CN1455001A - Exendin-4 polypeptide preparation method - Google Patents

Exendin-4 polypeptide preparation method Download PDF

Info

Publication number
CN1455001A
CN1455001A CN 02111563 CN02111563A CN1455001A CN 1455001 A CN1455001 A CN 1455001A CN 02111563 CN02111563 CN 02111563 CN 02111563 A CN02111563 A CN 02111563A CN 1455001 A CN1455001 A CN 1455001A
Authority
CN
China
Prior art keywords
exendin
primer
expression
polypeptide
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 02111563
Other languages
Chinese (zh)
Inventor
周永春
杨武剑
张高峡
韩友斌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FUXING BIOMEDICINE ACADEMY Co Ltd SHANGHAI
Original Assignee
FUXING BIOMEDICINE ACADEMY Co Ltd SHANGHAI
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by FUXING BIOMEDICINE ACADEMY Co Ltd SHANGHAI filed Critical FUXING BIOMEDICINE ACADEMY Co Ltd SHANGHAI
Priority to CN 02111563 priority Critical patent/CN1455001A/en
Publication of CN1455001A publication Critical patent/CN1455001A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The method for preparing Exendin-4 polypeptide includes the following steps: designing and synthesizing primer, using PCR method to splice Exendin-4 gene, constructing recombinant plasmid, transferring it into host cell to obtain the engineering bacterium in which Exendin-4 polypeptide is fused expressed or non-fused expressed, fermentation to culture said engineering bacterium, finally separating and purifying to obtain the Exendin-4 polypeptide. As compared with traditional method its production cost is reduced, and it can implement large-scale production.

