CN1560229A

CN1560229A - Process of preparing D-amino acid oxydase

Info

Publication number: CN1560229A
Application number: CNA2004100168259A
Authority: CN
Inventors: 佩周; 周佩; 冯美卿; 史训龙; 袁中一
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2004-03-09
Filing date: 2004-03-09
Publication date: 2005-01-05

Abstract

The invention is a method of preparing D-amino acid oxidase, relating to a method of preparing flavo-enzyme D-amino acid oxidase. Concretely, it relates to a method of highly efficiently producing mutational D-amino acid oxidase by constructing recombinant engineering strains. It reconstructs wild D-amino acid oxidase coming from Trigonopsis variablilis by means of gene engineering, fuses a segment of Histag at N end and C end of the wild enzyme, and further implements high-efficiency fast separation of mutational enzyme by affinity chromatography. The expression level of the enzyme in fermentation liquor is 4000IU/mL, higher than that of the wild enzyme, and the recovery ratio of Ni-column affinity chromatography is 50%. The purified enzyme can be used in making high-efficient oxidation conversion of cephalosporin C- to produce glutaryl-7-ACA and be used together with GL-7-ACA to produce 7-ACA.

Description

A kind of method for preparing the D-amino-acid oxidase

Technical field

The invention belongs to technical field of bioengineering, relate to a kind of method for preparing flavin protease D-amino-acid oxidase.Be specifically related to, by making up the method that recombinant strain obtains High-efficient Production sudden change D-amino-acid oxidase.

Background technology

D-amino-acid oxidase (D-Amino Acid Oxidase.EC 1.4.3.3.DAAO) is a kind of with the typical flavo-enzyme of flavin adenine dinucleotide (FAD) as prothetic group, extensively is present in animal and the multiple microorganism.Natural enzyme albumen is the dimer of 86kDa, has catalyzed oxidation cephalosporin vigor.Mammiferous DAAO combines pine with prothetic group FAD, prothetic group is easily lost and made enzyme deactivation; And that some yeast combines with prothetic group FAD is stronger, and greater activity is arranged.In the practical application, the DAAO of trigonopsis variabilis is that (Yeast 1997 for Dominguez, A, 13:1399-1408) for the most frequently used and tool application potential.DAAO catalysis D-amino-acid oxidase deamination generates alpha-ketoacid, can be used for the catalyzed oxidation dl aminoadipic acid and produces L-amino acid and alpha-ketoacid.In the enzyme process compound probability of semi-synthetic cynnematin, DAAO and GL-7ACA acylase double-enzyme catalysis are the present approach of the most promising Production by Enzymes 7-ACA.Cephalosporin produces α-ketone group hexanedioyl-7-amino-cephalosporanic acid through DAAO catalyzed oxidation deamination, if H is arranged ₂O ₂Exist, just the spontaneous oxidation decarboxylation form Glularyl-7-amino-cephalo-alkanoic acid (GL-7ACA) (Shewale, JG, J.Biotechnol.1999,75:11-22).The further catalysis GL-7ACA of GL-7-ACA acylase takes off glutaryl and generates 7-ACA.

At present, obtained the clone from the DAAO gene in multiple source, and in intestinal bacteria and yeast, realized recombinant expressed.Pichia yeast expression system has derivable strong promoter, can reach high-density culture and efficiently express, and is easy to realize industrialization.Report is arranged, and the DAAO that utilizes Pichia anomala expression to derive from trigonopsis variabilis Trigonopsis viabllis has obtained higher level and has expressed (Yuan Zhongyi, in building Chinese patent CN1385521A).Yet, find in the separation and purification process of DAAO, always to be accompanied by catalatic vigor, be difficult to realize the separation fully of the two with separating and purifying technology commonly used.

Summary of the invention

The purpose of this invention is to provide a kind of method for preparing the D-amino-acid oxidase simply, fast.Specifically be by making up the method that recombinant strain obtains High-efficient Production sudden change D-amino-acid oxidase.

The present invention adopts the DNA recombinant technology to transform trigonopsis variabilis wild-type DAAO gene, Histag is blended in the terminal and C-end of N-of wild-type enzyme gene, both realized efficiently expressing of mutant enzyme in pichia spp, available again affinity chromatography obtains highly purified DAAO quickly and easily.The enzyme of purifying can be used for efficient oxidation and transforms cephalosporin-generation glutaryl-7-ACA, can produce 7-ACA. with the coupling of GL-7-ACA acylase.

