CN106048076A - Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof - Google Patents
Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof Download PDFInfo
- Publication number
- CN106048076A CN106048076A CN201610700306.7A CN201610700306A CN106048076A CN 106048076 A CN106048076 A CN 106048076A CN 201610700306 A CN201610700306 A CN 201610700306A CN 106048076 A CN106048076 A CN 106048076A
- Authority
- CN
- China
- Prior art keywords
- detection
- primer
- site
- seq
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit for clopidogrel personalized medicine related gene SNP detection and a detection method thereof. The kit comprises two forward primers and a reverse primer for detecting gene CYP2C19* 2 locus, and two forward primers and a reverse primer for detecting gene CYP2C19*3 locus. With the kit of the present invention, the two loci can be subjected to the high-throughput detection, and the genotyping result can be intuitively discerned through the software so as to quantitatively control the clopidogrel measurement and minimize the side effect.
Description
Technical field
The present invention relates to test kit and the detection method thereof of multiple gene detection, use in particular for clopidogrel individuation
The test kit of medicine related gene SNP detection and detection method thereof.
Background technology
Clopidogrel is a kind of novel thienopyridine analog derivative, and it is by selective and platelet surface adenosine
The adp receptor of cyclase of acid coupling combines and irreversibly suppresses platelet aggregation, is now widely used for Acute Coronary Syndrome
Levy, complication that ischemic cerebral thrombosis, thromboangiitis obliterans and arteriosclerosis and thromboembolism cause.Cardiac stent is postoperative
Patient needs long-term taking clopidogrel to obstruct with regeneration in preventing support.Clinical research shows that clopidogrel curative effect exists significantly
Individual variation, the patient of 4%～30% takes the clopidogrel of routine dose and can not effectively suppress platelet aggregation to react.
Clopidogrel mainly plays antiplatelet effect after CYP2C19 metabolism activation, and therefore CYP2C19 hereditary variation can
Cause the individual variation of enzymatic activity, make crowd's occur ultra-rapid metabolism person (ultrarapid metabolizer, UM), fast metabolizer
(extensive metabolizer, EM), intermediate supersession person (intermediate metabolizer, IM) and poor metabolizer
(poor metabolizer, PM) 4 kinds of phenotypes.CYP2C19*2 (rs4244285, c.681G > A) and CYP2C19*3
(rs4986893, c.636G > A) is 2 kinds of major allele causing CYP2C19 enzyme defect present in Chinese population.
CYP2C19*2 causes shearing disappearance, and CYP2C19*3 is termination codon sudden change.EM individuality only carries CYP2C19*1 equipotential base
Cause；IM individuality carries CYP2C19*2 or CYP2C19*3 heterozygote genotype；PM individuality includes CYP2C19*2/*2, CYP2C19*
2/*3 and CYP2C19*3/*3 genotype.In the crowd of east, the PM of 75-85% is by caused by CYP2C19*2, the PM of about 20-25% by
Caused by CYP2C19*3.U.S. FDA and ACC's suggestion, metabolic gene type patient slow for CYP2C19 needs to consider
Changing therapeutic scheme, particular view is: CYP2C19*1/*1 genotype individuals application clopidogrel is effective, can conventional use；
Clopidogrel curative effect is reduced by CYP2C19*2 or * 3 genotype individuals, it is proposed that be replaced with prasugrel or Ticagrelor；
CYP2C19*2 or CYP2C19*3 saltant type homozygotic individual application clopidogrel weak effect, it is proposed that use prasugrel instead or for card
Gray.
The method of the most conventional detection gene pleiomorphism has DNA direct sequencing, restriction fragment length polymorphism to divide
Analysis method (PCR-PFLP), high-resolution solubility curve (HRM), gene chip, Luminex, fluorescence quantitative PCR method etc..Order-checking
The goldstandard of the detection gene mutation that technology is well recognized as, but its equipment cost is high, detection cycle length, detection flux are low, detection spirit
Sensitivity technical operation low, to experimenter requires the reasons such as high, result determination step is loaded down with trivial details, it is more difficult to form business-like diagnosis
Product；Restriction fragment length polymorphism analysis method detection sensitivity is the highest, complex operation step, and the result of detection still needs to
The checking again of generation sequencing to be carried out, especially easily causes the cross-contamination of PCR primer and easily goes out when sample size is many
Existing enzyme action is insufficient or enzyme action excessively false negative or false positive results occurs, the most also cannot be applied to clinically.Chip is examined
Surveying because accuracy and the repeatability of its testing result are poor, experimental period, the shortcoming such as length, was also unsuitable for developing clinical detection reagent
Box.The detection method of quantitative fluorescent PCR has low cost, highly sensitive, high specificity, the advantage such as reproducible of result, is
Extraordinary a kind of detection means of detection SNP, but the Taqman sonde method probe Order Cost of routine is the highest, multiple sites
Simultaneously it is difficult to ensure that all primed probe all reach extraordinary expanding effect under same amplification condition during detection.Therefore, anxious
Need to find a kind of simple and easy to do methods of genotyping.