Description

A kind of preparation method of Exendin-4 polypeptide
Affiliated technical field
The present invention relates to bioengineering field, relate in particular to genetic engineering technique and prepare polypeptide or method of protein.
Background technology
Exendin-4 is from Monster Gila monster, a kind of 39 amino acid whose polypeptide of separating in Heloderma horridum or the Helodermasuspectum oral secretion, its amino acid and glucagon-like glucagon-like peptide (GLP-1) have an appointment 50% homology [referring to Bao Er etc., journal of biological chemistry, the 9778-9784 page or leaf, in April, 1998 version, (Pohl M.﹠amp; Wank SA., The Journal ofBiological Chemistry, page 9778-9784, in April, 1998 version)], and in several animal models, shown the effect of similarly treating type ii diabetes with GLP-1.
United States Patent (USP) (patent No. 5,424,286) discloses Exendin-4 aminoacid sequence and treatment diabetes function thereof, and wherein disclosed Exendin-4 polypeptide total length is: hgegtftsdl skqmeeeavr lfiewlknggpssgappps.
Because the Exendin-4 polypeptide has many advantages on the type ii diabetes in treatment: as can be, comprise oral, hypogloeeis, through the lung suction etc. through multiple route of administration onset; The main postprandial blood sugar that reduces raises, and is longer than effective acting time such as GLP-1 etc., and therefore, the Exendin-4 polypeptide has the bigger market requirement.
But Exendin-4 polypeptide content in animal body is atomic, the extraction process complexity, and it is medical to satisfy to be difficult to mass production.In the market polypeptide synthetic methods that adopt as Amylin company more.So far do not see the open report for preparing the scale production of such polypeptide about using gene engineering technique as yet.
The invention discloses and a kind ofly prepare the method for Exendin-4 polypeptide with genetic engineering technique, it is compared with traditional polypeptide synthesis method, has reduced production cost dramatically, and satisfies the requirement of scale production.
Summary of the invention
The objective of the invention is, a kind of preparation method of Exendin-4 polypeptide is provided.
The invention provides a kind of preparation method of Exendin-4 polypeptide, it is characterized in that, this method comprises:
1. design and synthesize primer;
2. with PCR method splicing Exendin-4 gene;
3. use the suitable expression construction recombination plasmid;
4. change recombinant plasmid over to host cell, obtain amalgamation and expression or non-fusion expression Exendin-4 polypeptide
Engineering bacteria;
5. the engineering bacteria of fermentation culture amalgamation and expression or non-fusion expression Exendin-4 polypeptide;
6. purifies and separates obtains the Exendin-4 polypeptide.
Described step 1. in, comprise designing and synthesizing primer, and introduce restriction enzyme site.
Described step 1. in, described primer can be used for splicing the Exendin-4 gene, and introduces the required restriction enzyme site of construction recombination plasmid.Described primer can be, is the primer that exemplifies in the embodiments of the invention but be not limited to, and comprises primer 1 (sequence numbering 2), primer 2 (sequence numbering 3), primer 3 (sequence numbering 4), primer 4 (sequence numbering 5), or primer 5 (sequence numbering 7); The restriction enzyme site of described introducing is BglII, KpnI, EcoRI, HindIII, XhoI, or yeast signal peptide cleavage site (being the KEX2 enzyme recognition site).
Described step 3. in, described expression vector can be a prokaryotic expression carrier, can be carrier for expression of eukaryon also, includes, but are not limited to pET32a (+) plasmid, pBV220 plasmid, pPIC9 plasmid, or YES TMCarrier.
Described step 4. in, described host cell can be a prokaryotic host cell, comprises intestinal bacteria, Bacillus subtilus; Can be eukaryotic host cell also, comprise yeast cell, insect cell, or mammalian cell.
Among the present invention, " a kind of Exendin-4 polypeptide " is meant the polypeptide with the aminoacid sequence shown in the sequence numbering 1.
Among the present invention, " Exendin-4 gene " is meant the combination that contains the various nucleotide sequences of the polypeptide of aminoacid sequence shown in the encoding sequence numbering 1.Provide sequence numbering 6 in an embodiment of the present invention, 8 two kinds of nucleotide sequence combinations of sequence numbering.
Among the present invention, when acquisition contains the recombinant plasmid of Exendin-4 gene, can select various expression vector known in the art for use, comprise business-like carrier, it can be prokaryotic expression carrier, can be carrier for expression of eukaryon also, include, but are not limited to, pET32a (+) plasmid, the pBV220 plasmid, pPIC9 plasmid, or YES TMCarrier.
