccagg gcacctgctc 20
<210> 10
<211> 22
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 10
tgaaggagca gggcctgcgg ga 22
<210> 11
<211> 22
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 11
ctggactggg tcccagctgg cg 22
<210> 12
<211> 19
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 12
tgatgtagaa gatgtcagt 19
<210> 13
<211> 16
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 13
tgacttcgac ccctag 16
<210> 14
<211> 17
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 14
agcccgcgct tccacca 17
<210> 15
<211> 23
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 15
ctgcacttct ctgaccaggt gga 23
<210> 16
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 16
acagagtagg ctgcggcacc 20
<210> 17
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 17
tcctgaccgg agtggtggtt 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 18
tgagagtacc tgtgagcagc 20
<210> 19
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 19
atagccaggc ccagctgctg 20
<210> 20
<211> 21
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 20
agtggttaga atggggtccc t 21
<210> 21
<211> 19
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 21
agggaagcca gccacatct 19
<210> 22
<211> 19
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 22
ccacccgaga gttttccat 19
<210> 23
<211> 18
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 23
cggcctcttg ctccgttg 18
<210> 24
<211> 21
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 24
aggctaacat tgaaggtatg t 21
<210> 25
<211> 18
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 25
tcagcgtaac aaattgtg 18
<210> 26
<211> 22
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 26
gacaccttta gctaccccat cg 22
<210> 27
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 27
ttggaccaca cagctgacag 20
<210> 28
<211> 22
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 28
agtgagaaga ggtgtccagc ct 22
<210> 29
<211> 20
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 29
taccttcatg ctgctgtcct 20
<210> 30
<211> 16
<212> DNA
<213>artificial sequence (artificial sequence)
<400> 30
tgagtgtctg tggcca 16
Claims (10)
1. a kind of primer combination for detecting maternal peripheral blood chromosome abnormality, it is characterised in that including on amplification target chromosome
The corresponding primer pair of gene, the sequence of each primer is respectively as shown in NO.1~10 SEQ ID in the primer pair.
2. the primer combination of detection maternal peripheral blood chromosome abnormality according to claim 1, it is characterised in that: the mesh
Mark chromosome is No. 21 chromosomes；Preferably, the gene on the target chromosome include BACE2, BRWD1, C21orf119,
CBR1 and COL6A2；Preferably, the sequence of the forward primer of BACE2 is expanded as shown in SEQ ID NO.1, the sequence of reverse primer
As shown in SEQ ID NO.2, the sequence of the forward primer of BRWD1 is expanded as shown in SEQ ID NO.3, the sequence of reverse primer is such as
Shown in SEQ ID NO.4, the sequence of the forward primer of C21orf119 is expanded as shown in SEQ ID NO.5, the sequence of reverse primer
As shown in SEQ ID NO.6, the sequence of the forward primer of CBR1 is expanded as shown in SEQ ID NO.7, the sequence of reverse primer is such as
Shown in SEQ ID NO.8, the sequence of the forward primer of COL6A2 is expanded as shown in SEQ ID NO.9, the sequence of reverse primer is such as
Shown in SEQ ID NO.10.
3. a kind of probe combinations for detecting maternal peripheral blood chromosome abnormality, it is characterised in that including the gene on target chromosome
Corresponding Taqman probe, the sequence of the Taqman probe is respectively as shown in NO.11~15 SEQ ID.
4. the probe combinations of detection maternal peripheral blood chromosome abnormality according to claim 3, it is characterised in that: the mesh
Mark chromosome is No. 21 chromosomes；Preferably, the gene on the target chromosome include BACE2, BRWD1, C21orf119,
CBR1 and COL6A2；Preferably, for the sequence of the corresponding Taqman probe of BACE2 as shown in SEQ ID NO.11, BRWD1 is corresponding
The sequence of Taqman probe is as shown in SEQ ID NO.12, the sequence such as SEQ ID of the corresponding Taqman probe of C21orf119
Shown in NO.13, the sequence of the corresponding Taqman probe of CBR1 is as shown in SEQ ID NO.14, the corresponding Taqman probe of COL6A2
Sequence as shown in SEQ ID NO.15；Preferably, the corresponding Taqman probe of gene on the target chromosome is to use
ALEXA FLUOR488 fluorescent marker.
5. a kind of kit for detecting maternal peripheral blood chromosome abnormality, it is characterised in that include: any one of claim 1-2
Outside detection parent described in any one of the primer combination of the described detection maternal peripheral blood chromosome abnormality, claim 3-4
Probe combinations, PCR reaction solution and the Taq polymerase of all blood chromosome abnormalities.