The present invention is undertaken by following method and step,

1, the sudden change daao gene,

With plasmid pPIC3.5K-DAAO is template, 5 ' end and 3 ' at the DAAO encoding sequence is held the Histag sequence that imports 6 Histidines of continuous programming code according to a conventional method respectively, obtain mutator gene, corresponding sudden change D-amino-acid oxidase N end and C end all have the Histidine sequence.Also can hold the Histag sequence that respectively be introduced separately into 6 Histidines at the 5 ' end or 3 ' of DAAO encoding sequence, corresponding sudden change D-amino-acid oxidase N end or C end have the Histidine sequence.

2, make up the mutant enzyme expression strain,

The said mutation gene is cloned into pBluescript (SK+) by flush end, cuts the carrier pPIC3.5K that rear clone is cut to same enzyme through NotI and BamHI enzyme again, obtains recombinant plasmid pPIC3.5K-hisDAAO.The SalI linearizing of described recombinant plasmid, electricity transforms pichia spp host cell GS115, obtain positive recombinant bacterial strain by the screening of PCR method, filter out superior strain by enzyme activity determination again, called after Fudan0112 is (in preservation on March 3 in 2004, depositary institution: CGMCC, the No. 13, North No.1 Row, Zhongguancun, Haidian District, Beijing City, deposit number: CGMCC No.1103, microorganism classification title: Pichia.Postori) s.

3, fermentation, cultivation, separation sudden change D-amino-acid oxidase,

After above-mentioned gained superior strain carried out fermentation culture, hold by sudden change D-amino-acid oxidase N end and C to have the affine fractionation by adsorption D-amino-acid oxidase of Ni ionic specificity on Histag sequence and the affine resin.The highest production of enzyme reaches 4000IU/ml.The thalline of gained through ultrasonic broken wall, low-temperature centrifugation gained supernatant as crude enzyme liquid, carry out affinity chromatography by the Ni post again, gradient is 0, the phosphoric acid buffer of 5mmol/L, 25mmol/L, 50mmol/L, 100mmol/L imidazoles, and the enzyme rate of recovery of purifying is 50%.

Host cell of the present invention is available from Invitrogen company, and gene source is in described bacterial strain of patent CN 1385521A and plasmid.

Description of drawings

Fig. 1 is the construction of recombinant plasmid figure that comprises the daao gene that suddenlys change of the present invention,

Fig. 2 is a SDS-PAGE electrophoretogram of the present invention: the intracellular protein of 1 positive reorganization bacterium wherein; 2 are albumen in the reorganization mycetocyte of empty carrier pPIC3.5k conversion; 3 is the lower molecular weight standard protein,

Fig. 3 is the vigor curve that pichia spp recombinant bacterial strain of the present invention is expressed the D-amino-acid oxidase,

Embodiment

Embodiment 1 obtains the sudden change daao gene

Codon design mutant primer according to the DAAO gene order of known trigonopsis variabilis Trigonopsis Vriabllis and Histidine correspondence is as follows:

5’primer?5’ GGATCC?ATGCACCATCATCATCATCAT?ATGGCTAAAA?TCGTTGTT

3 ' primer 5 ' GCGGCCGCTTAATGATGATGATGATGATG AAGGTTT GGACGAGTAAG templet gene derives from the described plasmid pPIC3.5K-DAAO of patent CN 1385521A, with high-fidelity PCR (Pfu enzyme, available from lottery industry) amplification DAAO gene, and 5 ' and 3 ' end at encoding sequence imports the Histag sequence of 6 Histidines of continuous programming code respectively respectively, and introduces the restriction enzyme site of NotI and BamHI correspondence respectively.The PCR reaction conditions is: 94 ℃ of 5min, 1 circulation; 94 ℃ of 30s, 40 ℃ of 30s, 72 ℃ of 75s, 5 circulations; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 75s, 30 circulations; At last, 72 ℃ of 10min, 1 circulation.

The PCR product adopts DNA glue to reclaim test kit (available from Promega) and reclaims sudden change DAAO gene fragment after the checking of 1% agarose gel electrophoresis.

Embodiment 2 sudden change DAAO gene flush ends are cloned into plasmid pBluescript (SK+)

Plasmid pBluescript (SK+) is with the SmaI linearizing, as flush end clone's carrier.The sudden change DAAO gene fragment that glue reclaims is carried out external the connection with described carrier, and (20 μ l) is as follows for reaction system:

pBluescript(SK+) 2μl

PCR product 10 μ l

10 times connect damping fluid 2 μ l

T4 dna ligase (1U/ μ l) 1 μ l

Water 5 μ l

Mixture spends the night in 16 ℃ of reactions.Gained connects product Transformed E .coli TG1 competent cell, coats the LB flat board that contains ammonia benzyl resistance, selects white transformant extracting plasmid DNA, and gained DNA is pSK-DAAO with PCR method and enzyme cutting method proof recombinant plasmid.