Among the present invention, " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell, the example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc., and eukaryotic host cell commonly used comprises yeast cell (for example methanol yeast, multiple-shaped nuohan inferior yeast (Hansenula polymorphis), schizosaccharomyces pombe (Schizosaccharomyces pombe) and yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)), insect cell and mammalian cell.
But the expression vector among the present invention is amalgamation and expression Exendin-4 or non-fusion expression Exendin-4 after changing host cell over to.
Among the present invention, the engineering bacteria of fermentation culture amalgamation and expression or non-fusion expression Exendin-4 polypeptide may further comprise the steps:
After the engineering strain activation of screening, insert preparation seed liquor in the nutrient solution (for example LB nutrient solution, BMGY, YPD nutrient solution), be seeded in the fermentor tank after the overnight incubation, fermentation is basic medium (a for example M9+LB substratum) with substratum, fermentation condition is controlled to be pH5-9,28 ℃-37 ℃ of temperature, dissolved oxygen is controlled at more than 20%.Begin feed supplement or add glycerine after cultivating for some time,, add inductor (for example IPTG, methyl alcohol) abduction delivering, induced 2-84 hour when thalline OD value reaches high-density.
Among the present invention, purifies and separates obtains the Exendin-4 polypeptide and comprises following main points from tunning:
Collect tunning, the polypeptide with Exendin-4 protein-active has been expressed or amalgamation and expression, and expression product is present in nutrient solution or the thalline; In thalline, then need break bacterium as expression product, as needing through the enteropeptidase enzymolysis for amalgamation and expression; Obtain product (comprising metal-chelating column chromatography, ion column chromatography, oppositely chromatography, dialysis, ultrafiltration or gel-filtration etc.) through the multistep purifying; With SDS-PAGE and RP-HPLC check purity greater than 95% Exendin-4.
The Exendin-4 polypeptide that uses method of the present invention to obtain has lower toxicity (referring to the I of Amylin company clinical trial phase result).
The Exendin-4 polypeptide that uses method provided by the invention to obtain contains or has identical or similar aminoacid sequence and active structure with known Exendin-4 polypeptide.
Existing animal experiment or human trial conclusive evidence, Exendin-4 polypeptide of the present invention has the function of treatment type ii diabetes and fat-reducing (referring to the II of Amylin company phase clinical experiment result; Gang Xu etc.,＜diabetology〉DIABETES, the 2270-2276 page or leaf, in October, 1999 version; Margarzata Szayna etc.,＜incretology〉ENDOCRINOLOGY, 1936-1941 page or leaf, No.6, Vol.141, version in 2000).
Compare with traditional polypeptide synthesis method, preparation method of the present invention has broken through the confinement that in the past only obtains the Exendin-4 polypeptide with the amino acid synthetic method, makes that scale production cheaply becomes possibility in enormous quantities.It is the another successful example that biotechnology applies to scale operation.Brief description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.Fig. 1 pET32a (+) carrier physical map, wherein,
T7 promotor: 764-780;
Histidine-tagged 2:140-157;
T7 transcripting start point: 763
T7 terminator: 26-72;
Trx encoding sequence: 366-692;
LacI encoding sequence: 1171-2250;
Histidine-tagged 1:327-344; PBR322 replicon: 3684;
Multiple clone site: 157-217; Amp resistant gene: 4445-5302.The structure synoptic diagram of Fig. 2 recombinant plasmid 1.The amalgamation and expression of Fig. 3 Exendin4.Fig. 4 recombinant plasmid 2 (pPIC9-Ex4) makes up synoptic diagram.Fig. 5 pPIC9 physical map, wherein,
5 ' AOX1 promoter fragment (5 ' AOX1 promoter fragment): 1-948;
Signal peptide (α-factor secretion signal): 949-1218;
Multiple clone site (Multiple Cloning Region): 1192-1241;
3 ' AOX1 transcribes the terminal point fragment
(3’AOX1?transcription?termination(TT)fragment)：1253-1586；
Histidine gene (HIS4 ORF): 4514-1980;
3 ' AOX1 fragment (3 ' AOX1 fragment): 4870-5626;
ColE1 replication orgin (ColE1 origin): 6708-6034;
Amp resistant gene (Ampicillin resistance gene): 7713-6853.The Exendin-4 purifying electrophorogram that Fig. 6 E.coli expresses, wherein,
1.Chelating Sepharose FF column chromatography purification fusion rotein;
After 2.EK the enzyme enzyme is cut;
3.CM behind the Sepharose FF column chromatography purification;
4.Source behind the 30 RPC column chromatography purifications;