Summary of the invention
The technical problem to be solved is to provide a kind of quick, easy, economic, practical for clopidogrel
The test kit of personalized medicine related gene SNP detection and detection method thereof.
In order to solve above-mentioned technical problem, the technical solution used in the present invention is: a kind of for clopidogrel individuation use
The test kit of medicine related gene SNP detection, including 2X qPCR mixed reaction solution and detection the drawing of gene C YP2C19*2SNP site
Thing mix and the primer mix in detection gene C YP2C19*3SNP site；The primer in described detection gene C YP2C19*2SNP site
Mix contains two specific forward primer and a reverse primer, described detection gene C YP2C19* detecting this SNP site
The primer mix in 3SNP site contains and detects two specific forward primer of this SNP site and a reverse primer；Described detection
Gene C YP2C19*2SNP site two specific forward primer and a reverse primer sequences such as SEQ ID NO.3, SEQ
Shown in ID NO.4, SEQ ID NO.5, described detection gene C YP2C19*3SNP site two specific forward primer and
Article one, reverse primer sequences is as shown in SEQ ID NO.6, SEQ ID NO.7, SEQ IDNO.8.
Buffer, MgCl Han PCR in described 2X qPCR mixed reaction solution2, dNTPs, Taq archaeal dna polymerase, two
Respectively with the universal fluorescent probe of FAM and HEX labelling, the universal fluorescent probe sequence such as SEQ ID NO.1 institute of described FAM labelling
Showing, the universal fluorescent probe sequence of described HEX labelling is as shown in SEQ ID NO.2.
Specifically, comprise the following steps: extract the genomic DNA of sample to be detected, be then divided into 2 reaction tubes a, b and enter
Row detection, is first separately added into 2X qPCR mixed reaction solution in each reaction tube, then adds detection at the first reaction tube a
The primer mix in gene C YP2C19*2SNP site；The primer in detection gene C YP2C19*3SNP site is added at the second reaction tube b
Mix, finally adds the genomic DNA of sample to be detected in 2 reaction tubes a, b, and the quantitative fluorescent PCR carrying out sample of nucleic acid expands
Increase, carry out the scanning of fluorescence signal at 37 DEG C, use in LightCycler 480Softwarerelease software
Endpiont Genotyping module, intensity and ratio according to two kinds of fluorescence signals carry out automatic interpretation to genotype.
Described PCR amplification program is as follows:
The condition of denaturation is: temperature is 94 DEG C, and the time is 15 seconds；
PCR amplification is made up of first stage and second stage；
First stage is made up of 10 amplification cycles, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: initial temperature is 61 DEG C, each takes turns amplification cycles lapse of temperature 0.5 DEG C, until amplification cycles knot
Bundle, the time is 60 seconds；
Second stage is taken turns circulation by 29 and is constituted, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: temperature is 55 DEG C, and the time is 60 seconds；
Signal scanning condition is: temperature is 37 DEG C, and the time is 60 seconds.
The invention has the beneficial effects as follows: the test kit of the present invention can be quick, easy, economic, practical to gene type, and
And by with generation sequencing technologies testing result comparison, result goodness of fit is up to more than 99%, is expected to divide at clinical rapid gene
Type is used widely.Solve that other detection techniques existing are expensive, inefficiency and the highest problem of flux.
Accompanying drawing explanation
Fig. 1 be two specific forward primer using the detection gene C YP2C19*2 site in test kit of the present invention with
Article one, the reverse primer testing result figure to four samples.