Embodiment 3 construction expression plasmid pPIC3.5K-hisDAAO

With pSK-DAAO NotI and BamHI double digestion, 1% agarose gel electrophoresis, glue reclaims the fragment of about 1.3Kb, and the pPIC3.5K plasmid with the same double digestion of warp carries out external the connection again, and reaction system is as follows:

PPIC3.5k (NotI and BamHI cut) 2 μ l

DAAO gene segment 15 μ l

10x connects damping fluid 2 μ l

T4 dna ligase 1 μ

Said mixture spends the night in 16 ℃ of reactions.Gained connects product Transformed E .coli TG1 competent cell, coats the LB flat board that contains ammonia benzyl resistance, selects transformant extracting plasmid DNA, and gained DNA is pPIC3.5K-DAAO with PCR method and enzyme cutting method proof recombinant plasmid.

Embodiment 4 expression plasmids electricity transforms pichia spp GS115

Constructed expression plasmid pPIC3.5k-DAAO Sa/I linearization for enzyme restriction.It is 1.6-1.8 that host bacterium P.pastorisGS115 (his mut+) is cultured to OD; preparation electroreception attitude cell; mix with above-mentioned plasmid; transform voltage 1500V wherein, electric capacity 50 μ F again with GIBCOL BRL electricity conversion instrument CELL-PORATOR electricity; resistance 4k Ω; add the cold sorbyl alcohol of 0.5ml 1mol/L in transforming cup, get 200 μ l and be applied to the MD flat board, 30 ℃ are cultured to single bacterium colony and occur.Transformant is applied to MM and MD plate screening Mut+ transformant respectively, screens positive strain, the positive strain that obtains is expressed with PCR, sieve superior strain, wherein PDH12 strain expression level is the highest.

Embodiment 5 PCR method are screened positive pichia spp recombinant bacterial strain

Transformant on the MD flat board is inserted 3ml YPD test tube respectively cultivate, press yeast plasmid DNA extraction agent box and extract the transformant plasmid DNA.Do the PCR reaction by following PCR reaction system:

10X damping fluid 2.5 μ l

dNTP(25mM?each) 0.5μl

5’DAAO?Primer 1μl

3’DAAO?Primer 1μl

Template 1 μ l

Taq archaeal dna polymerase 0.5 μ l

Water 18.5 μ l

Above mixture totally 25 μ l carries out the PCR reaction by embodiment 1 condition.

Embodiment 6 reorganization methanol yeast bacterial strains are expressed the D-amino-acid oxidase

Select single bacterium colony from the YPD slant medium, insert the 250ml that contains the 30mlBMGY substratum and shake bottle, 28-30 ℃, 220r/min, cultivate 24h, get 1.5ml and change 40ml basis salt culture medium growth 24h over to, centrifugal (4000rpm, 5min), abandon supernatant, thalline suspends with the 40ml inducing culture, cultivates.Every 6h gets thalline and surveys the DAAO vigor, and it is 0.5% that every 24h mends methyl alcohol to its final concentration.

The pichia spp recombinant bacterial strain is expressed the D-amino-acid oxidase in embodiment 7 fermentor tanks

Fermentor tank is that the Bio F110 of U.S. NBS company controls fermentation system automatically, contains that pH regulates automatically, temperature is controlled automatically, dissolved oxygen monitoring, stirring, inlet system.

Fermentation parameter is provided with temperature: 30 ℃; PH:6.0; D0 (oxyty): 35%; Stir: 200-800r/min.

The seed liquor preparation: select single bacterium colony from the YPD slant medium, insert the bottle that shakes that contains BMGY substratum 40ml, 28-30 ℃, 220r/min cultivates 24h, as primary seed solution.Insert BMGY 400ml with 5% inoculum size again, similarity condition is cultivated 12-14h down, to A ₆₀₀About about 8, as the fermentor tank seed liquor.

Fermentation culture: the 14L fermentor tank 6L basis salt nutrient solution of packing into, seed liquor inserts fermentor tank with the inoculum size of 8-10%.The growth initial stage, stir interconnected system by dissolved oxygen, DO is maintained about 35%.Stirring reaches 800r/min, removes dissolved oxygen and stirs related.Look the DO situation that suddenly rises, stream adds 50% glycerine, stops behind the 4h.Glycerine has consumed, and begins stream and adds methyl alcohol, and flow acceleration is advisable to keep DO 35%.Timing sampling is surveyed bacterium and is heavily reached vigor, puts jar in good time, and final cell density reaches 180g/L (weight in wet base), enzyme activity 4000IU/mL.