5.Sephadex behind the G-25 column chromatography purification;
6. molecular weight Marker.The Exendin-4 purifying electrophorogram that Fig. 7 Pichia pastoris expresses, wherein,
1. fermented liquid supernatant;
2.CM Sepharose FF column chromatography penetrates sample;
3.CM Sepharose FF column chromatography wash-out sample;
4.Source 30 RPC column chromatography wash-out samples;
5.Sephadex behind the G-25 column chromatography purification;
6. molecular weight Marker.
Specific implementation method
Below in conjunction with specific embodiment, further set forth the present invention.Following examples are used to illustrate the present invention, limit the scope of the invention and be not used in.The experimental technique of unreceipted actual conditions in the following example, usually condition routinely, " molecular cloning the experiment guide " (NewYork that writes as J. Sa nurse Brooker (Sambrook) etc., Cold Spring Harbor Laboratory Press, 1989) described in condition, or carry out according to the condition that manufacturer advises.The preparation method of embodiment 1:Exendin-4 polypeptide
Present embodiment utilizes the pET expression system of Novagen company to express Exendin-4, and pET32a (+) plasmid is an expression vector, and host cell is intestinal bacteria.
1. design and synthesize primer
Design primer 1,2,3,4 (sequence numbering 2,3,4,5), primer 1 are introduced enteropeptidase recognition site response dna sequence dna, introduce BglII and KpnI restriction enzyme site simultaneously, and primer 4 is introduced EcoRI and HindIII restriction enzyme site.Synthetic primer 1,2,3,4 (being respectively sequence numbering 2,3,4,5), (" the molecular cloning experiment guide " that the synthetic method is write referring to J. Sa nurse Brooker etc., 538-575 page or leaf).
2. with PCR method splicing Exendin-4 gene
Splice Exendin-4 gene (sequence numbering 6) with PCR method:
1) in the following order, each composition is mixed in 0.5ml sterilization centrifuge tube:
Aqua sterilisa 30ul
10X amplification buffer (worker is given birth in Shanghai) 10ul
4 kinds of dNTP mixtures, every kind of concentration is 1.25mmol/L 16ul
Primer 1 (25pmol) 1ul
Primer 2 (25pmol) 1ul
Primer 3 (25pmol) 1ul
Primer 4 (25pmol) 1ul
Taq enzyme (worker is given birth in Shanghai) 0.5ul
Add water to final volume 100ul
Add 100ul mineral oil
2) put into the PCR instrument, conditioned response be set, 94 ℃ of opening rotations 5 minutes, 50 ℃ 2 minutes, 72 ℃ 3 minutes, 94 ℃ of follow-up circulations 1 minute, 50 ℃ 2 minutes, 72 ℃ 3 minutes, 94 ℃ of end wheel circulations 1 minute, 50 ℃ 2 minutes, 72 ℃ 10 minutes.30 circulations are set, the pcr amplification gene.
After finishing, the Exendin-4 gene splicing cuts (1ulKpnI (magnificent company), 1ulHindIII (magnificent company), the 10ul sterilized water, reacted 1 hour by 37 ℃ for 15ulPCR product, 3ul 10X damping fluid [magnificent company]) with KpnI and HindIII enzyme.Exendin-4 gene fragment after electrophoresis reclaims and to obtain KpnI and HindIII enzyme and cut.
3. construction recombination plasmid (referring to Fig. 2)
Referring to Fig. 1, behind Exendin-4 gene clone and Trx (Trx) gene, have enteropeptidase (eternokinase) recognition site and six continuous Histidine sequences between Exendin-4 gene and Trx (Trx) gene.
1) cuts expression plasmid pET32a (+) (15ul plasmid pET32a (+) [Novagen company], 3ul 10X damping fluid [magnificent company], 1ulKpnI (magnificent company) with KpnI and HindIII enzyme, 1ulHindIII (magnificent company), the 10ul sterilized water, reacted 1 hour by 37 ℃).
2) electrophoresis reclaims pET32a (+) plasmid of cutting through KpnI and HindIII enzyme.
3) the expression plasmid pET32a (+) that will cut with KpnI and HindIII enzyme and KpnI are connected with Exendin-4 gene fragment after the HindIII enzyme is cut.The product that (5ul sterilized water, 1ul10X damping fluid [magnificent company], 1ul step 2) obtains, the product that 3ul step 2 obtains, 0.3ul ligase enzyme [magnificent company], 16 ℃, reaction is spent the night).
4) be transformed into bacillus coli DH 5 alpha (available from Invitrogen company), be coated on the LB flat board of band penbritin.
5) bacterium colony that grows is the transformant that contains recombinant plasmid 1, selects single bacterium colony, cultivates and the extracting plasmid in the LB substratum.
6) identical through dna sequence analysis with implementation sequence.
4. recombinant plasmid amalgamation and expression in host cell (intestinal bacteria)
1) with recombinant plasmid 1 transformed into escherichia coli BL21 (DE3) (available from Novagen company), with the amicillin resistance screening, get positive colony, be the expression engineering bacteria (pET32a (+)-Exendin-4/BL21 (DE3)) of Exendin-4.