Fig. 2 is the generation order-checking (Sanger of six samples to be tested of 1-1,1-2,1-3,1-4,1-5,1-6 shown in Fig. 1
Order-checking) figure.
Fig. 3 be two specific forward primer using the detection gene C YP2C19*3 site in test kit of the present invention with
Article one, the reverse primer testing result figure to four samples.
Fig. 4 is generation order-checking (Sanger order-checking) figure of tetra-samples to be tested of 2-1,2-2,2-3,2-4 shown in Fig. 3.
Detailed description of the invention
With detailed description of the invention, the present invention is described in further detail below in conjunction with the accompanying drawings:
The present invention is used for test kit and the detection method thereof of clopidogrel personalized medicine related gene SNP detection, described
Test kit include detect gene C YP2C19*2SNP site two specific forward primer and a reverse primer, and detection
Two specific forward primer in gene C YP2C19*3SNP site and a reverse primer.
Described detection gene C YP2C19*2SNP site two specific forward primer and a reverse primer sequences
As follows:
A allele forward primer: GAAGGTGACCAAGTTCATGCTAATTTTCCCACTATCATTGATTATTTCCCA
SEQ ID NO.3
G allele forward primer: GAAGGTCGGAGTCAACGGATTTCCCACTATCATTGATTATTTCCCG SEQ
ID NO.4
Reverse primer: GCAAGGTTTTTAAGTAATTTGTTATGGGTT SEQ ID NO.5
Described detection gene C YP2C19*3 site two specific forward primer and a reverse primer sequences as follows
Shown in:
A allele forward primer: GAAGGTGACCAAGTTCATGCTCAGGATTGTAAGCACCCCCTGA SEQ ID
NO.6
C allele forward primer: GAAGGTCGGAGTCAACGGATTAGGATTGTAAGCACCCCCTGG SEQ ID
NO.7
Reverse primer: GCAAAAAACTTGGCCTTACCTGGAT SEQ ID NO.8
Wherein, described forward primer is combined into by two parts sequence: 5 ' ends of saltant type forward primer are general sequence
Row GAAGGTGACCAAGTTCATGCT (SEQ ID NO.1), 3 ' ends are the distinguished sequence identifying corresponding site；Wild type forward
5 ' ends of primer are universal sequence GAAGGTCGGAGTCAACGGATT (SEQ ID NO.2), and 3 ' ends are the spy identifying corresponding site
Different sequence.
The detection method of test kit of the present invention, amplification program is as follows:
The condition of denaturation is: temperature is 94 DEG C, and the time is 15 seconds；
PCR amplification is made up of first stage and second stage；
First stage is made up of 10 amplification cycles, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: initial temperature is 61 DEG C, each takes turns amplification cycles lapse of temperature 0.5 DEG C, until amplification cycles knot
Bundle, the time is 60 seconds；
Second stage is taken turns circulation by 29 and is constituted, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: temperature is 55 DEG C, and the time is 60 seconds；
Signal scanning condition is: temperature is 37 DEG C, and the time is 60 seconds.
The primer (primer) of the present invention is the important component part in PCR (polymerase chain reaction) technology, and it is one
Segment single stranded DNA, as the starting point of DNA replication dna, when nucleic acid synthetic reaction, carries out extending as each polynucleotide chain
Starting point and the polynucleotide chain that works, on 3 '-OH of primer, nucleotide synthesizes with diester linkage form, therefore draws
3 '-OH of thing must be free.5 ' universal sequences of saltant type forward primer and 2X PCR mixed reaction solution use FAM fluorescence
The universal sequence of dye marker is consistent；5 ' universal sequences of wild type forward primer are glimmering with HEX with 2X PCR mixed reaction solution
The universal sequence of photoinitiator dye labelling is consistent；Carry the universal sequence of fluorochrome label for completing for fluorescent quantitative PCR
Rear offer fluorescence signal.
The operation principle of the present invention is: separately designed two specific forward primer and one reversely for each site
Primer.Article two, specific forward primer 3 ' holds the base pair complementarity that last nucleotide is detected respectively with mutational site,
Combine reverse primer when PCR (polymerase chain reaction) expands and DNA profiling to be measured is carried out specific amplification.First 10 of PCR
The amplification of circulation have employed Touchdown PCR, i.e. touchdown PCR, is a kind of PCR method after optimizing and improveing, refers to each
(or n) circulation reduces by 0.5 DEG C of (or n DEG C) annealing temperature, until reaching a relatively low annealing temperature, (Touchdown anneals
Temperature), all with the primer that this ensures different Tm value can combine with corresponding DNA profiling to be measured and carry out specific amplification.