6. kit according to claim 5, it is characterised in that also include: the gene on amplification control chromosome is corresponding
Primer pair, the sequence of each primer is respectively as shown in NO.16~25 SEQ ID in the primer pair；
And the corresponding Taqman probe of gene on control chromosome, the sequence of the Taqman probe is respectively such as SEQ ID
Shown in NO.26~30.
7. kit according to claim 6, it is characterised in that: the control chromosome includes No. 1 chromosome and No. 2 dyes
Colour solid；Preferably, the gene on the control chromosome includes ACTL8, AGT, BAI2, C1orf101 and CAP1；Preferably, expand
Increase the sequence of the forward primer of ACTL8 as shown in SEQ ID NO.16, the sequence of reverse primer expands as shown in SEQ ID NO.17
Increase the sequence of the forward primer of AGT as shown in SEQ ID NO.18, the sequence of reverse primer is as shown in SEQ ID NO.19, amplification
The sequence of the forward primer of BAI2 is as shown in SEQ ID NO.20, and the sequence of reverse primer is as shown in SEQ ID NO.21, amplification
The sequence of the forward primer of C1orf101 as shown in SEQ ID NO.22, the sequence of reverse primer as shown in SEQ ID NO.23,
The sequence of the forward primer of CAP1 is expanded as shown in SEQ ID NO.24, the sequence of reverse primer is as shown in SEQ ID NO.25；
Preferably, the sequence of the corresponding Taqman probe of ACTL8 is as shown in SEQ ID NO.26, the sequence of the corresponding Taqman probe of AGT
Column are as shown in SEQ ID NO.27, and the sequence of the corresponding Taqman probe of BAI2 is as shown in SEQ ID NO.28, and C1orf101 pairs
The sequence for the Taqman probe answered is as shown in SEQ ID NO.29, the sequence such as SEQ ID of the corresponding Taqman probe of CAP1
Shown in NO.30；Preferably, on the control chromosome the corresponding Taqman probe of gene using HEX fluorescent marker.
8. kit described in any one of claim 5-7 is in the product of preparation detection maternal peripheral blood chromosome abnormality
Purposes.
9. purposes as claimed in claim 8, which is characterized in that the application product testing maternal peripheral blood chromosome abnormality
Method includes:
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive site of ALEXA FLUOR488 signal
Several and HEX signal positive number of sites, and according to the positive position of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of points determines the multiple of target chromosome；
Preferably, the size of the amplified production of pcr amplification reaction is 75~150bp；
Preferably, when the ratio of the positive number of sites of the positive number of sites and HEX signal of ALEXA FLUOR488 signal is equal to 1
When, target chromosome is identical as the control multiple of chromosome in sample to be detected, when the positive of ALEXA FLUOR488 signal
When the ratio of the positive number of sites of number of sites and HEX signal >=1.15, target chromosome is triploid in sample to be detected, when
When the ratio < 1.15 of the positive number of sites of the positive number of sites and HEX signal of ALEXA FLUOR488 signal, sample to be detected
Target chromosome is diploid in this.
10. a kind of product comprising kit described in any one of claim 5-7, the products application is in outside detection parent
The method of all blood chromosome abnormalities, which comprises
Peripheral blood sample to be detected is provided, and extracts the cfDNA in sample；
It using drop microreactor, mixes the cfDNA with PCR reaction solution, and generates multiple digital PCR reaction solution drop；
Pcr amplification reaction is carried out to the drop using the kit, records the positive site of ALEXA FLUOR488 signal
Several and HEX signal positive number of sites, and according to the positive position of the positive number of sites of ALEXA FLUOR488 signal and HEX signal
The ratio of points determines the multiple of target chromosome；
Preferably, the size of the amplified production of pcr amplification reaction is 75~150bp；
Preferably, when the ratio of the positive number of sites of the positive number of sites and HEX signal of ALEXA FLUOR488 signal is equal to 1
When, target chromosome is identical as the control multiple of chromosome in sample to be detected, when the positive of ALEXA FLUOR488 signal
When the ratio of the positive number of sites of number of sites and HEX signal >=1.15, target chromosome is triploid in sample to be detected, when
When the ratio < 1.15 of the positive number of sites of the positive number of sites and HEX signal of ALEXA FLUOR488 signal, sample to be detected
Target chromosome is diploid in this.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811635612.2A CN109355380A (en) | 2018-12-29 | 2018-12-29 | Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811635612.2A CN109355380A (en) | 2018-12-29 | 2018-12-29 | Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109355380A true CN109355380A (en) | 2019-02-19 |
Family