2) will contain on the LB agar plate of 100 μ g/ml penbritins through the Exendin-4 engineering bacteria line of screening, cultivating 16 hours for 37 ℃.Select well-grown single bacterium colony, be inoculated in LB nutrient solution (containing Amp100 μ g/ml), 37 ℃ of overnight incubation.To spend the night bacterium to be inoculated in LB nutrient solution (containing Amp100 μ g/ml), 37 ℃ of shaking culture at 1: 20.Work as OD 600Reach at 0.6～0.8 o'clock, add IPTG, induced 6 hours to final concentration 0.5mM.Bacterium liquid is through 5000rpm, and 5min is centrifugal.Remove the substratum supernatant, the precipitation thalline adds sample-loading buffer, 100 ℃ of water-bath 3min, and SDS-PAGE electrophoresis (concentrating glue 5%, separation gel 15%), dyeing, decolouring, scanning analysis are gone up in centrifugal back.Because of the long 591bp of Trx-Exendin-4 fusion gene, fusion rotein contains 197 amino acid, and theoretical molecular is about 21.67KD.SDS-PAGE result shows: obvious band of expression (Fig. 3) is arranged between 14KD and 24KD, conform to expection, fusion rotein accounts for bacterial protein about 20%.The bacterial strain of screening high expression level is an engineering strain.
5. fermentation culture is expressed or the engineering bacteria of amalgamation and expression Exendin-4 polypeptide
Get a ring bacterial classification and insert in the LB nutrient solution on the engineering strain inclined-plane of above-mentioned preservation, 30 ℃ of 200rpm shake-flask culture inserted in the M9+LB nutrient solution by 10% inoculum size after 12-16 hour, 30 ℃ of 250rpm shake-flask culture 6 hours.Seed liquor is equipped with in the fermentor tank of M9+LB substratum by access amount adding in 1: 20, and 30 ℃, 400rpm cultivates, air flow 0.2vvm, and control pH value 7.0, dissolved oxygen (DO) is cultured to 4-6 hour more than 30%, and the DO value begins to add glucose when beginning to rise, to OD 600Be about at 20 o'clock, add IPTG to final concentration be 0.5mM, induce to stop fermentation in 3.5 hours.
6. purifies and separates obtains the Exendin-4 polypeptide
It is centrifugal that (6,000rpm) tunning of above-mentioned acquisition is to collect thalline.Ratio in 1: 10 overhangs 20mMPB with thalline, and in the damping fluid of 500mMNaCl, bacterium is broken in pressure homogenate, and pressure reaches 10,000psi.Centrifuged supernatant is crossed the Chelating Sepharose FF of pre-equilibration, and drip washing is used 20mMPB to baseline, 500mMNaCl, 150mM imidazole buffer wash-out, collect elutriant, behind ChelatingSepharose FF purifying, the Trx-Exendin-4 fusion rotein accounts for about 80% of total protein.Dialysis or ultrafiltration are changed and adjusted protein concentration behind the liquid is 2mg/ml.Add reorganization enteropeptidase (Invitrogen company) 0.3U/ml, 25-30 ℃ of reaction spent the night, and reaction solution transfers pH to 3.0 back to go up CM-Sepharose FF, and drip washing is used 20mMPB to baseline, the 300mMNaCl wash-out, collect elutriant, behind the adding 0.1%TFA, last Source 30RPC post, use 0.1%TFA after the drip washing, 50% acetonitrile gradient wash-out is collected elution peak, and Sephadex G-25 removes sampling analysis behind the acetonitrile.SDS-PAGE or RP-HPLC detect purity greater than 95% (referring to Fig. 6).The preparation method of embodiment 2:Exendin-4 polypeptide
Present embodiment as the pPIC9 plasmid, is a host cell expression Exendin-4 gene with the yeast with Invitrogen company pichia expression vector.
1. design and synthesize primer
Design primer 5 is introduced XhoI restriction enzyme site and yeast signal peptide cleavage site (KEX2 enzyme recognition site), synthetic primer 5 (sequence numbering 7), (synthetic method is referring to " molecular cloning experiment guide ", 538-575 page or leaf) in the primer 5.
2. with PCR method splicing Exendin-4 gene
Splice Exendin-4 gene (sequence numbering 8) with PCR method:
1) in the following order, each composition is mixed in 0.5ml sterilization centrifuge tube:
Aqua sterilisa 10ul
10X amplification buffer (give birth in Shanghai) 10ul
4 kinds of dNTP mixtures, every kind of concentration is 1.25mmol/L 16ul
Primer 5 (25pmol) 1ul
Primer 4 (25pmol) 1ul
Recombinant plasmid 1 2ug
Taq enzyme (worker is given birth in Shanghai) 0.5ul
Add water to final volume 100ul
Add 100ul mineral oil
2) put into the PCR instrument, reaction conditions be set, 94 ℃ of opening rotations 5 minutes, 50 ℃ 2 minutes, 72 ℃ 3 minutes, 94 ℃ of follow-up circulations 1 minute, 50 ℃ 2 minutes, 72 ℃ 3 minutes, 94 ℃ of end wheel circulations 1 minute, 50 ℃ 2 minutes, 72 ℃ 10 minutes.React 30 circulations, the pcr amplification gene.
Electrophoresis reclaims gene fragment, cuts processing (1ulXhoI (magnificent company), 1ulEcoR I (magnificent company), the 10ul sterilized water, reacted 1 hour by 37 ℃ for 15ulPCR product, 3ul 10X damping fluid [magnificent company]) with Xho I and EcoRI enzyme.Reclaim.