In the PCR amplification procedure of carry out subsequently 29 circulations, in 2X PCR mixed reaction solution respectively with the two of FAM and HEX labelling
Bar general probe can 10 PCR primer produced when taking turns PCR amplification be template in the past, coordinates reverse primer to produce and carries difference
The PCR primer of fluorochrome label.The last scanning carrying out fluorescence signal at 37 DEG C, by strong according to two kinds of fluorescence signals of software
Degree and ratio carry out automatic discrimination to genotype.
The present invention compared with prior art has the following advantages that and effect:
1, the present invention uses the primer of particular design, and fluorescence signal is carried different fluorescence dye by two kinds in PCR mixed liquor
The universal sequence of material labelling provides, it is not necessary to individually designed specific probe, greatly reduces R&D cycle and testing cost.
2, the present invention uses special PCR program, greatly reduces the primer caused owing to Tm value is the lowest and exists with template
The combination in mistake site, thus improve PCR efficiency and sensitivity, adjusting for clinical clopidogrel dosage provides reliably
Foundation.
3, the SNP site genotyping software that the present invention uses, can the base in each site to be measured of automatic discrimination intuitively
Because of type, it is not necessary to by the troublesome calculation of Ct value, greatly reduce human error during result interpretation, and shorten result interpretation
Time, improve detection efficiency.
4, the test kit of the present invention, can according to the number of sample to be tested quantity, select flexibly 8 connecting legs, 96 orifice plates or
Person 384 orifice plate detects, and detection flux once is respectively 1 person-portion, 28 person-portions and 124 person-portions.
5, the test kit of the present invention, it is possible to achieve high accuracy, high efficiency to * 2, * 3 two on CYP2C19 gene
SNP site detects, thus reaches the quantified controlling to clopidogrel dosage, even prevention, the anticoagulant to thrombotic disease
The selection of medicine, the research and development of acenocoumarol medicine, thrombotic disease prognosis also function to certain effect.
Embodiment 1
A kind of test kit for instructing clopidogrel personalized medicine related gene SNP to detect comprises: 2X PCR mixes
Reactant liquor, the primer mix in detection CYP2C19*2SNP site and the primer mix in detection CYP2C19*3SNP site.
The primer mix in described detection gene C YP2C19*2SNP site is reversely drawn by two specific forward primer and one
Thing forms, and sequence is as follows:
A allele forward primer: GAAGGTGACCAAGTTCATGCTAATTTTCCCACTATCATTGATTATTTCCCA
SEQ ID NO.3
G allele forward primer: GAAGGTCGGAGTCAACGGATTTCCCACTATCATTGATTATTTCCCG SEQ
ID NO.4
Reverse primer: GCAAGGTTTTTAAGTAATTTGTTATGGGTT SEQ ID NO.5
The primer mix in described detection gene C YP2C19*3 site is by two specific forward primer and a reverse primer
Composition, sequence is as follows:
A allele forward primer: GAAGGTGACCAAGTTCATGCTCAGGATTGTAAGCACCCCCTGA SEQ ID
NO.6
C allele forward primer: GAAGGTCGGAGTCAACGGATTAGGATTGTAAGCACCCCCTGG SEQ ID
NO.7
Reverse primer: GCAAAAAACTTGGCCTTACCTGGAT SEQ ID NO.8
Wherein, described forward primer is combined into by two parts sequence: 5 ' ends of saltant type forward primer are general sequence
Row GAAGGTGACCAAGTTCATGCT (SEQ ID NO.1), 3 ' ends are the distinguished sequence identifying corresponding site；Wild type forward
5 ' ends of primer are universal sequence GAAGGTCGGAGTCAACGGATT (SEQ ID NO.2), and 3 ' ends are the spy identifying corresponding site
Different sequence.
Embodiment 2
The PCR amplification side that a kind of test kit for instructing clopidogrel personalized medicine related gene SNP to detect uses
Method comprises the following steps:
The first step: sample to be tested extracting genome DNA
(1) blood sample is extracted from patient.