ID=65329518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811635612.2A Pending CN109355380A (en) | 2018-12-29 | 2018-12-29 | Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109355380A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113643755A (en) * | 2021-08-11 | 2021-11-12 | 上海小海龟科技有限公司 | NIPT kit positive rate correction method, device, computer equipment and medium |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104846103A (en) * | 2015-05-26 | 2015-08-19 | 南京杰蒙生物技术有限公司 | Application of MDPCR (multiple digital PCR (polymerase chain reaction)) technology to chromosome aneuploidy screening |
| CN105695567A (en) * | 2015-11-30 | 2016-06-22 | 北京昱晟达医疗科技有限公司 | Kit, primers, probe sequence and method for detecting fetus chromosome aneuploid |
| CN106191233A (en) * | 2016-07-06 | 2016-12-07 | 上海桀蒙生物技术有限公司 | The test kit of multiple real-time quantitative PCR detection chromosome aneuploid and application thereof |
| CN106715721A (en) * | 2014-09-22 | 2017-05-24 | 豪夫迈·罗氏有限公司 | Design of digital PCR for non-invasive prenatal testing |
| CN108342455A (en) * | 2017-06-25 | 2018-07-31 | 北京天健惠康生物科技有限公司 | A kind of method and its kit detecting fetal aneuploidy chromosome from maternal peripheral blood |
-
2018
- 2018-12-29 CN CN201811635612.2A patent/CN109355380A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106715721A (en) * | 2014-09-22 | 2017-05-24 | 豪夫迈·罗氏有限公司 | Design of digital PCR for non-invasive prenatal testing |
| CN104846103A (en) * | 2015-05-26 | 2015-08-19 | 南京杰蒙生物技术有限公司 | Application of MDPCR (multiple digital PCR (polymerase chain reaction)) technology to chromosome aneuploidy screening |
| CN105695567A (en) * | 2015-11-30 | 2016-06-22 | 北京昱晟达医疗科技有限公司 | Kit, primers, probe sequence and method for detecting fetus chromosome aneuploid |
| CN106191233A (en) * | 2016-07-06 | 2016-12-07 | 上海桀蒙生物技术有限公司 | The test kit of multiple real-time quantitative PCR detection chromosome aneuploid and application thereof |
| CN108342455A (en) * | 2017-06-25 | 2018-07-31 | 北京天健惠康生物科技有限公司 | A kind of method and its kit detecting fetal aneuploidy chromosome from maternal peripheral blood |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113643755A (en) * | 2021-08-11 | 2021-11-12 | 上海小海龟科技有限公司 | NIPT kit positive rate correction method, device, computer equipment and medium |
| CN113643755B (en) * | 2021-08-11 | 2023-10-13 | 上海小海龟科技有限公司 | NIPT kit positive rate correction method, NIPT kit positive rate correction device, computer equipment and medium |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106319032A (en) | Method for measuring activity of Phi29 DNA polymerase and rolling circle sequencing method | |
| CN104651488B (en) | Detect the Amplification thing and quick detection kit of chromosome aneuploid numerical abnormality | |
| CN108998508A (en) | The construction method and primer sets and kit of amplicon sequencing library | |
| Lee et al. | A new approach of digital PCR system for non-invasive prenatal screening of trisomy 21 | |
| CN108342455A (en) | A kind of method and its kit detecting fetal aneuploidy chromosome from maternal peripheral blood | |
| CN105838792A (en) | Primer, probe, kit and method for qualitatively detecting fusion genes of leukemia | |
| CN107016258B (en) | Method for fluorescence quantitative calculation based on recombinase-mediated isothermal nucleic acid amplification (RAA) method | |
| CN110317861A (en) | A kind of kit detecting pathogen | |
| CN105039322A (en) | DNA label sequence, sequencing library construction method and kit | |
| CN104877999A (en) | Liquid phase chip miRNA detection kit | |
| CN109355380A (en) | Detect primer, kit and the detection method of maternal peripheral blood chromosome abnormality | |
| CN110305988A (en) | Pigeon with newcastle disease LAMP-TaqMan detection kit | |
| CN108070636A (en) | A kind of processing method and kit of fluorescent PCR amplified sample | |
| US20180355418A1 (en) | Chromosome number determination method | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN108220450B (en) | Identification method and identification kit for animal-derived components in meat products | |
| CN109790570A (en) | The method for obtaining the single celled base sequence information from vertebrate | |
| CN105624308B (en) | A kind of product that detection chromosome 16p11.2 is micro-deleted | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN106048076A (en) | Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof | |
| CN105950755A (en) | Method for detecting microRNA based on split-type recognition mode and cascade signal amplification strategy | |
| US20180355433A1 (en) | Chromosome number determination method | |
| JPWO2016194552A1 (en) | Multiple target nucleic acid detection kit and detection method using the same | |
| JP6698696B2 (en) | Detection of nucleic acid molecules | |
| CN109266723A (en) | Rare mutation detection method, its kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190219 |
|
| RJ01 | Rejection of invention patent application after publication |