3. construction recombination plasmid
1), cuts pPIC9 plasmid (Invitrogen company) with XhoI and EcoRI enzyme referring to Fig. 5.(the 15ulpPIC9 plasmid, 3ul 10X damping fluid [magnificent company], 1ulXho I (magnificent company), 1ulEcoR I (magnificent company), the 10ul sterilized water, reacted 1 hour by 37 ℃).
2) electrophoresis reclaims
3) reclaim fragment and is connected the product that (5ul sterilized water, 1ul10X damping fluid [magnificent company], 1ul step 2) obtains with gene fragment after the EcoRI enzyme is cut through XhoI, the product of 3ul step 2 acquisition, 0.3ul ligase enzyme [magnificent company], reacts and spends the night by 16 ℃).
4) transformed into escherichia coli DH5 α (available from Invitrogen company) is coated on the LB flat board of band penbritin.
5) the screening transformant gets recombinant plasmid 2 (referring to Fig. 4)
6) correct through order-checking proof sequence.
4. recombinant plasmid amalgamation and expression in host cell (yeast)
A large amount of extracting recombinant plasmids 2 are used the SalI linearizing, with the dehydrated alcohol precipitation, dry after 70% washing with alcohol then, are dissolved in (concentration is about 1 μ g/ μ L) in an amount of TE solution.Electricity transforms the GS115 host bacterium for preparing then, is coated on the MD screening culture medium, cultivates 3 days, and obtains yeast transformant for 30 ℃.
Select 20 mono-clonals to inoculate 3ml respectively to the MGY substratum from the MD flat board, 30 ℃ of cultivations add 27ml MM substratum after 48 hours induces, and expresses 72 hours, and sampling is carried out SDS-PAGE and detected, and the bacterial strain of screening high expression level is an engineering strain.
5. fermentation culture is expressed or the engineering bacteria of amalgamation and expression Exendin-4 polypeptide
With the engineering strain of above-mentioned acquisition be inoculated in the BMGY substratum 30 ℃ cultivate 24 hours after, be inoculated in the fermentor tank as seed liquor, fermention medium is the solution that basic medium is incorporated as secondary element, 30 ℃ of leavening temperatures, pH5.0, the control dissolved oxygen is not less than 30%, and thalli growth begins to add glycerine after 24 hours, simultaneously pH is transferred to 3.0.Thalline OD reaches at 200 o'clock begins to add the methanol induction expression.Initial methyl alcohol addition is controlled to be 1-2ml/L. hour, increases to 15-20ml/L. hour subsequently gradually, keeps oxygen dissolving value greater than 30% by regulating whipping temp and air flow, feeds pure oxygen in case of necessity.Continuous induction is cultivated after 72 hours and is gathered in the crops nutrient solution, centrifugal collection supernatant.
6. purifies and separates obtains the Exendin-4 polypeptide
With the centrifugal collection supernatant of the tunning of above-mentioned acquisition, with the supernatant ultrafiltration and concentration, on use the CM-Sepharose FF post of 20mMPB pre-equilibration, drip washing is used 150mMNaCl to baseline, the 20mMPB wash-out, collect elution peak, go up Source 30RPC post behind the adding 0.1%TFA, drip washing is used 0.1%TFA to baseline, 30% Virahol wash-out, collect elution peak, cross Sephadex G-25 and remove sampling analysis behind the Virahol, SDS-PAGE or RP-HPLC detect purity greater than 95% (referring to Fig. 7).
1.82. ( 1 ) 1 ( A ) ：39 ( B ) ：1：HisGlyGluGlyThr PheThrSerAspLeu SerLysGlnMetGlu GluGluAlaValArgLeuPheIleGluTrp LeuLysAsnGlyGly ProSerSerGlyAla ProProProSer ( 2 ) 2： ( A ) ：57bp ( B ) ：2：GCCCAGATCT GGGTACCGAT GACGATGACA AGCATGGCGAAGGTACATTT ACCAGTG ( 3 ) 3 ( A ) ：48bp ( B ) ：3：ACATTTACCA GTGACTTGTC AAAACAGATG GAAGAGGAGGCAGTGCGC ( 4 ) 4 ( A ) ：48bp ( B ) ：4：CGGGCCACCG TTCTTAAGCC ACTCAATAAA TAAGCGCACTGCCTCCTC ( 5 ) 5： ( A ) ：56bp ( B ) ：5：CGCAAGCTTG AATTCATTAC GATGGCGGAG GTGCCCCGCTACTCGGGCCA CCGTTC ( 6 ) 6： ( A ) ：168bp ( B ) ：6GCCCAGATCT GGGTACCGAT GACGATGACA AGCATGGCGA AGGTACATTT 50CGGGTCTAGA CCCATGGCTA CTGCTACTGT TCGTACCGCT TCCATGTAAAACCAGTGACT TGTCAAAACA GATGGAAGAG GAGGCAGTGC GCTTATTTAT 100TGGTCACTGA ACAGTTTTGT CTACCTTCTC CTCCGTCACG CGAATAAATATGAGTGGCTT AAGAACGGTG GCCCGAGTAG CGGGGCACCT CCGCCATCGT 150ACTCACCGAA TTCTTGCCAC CGGGCTCATC GCCCCGTGGA GGCGGTAGCAAATGAATTCA AGCTTGCG 168TTACTTAAGT TCGAACGC ( 7 ) 7 ( A ) ：32bp ( B ) ：7：GTATCTCTCG AGAAAAGACA TGGCGAAGGT AC ( 8 ) 8 ( A ) ：154bp ( B ) ：8：GTATCTCTCG AGAAAAGACA TGGCGAAGGT ACATTTACCA GTGACTTGTC 50CATAGAGAGC TCTTTTCTGT ACCGCTTCCA TGTAAATGGT CACTGAACAGAAAACAGATG GAAGAGGAGG CAGTGCGCTT ATTTATTGAG TGGCTTAAGA 100TTTTGTCTAC CTTCTCCTCC GTCACGCGAA TAAATAACTC ACCGAATTCTACGGTGGCCC GAGTAGCGGG GCACCTCCGC CATCGTAATG AATTCAAGCT 150TGCCACCGGG CTCATCGCCC CGTGGAGGCG GTAGCATTAC TTAAGTTCGATGCG 154ACGC