(2) from blood, obtain DNA, use the TGuide poba gene group that root biochemical (Beijing) company limited in sky produces
DNA extraction kit (OSR-M102) is extracted on its supporting TGuide M16 nucleic acid automatic extracting instrument.
Extraction process is as follows:
A. toward sample cell adds the mammalian whole blood sample of 200 μ l/400 μ l, and 10 μ l/20 μ l E.C. 3.4.21.64s are added
Mixing.
B. sample cell is placed in the position, hole 4 of T-shaped frame.Run numbering 102 program (Whole Blood Genomic DNA extraction procedure),
Select corresponding sample size volume and final elution volume.
Second step: DNA is expanded
Using 10ng/10ul reaction system, concrete operations are:
1, by above-mentioned a series of primers respectively with poba gene group DNA, 2X PCR mixed reaction solution, deionized water according to one
Certainty ratio mixing constitutes single reaction system, is specifically shown in following table:
| Reagent name | Volume (ul) |
| Genomic DNA (10ng) | 2ul |
| Primer mix | 1ul |
| 2X PCR mixed reaction solution | 5ul |
| Deionized water | 2ul |
2, above-mentioned reaction system carrying out PCR cycle, PCR cycle condition see table:
3rd step: observed result
Table 1 be use two specific forward primer in the detection gene C YP2C9*2 site in test kit and one reverse
The primer genotype results to four samples.
Table 1
As it is shown in figure 1, in the fluorescent quantitative PCR system in CYP2C19*2 site, A is allelic special in detection
Property forward primer 5 ' terminal sequence consistent with the fluorescently-labeled primer sequence of FAM in 2*qPCR reaction mixture, detect G allele
Specific forward primer 5 ' terminal sequence consistent with the fluorescently-labeled primer sequence of HEX in 2*qPCR reaction mixture.X in Fig. 1
Axle represents the intensity of FAM fluorescence, and Y-axis represents the intensity of HEX fluorescence, and the testing result of two samples of 1-1,1-2 is near X
Axle, illustrates that only FAM fluorescence is detected, and therefore genotype is AA and isozygotys；The testing result of two samples of 1-3,1-4 is near right
Linea angulata, illustrates that two kinds of fluorescence of FAM and HEX are detected simultaneously, and therefore genotype is AG heterozygosis；The detection of two samples of 1-5,1-6
Result, near Y-axis, illustrates that only HEX fluorescence is detected, and therefore genotype is GG and isozygotys.
As in figure 2 it is shown, two samples of 1-1,1-2 only detect A allele in CYP2C19*2 site, illustrate two
The sample genotype in CYP2C19*2 site is that AA isozygotys；Two samples of 1-3,1-4 detect in CYP2C19*2 site simultaneously
To two kinds of allele of A and G, illustrate that two samples genotype in CYP2C19*2 site is AG heterozygosis；Two samples of 1-5,1-6
This only detects G allele in CYP2C19*2 site, illustrates that two samples genotype in CYP2C19*2 site is GG
Isozygoty.Generation sequencing result is consistent with test kit testing result.
Table 2 is to use two specific forward primer in the detection gene C YP2C19*3 site in test kit and one instead
To the primer genotype results to four samples.
Table 2
As it is shown on figure 3, in the fluorescent quantitative PCR system in CYP2C19*3 site, A is allelic special in detection
Property forward primer 5 ' terminal sequence consistent with the fluorescently-labeled primer sequence of FAM in 2*qPCR reaction mixture, detect G allele
Specific forward primer 5 ' terminal sequence is consistent with the fluorescently-labeled primer sequence of HEX in 2*qPCR reaction mixture.X-axis in Fig. 3
Representing the intensity of FAM fluorescence, Y-axis represents the intensity of HEX fluorescence, and two pattern detection results of 2-1 and 2-2 are near diagonal
Position, illustrate that two kinds of fluorescence of FAM and HEX are all detected, therefore genotype is AG heterozygosis；Two pattern detection knots of 2-3 and 2-4
Fruit, near Y-axis, illustrates that only HEX fluorescence is detected, and therefore genotype is that GG isozygotys.