Embodiment 8 separates and purifying D-amino-acid oxidase

The thalline of inducing the back gained is with the suspension of the phosphoric acid buffer of 3 times of volumes, and centrifugal (12000rpm, 20min), with 30% ammonium sulfate precipitation supernatant, 4 ℃ centrifugal, and (12000rpm, 20min), supernatant liquor is as the upper prop sample liquid through ultrasonic echography 16min.4 ℃.

The Ni resin chromatography column of packing into, balance back well adds sample to be separated, successively with contain 0, the phosphoric acid buffer wash-out of 5mmol/L, 50mmol/L, 100mmol/L, collect respectively and contain the albumen elutriant, SDS-PAGE detects, the result shows, contains in the elution peak of 50mmol/L imidazoles and contains target protein.

Embodiment 9 HisDAAO transform CPC-Na

Above-mentioned purified product mixes with 2% CPC-Na, and 25 ℃ of oscillatory reaction 3h detect 3hCPC-Na through HPLC and transform fully, and resultant is GL-7ACA.

Embodiment 10 DAAO vitality tests

Get nutrient solution 1ml, centrifugal, the thalline tetra-sodium damping fluid (0.05mol/L that contains 30% acetone, pHg.5) 10ml suspends again, and 30min is slightly shaken in 25 ℃ of water-baths, and is centrifugal, with the physiological saline washing, thalline adds the DL-methionine 5ml of 0.05mol/L, 37 ℃ of water-bath concussion 30min.With 10% trichoroacetic acid(TCA) 3ml termination reaction, dilute 10 times, get 1ml, add 2,4 dinitrophenyl hydrazine (0.2%) 0.4ml, leave standstill 10min, add 3mol/LNaOH 1.5ml, leave standstill 15min, the centrifuging and taking supernatant is surveyed A ₅₅₀

Described unit of enzyme definition: per minute generates the DAAO that the required enzyme amount of 1umol ketone acid is defined as 1 unit,

The unit of enzyme calculation formula is vigor IU/ml=K * OD * M * 1000/30 * D

K wherein: slope of standard curve 0.592; M: extension rate; D: institute's bacteria liquid of getting long-pending (ml).

The mutator gene sequence

Organization?Applicant

----------------------

Street: No. 138, medical college road

City: Shanghai

State: Shanghai

Country: the People's Republic of China (PRC)

PostalCode：200032

PhoneNumber：64037324

FaxNumber：64037324

EmailAddress：patent@shmu.edu.cn

＜110〉OrganizationName: Fudan University

Application?Project

-------------------

＜120〉Title: a kind of method for preparing the D-amino-acid oxidase

<130>AppFileReference：

<140>CurrentAppNumber：

<141>CurrentFilingDate：____-__-__

Sequence

--------

<213>OrganismName：Trigonopsis?Vriabllis

<400>PreSequenceString：

ggatccatgc?accatcatca?tcatcatatg?ccggtgttgc?cggtttaact?acagctcttc

60aacttcttcg?taaaggacat?gaggttacaa?ttgtgtccga?gtttacgccc?ggtgatctta

120gtatcggata?tacctcgcct?tgggcaggtg?ccaactggct?cacattttac?gatggaggca

180agttagccga?ctacgatgcc?gtctcttatc?ctatcttgcg?agagctggct?cgaagcagcc

240ccgaggctgg?aattcgactc?atcagccaac?gctcccatgt?tctcaagcgt?gatcttccta

300aactggaagt?tgccatgtcg?gccatctgtc?aacgcaatcc?ctggttcaaa?aacacagtcg

360attctttcga?gattatcgag?gacaggtcca?ggattgtcca?cgatgatgtg?gcttatctag

420tcgaatttcg?ttccgtttgt?atccacaccg?gagtctactt?gaactggctg?atgtcccaat

480gcttatcgct?cggcgccacg?gtggttaaac?gtcgagtgaa?ccatatcaag?gatgccaatt

540tactacactc?ctcaggatca?cgccccgacg?tgattgtcaa?ctgtagtggt?aaacgtcgag

600tgaaccatat?caaggatgcc?aatttactac?actcctcagg?atcacgcccc?gacgtgattg

660tcaactgtag?tggtctcttt?gcccggttct?tgggaggcgt?cgaggacaag?aagatgtacc

720ctattcgagg?acaagtcgtc?cttgttcgaa?actctcttcc?ttttatggcc?tccttttcca?780gcactcctga