Claims (5)

1. the preparation method of an Exendin-4 polypeptide is characterized in that, this method comprises:
1. design and synthesize primer;
2. with PCR method splicing Exendin-4 gene;
3. use expression vector establishment to contain the recombinant plasmid of Exendin-4 gene;
4. change recombinant plasmid over to host cell, acquisition amalgamation and expression or non-fusion expression Exendin-4 polypeptide
Engineering bacteria;
5. the engineering bacteria of fermentation culture amalgamation and expression or non-fusion expression Exendin-4 polypeptide;
6. purifies and separates obtains the Exendin-4 polypeptide.
2. preparation method as claimed in claim 1, it is further characterized in that, described step 1. in, comprise designing and synthesizing primer, and introduce restriction enzyme site.
3. preparation method as claimed in claim 2, it is further characterized in that, described primer can be to be used to splice the Exendin-4 gene, can be primer 1 (sequence numbering 2), primer 2 (sequence numbering 3), primer 3 (sequence numbering 4), primer 4 (sequence numbering 5), or primer 5 (sequence numbering 7); The restriction enzyme site of described introducing can be the required restriction enzyme site of construction recombination plasmid, can be BglII, KpnI, EcoRI, HindIII, XhoI, or yeast signal peptide cleavage site (KEX2 enzyme recognition site).
4. preparation method as claimed in claim 1, it is further characterized in that, described step 3. in, described expression vector can be a prokaryotic expression carrier, can be carrier for expression of eukaryon also, comprises pET32a (+) plasmid, pBV220 plasmid, pPIC9 plasmid, or YES TMCarrier.
5. preparation method as claimed in claim 1, it is further characterized in that, described step 4. in, described host cell can be a prokaryotic host cell, comprises intestinal bacteria, or Bacillus subtilus; Can be eukaryotic host cell also, comprise yeast cell, insect cell, or mammalian cell.
CN 02111563 2002-04-29 2002-04-29 Exendin-4 polypeptide preparation method Pending CN1455001A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 02111563 CN1455001A (en) 2002-04-29 2002-04-29 Exendin-4 polypeptide preparation method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 02111563 CN1455001A (en) 2002-04-29 2002-04-29 Exendin-4 polypeptide preparation method