As shown in Figure 4, two samples of 2-1 and 2-2 are detected simultaneously by two kinds of equipotential bases of A and G in CYP2C19*3 site
Cause, so the genotype that two samples of 2-1 and 2-2 are in CYP2C19*3 site is AG heterozygosis；Two samples of 2-3 and 2-4 exist
CYP2C19*3 site only detects G allele, so the genotype that two samples of 2-3 and 2-4 are in CYP2C19*3 site
Isozygoty for GG.Generation sequencing result is consistent with test kit testing result.
In sum, present disclosure is not limited in the above embodiments, and the knowledgeable people in same area can
Can propose other embodiment within technological guidance's thought of the present invention easily, but this embodiment is included in this
Within the scope of bright.
Claims (4)
1. the test kit for clopidogrel personalized medicine related gene SNP detection, it is characterised in that include 2XqPCR
The primer mix in mixed reaction solution and detection gene C YP2C19*2SNP site and the primer in detection gene C YP2C19*3SNP site
mix；The primer mix in described detection gene C YP2C19*2SNP site contains two the specificity forwards detecting this SNP site
Primer and a reverse primer, the primer mix in described detection gene C YP2C19*3SNP site contains this SNP site of detection
Article two, specific forward primer and a reverse primer；Described detection gene C YP2C19*2SNP site two specificitys just
To primer and a reverse primer sequences as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, described detection base
Because of CYP2C19*3SNP site two specific forward primer and a reverse primer sequences such as SEQ ID NO.6, SEQ
Shown in ID NO.7, SEQ ID NO.8.
Test kit for clopidogrel personalized medicine related gene SNP detection the most according to claim 1, its feature
It is, Buffer, MgCl Han PCR in described 2X qPCR mixed reaction solution2, dNTPs, Taq archaeal dna polymerase, two difference
With the universal fluorescent probe of FAM and HEX labelling, the universal fluorescent probe sequence of described FAM labelling as shown in SEQ ID NO.1,
The universal fluorescent probe sequence of described HEX labelling is as shown in SEQ ID NO.2.
3. the detection side of the test kit for clopidogrel personalized medicine related gene SNP detection as claimed in claim 1
Method, it is characterised in that comprise the following steps: extract the genomic DNA of sample to be detected, is then divided into 2 reaction tubes (a, b) and enters
Row detection, is first separately added into 2X qPCR mixed reaction solution in each reaction tube, then adds inspection at the first reaction tube (a)
The primer mix in cls gene CYP2C19*2SNP site；Detection gene C YP2C19*3SNP site is added at the second reaction tube (b)
Primer mix, finally adds the genomic DNA of sample to be detected in 2 reaction tubes (a, b), and the fluorescence carrying out sample of nucleic acid is fixed
Amount PCR amplification, carries out the scanning of fluorescence signal, uses in LightCycler 480Software release software at 37 DEG C
Endpiont Genotyping module, intensity and ratio according to two kinds of fluorescence signals carry out automatic interpretation to genotype.
The detection of the test kit for clopidogrel personalized medicine related gene SNP detection the most according to claim 3
Method, it is characterised in that described PCR amplification program is as follows:
The condition of denaturation is: temperature is 94 DEG C, and the time is 15 seconds；
PCR amplification is made up of first stage and second stage；
First stage is made up of 10 amplification cycles, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: initial temperature is 61 DEG C, each takes turns amplification cycles lapse of temperature 0.5 DEG C, until amplification cycles terminates, time
Between be 60 seconds；
Second stage is taken turns circulation by 29 and is constituted, and its condition is:
Degeneration: temperature is 94 DEG C, the time is 20 seconds；
Annealing+extend: temperature is 55 DEG C, and the time is 60 seconds；
Signal scanning condition is: temperature is 37 DEG C, and the time is 60 seconds.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610700306.7A CN106048076A (en) | 2016-08-19 | 2016-08-19 | Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610700306.7A CN106048076A (en) | 2016-08-19 | 2016-08-19 | Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106048076A true CN106048076A (en) | 2016-10-26 |
Family
ID=57195404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610700306.7A Pending CN106048076A (en) | 2016-08-19 | 2016-08-19 | Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106048076A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108715805A (en) * | 2018-06-11 | 2018-10-30 | 首都医科大学附属北京潞河医院 | The automatic presentment system of clopidogrel medication related gene examining report |