aaaagaaaat?gaagacgaag?ctctatatat?catgacccga?ttcgatggta?840cttctatcat?tggcggttgt

ttccaaccca?acaactggtc?atccgaaccc?gatccttctc?900tcacccatcg?aatcctgtct?agagccctcg

accgattccc?ggaactgacc?aaagatggcc?960ctcttgacat?tgtgcgcgaa?tgcgttggcc

accgtcctgg?tagagagggc?ggtccccgag?1020tagaattaga?gaagatcccc?ggcgttggct

ttgttgtcca?taactatggt?gccgccggtg?1080ctggttacca?atcctcttac?ggcatggctg?atgaagctgt

ttcttacgtc?gaaagagctc?1140ttactcgtcc?aaacctttag?aaatcatggt?agtagtagta?gtagtaattc

gccggcg?1197

<212>Type：DNA

<211>Length：1197

SequenceName: sudden change daao gene

Claims

1, a kind of method for preparing the D-amino-acid oxidase is characterized in that daao gene is modified the back transforms methanol yeast host bacterium, realizes that mutant enzyme efficiently expresses, with affinity chromatography separating and purifying high-purity D-amino-acid oxidase, comprise the steps,

1) sudden change daao gene,

With plasmid pPIC3.5K-DAAO is template, holds the Histag sequence that imports 6 Histidines of continuous programming code at the 5 ' end and 3 ' of DAAO encoding sequence, obtains mutator gene;

2) make up the mutant enzyme expression strain,

The mutator gene flush end of step 1) is cloned into pBluescript (SK+), cut rear clone to carrier pPIC3.5K through Not I and BamH I enzyme, get recombinant plasmid pPIC3.5K-hisDAAO, the Sal I linearizing of described recombinant plasmid, electricity transforms the pichia spp host cell, PCR method, enzyme activity determination screen positive recombinant bacterial strain Fudan0112, are preserved in CGMCC, deposit number on March 3rd, 2004: CGMCC No.1103;

3) fermentation, cultivation, separation sudden change D-amino-acid oxidase,

Step 2) strain fermentation, cultivation, ultrasonic broken wall thalline, low-temperature centrifugation get supernatant as crude enzyme liquid, carry out affinity chromatography, gradient elution through the Ni post again.

2, the method for preparing the D-amino-acid oxidase according to claim 1,5 ' the end and 3 ' that it is characterized in that the gene order of described sudden change D-amino-acid oxidase is held the sequence that imports 6 Histidines of continuous programming code respectively, corresponding sudden change D-amino-acid oxidase N end and C end all have the Histidine sequence, or in 5 ' end of the sequence of described sudden change D-amino-acid oxidase or the Histag sequence that 3 ' end respectively is introduced separately into 6 Histidines, corresponding sudden change D-amino-acid oxidase N end or C end have the Histidine sequence.

3, the method for preparing the D-amino-acid oxidase according to claim 1 is characterized in that having inlayed on the genomic dna of described mutant enzyme expression strain the sudden change daao gene of His sequence.

4, the method for preparing the D-amino-acid oxidase according to claim 1 is characterized in that the structure of described mutant enzyme expression strain may further comprise the steps:

1) designs mutant primer according to the DAAO gene order of trigonopsis variabilis Trigonopsis Vriabllis and the codon of Histidine correspondence, 5 ' end and 3 ' end in gene order import the Histag sequence of 6 Histidines of continuous programming code respectively, and introduce the restriction enzyme site of Not I and BamH I correspondence respectively;

2) be template with plasmid pPIC3.5K-DAAO, pcr amplification sudden change DAAO gene imports expression vector pPIC3.5K;

3) recombinant plasmid pPIC3.5K-hisDAAO electricity transforms pichia spp host bacterium GS115, screens positive recombinant bacterial strain by PCR, enzyme activity determination.

5, the method for preparing the D-amino-acid oxidase according to claim 1, the separation method that it is characterized in that the sudden change D-amino-acid oxidase of described step 3), be to have the affine fractionation by adsorption D-amino-acid oxidase of Ni ionic specificity on Histag sequence and the affine resin by sudden change D-amino-acid oxidase N end and C end, wherein gradient be 0, the phosphoric acid buffer of 5mmol/L, 25mmol/L, 50mmol/L, 100mmol/L imidazoles, the enzyme rate of recovery is 50%.。

6, the method for preparing the D-amino-acid oxidase according to claim 1 is characterized in that the separation method of the sudden change D-amino-acid oxidase of described step 3),

7, the method for preparing the D-amino-acid oxidase according to claim 1 is characterized in that described D-amino-acid oxidase can be directly used in the catalysis cephalosporin and generate GL-7ACA, generates 7-ACA. with the coupling of GL-7-ACA acylase.