| CN110684839A (en) * | 2019-11-11 | 2020-01-14 | 福建医科大学附属第一医院 | Digital PCR detection kit for CYP2C19 x2 and CYP2C19 x 3 and detection method thereof |
| CN111733221A (en) * | 2019-03-25 | 2020-10-02 | 北京大学第一医院 | ITGA2 gene SNP marker for assisting accurate medication of clopidogrel |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624328A (en) * | 2016-04-08 | 2016-06-01 | 山东寿光蔬菜种业集团有限公司 | High-flux molecular marker for identifying tomato leaf mold resistance, and marking method and application thereof |
| CN105861739A (en) * | 2016-06-23 | 2016-08-17 | 北京阅微基因技术有限公司 | CYP2C19, CYP2C9 and VKORC1 genotyping multiplex amplification system and detection kit |
-
2016
- 2016-08-19 CN CN201610700306.7A patent/CN106048076A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624328A (en) * | 2016-04-08 | 2016-06-01 | 山东寿光蔬菜种业集团有限公司 | High-flux molecular marker for identifying tomato leaf mold resistance, and marking method and application thereof |
| CN105861739A (en) * | 2016-06-23 | 2016-08-17 | 北京阅微基因技术有限公司 | CYP2C19, CYP2C9 and VKORC1 genotyping multiplex amplification system and detection kit |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108715805A (en) * | 2018-06-11 | 2018-10-30 | 首都医科大学附属北京潞河医院 | The automatic presentment system of clopidogrel medication related gene examining report |
| CN108715805B (en) * | 2018-06-11 | 2021-08-03 | 首都医科大学附属北京潞河医院 | Automatic issuing system for related gene detection report of clopidogrel medication |
| CN111733221A (en) * | 2019-03-25 | 2020-10-02 | 北京大学第一医院 | ITGA2 gene SNP marker for assisting accurate medication of clopidogrel |
| CN110684839A (en) * | 2019-11-11 | 2020-01-14 | 福建医科大学附属第一医院 | Digital PCR detection kit for CYP2C19 x2 and CYP2C19 x 3 and detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104099425B (en) | A kind of test kit for detecting B-raf transgenation | |
| CN106434940A (en) | Kit used for SNP detection of personalized medicine relaed genes of statin lipid-lowering medicine and detecting method thereof | |
| CN104232781B (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles | |
| CN104651488B (en) | Detect the Amplification thing and quick detection kit of chromosome aneuploid numerical abnormality | |
| CN105624296A (en) | Universal fluorescent hairpin primers for detecting gene polymorphism on basis of ARMS (amplification refractory mutation system) fluorescent PCR (polymerase chain reaction) process | |
| CN105274190A (en) | HRM method for detecting genetic polymorphism of CYP3A4*1G and MDR1C1236T | |
| CN106048076A (en) | Kit for clopidogrel personalized medicine related gene SNP detection, and detection method thereof | |
| CN102465174A (en) | Method for detecting GJB2 gene mutation by fluorescent quantitative PCR technology and kit thereof | |
| CN109355376A (en) | Fragile X mental retardation FMR1 genetic test primer, kit and detection method | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN106399479A (en) | SNP typing kit used for detecting susceptibility genes of type-II diabetes | |
| CN104293932B (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN106434943A (en) | Kit and detection method thereof for SNP detection of aspirin individualized medication related genes | |
| CN113403381A (en) | Detection kit for statin curative effect prediction and detection method and application thereof | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN108624657A (en) | β based on recombinase polymeric enzymatic amplification technology-thalassemia cdna amplification kit and method | |
| CN104342489A (en) | Method for detecting genotype of chicken beard | |
| CN106702005A (en) | Primers, probes, kit and method for testing human VKORC1 and CYP2C9 gene polymorphisms | |
| CN105950766A (en) | Primer group and kit for detecting HLA-B*5801 allelic genes | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN105925691A (en) | Kit for rapidly detecting the numbers of human No.13, No.18, No.21, X and Y chromosomes | |
| CN105349705A (en) | Aquatic product common virus detection kit | |
| EP3279338A1 (en) | Gene mutation detection method and fluorescence-labeled oligonucleotide used in same | |
| CN109385487B (en) | Recombinase-mediated amplification isothermal detection method and kit for American ginseng as Chinese medicinal herb | |
| CN106319049A (en) | Kit for detecting personalized medication related gene SNP of warfarin, and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161026 |
|
| RJ01 | Rejection of invention patent application after publication |