Publications (1)

Publication Number Publication Date
CN1455001A true CN1455001A (en) 2003-11-12

Family

ID=29256827

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 02111563 Pending CN1455001A (en) 2002-04-29 2002-04-29 Exendin-4 polypeptide preparation method

Country Status (1)

Country Link
CN (1) CN1455001A (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100388A1 (en) * 2004-04-19 2005-10-27 Biocon Limited Production of insulinotropic peptides
CN1318587C (en) * 2004-04-30 2007-05-30 成都芝田生物工程有限公司 Recombination preparation method of amidating Exendin-4 polypeptide
CN101586104B (en) * 2008-05-19 2010-11-24 河南农业大学 Method for constructing Exendin-4 high-yielding engineering bacterial strain
CN101525386B (en) * 2008-03-05 2011-09-07 浙江华阳药业有限公司 Fusion protein of Exendin-4 tandem polypeptide and human serum albumin, preparation and application thereof
CN101240033B (en) * 2008-03-04 2011-10-05 无锡和邦生物科技有限公司 Fusion protein of insulin secretion accelerating peptide and human serum albumin, and preparation method thereof
CN112552392A (en) * 2020-12-18 2021-03-26 北京博康健基因科技有限公司 Purification method of recombinant Exendin-4 polypeptide
CN112608964A (en) * 2020-12-18 2021-04-06 北京博康健基因科技有限公司 Fermentation method for large-scale production of recombinant Exendin-4 polypeptide

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005100388A1 (en) * 2004-04-19 2005-10-27 Biocon Limited Production of insulinotropic peptides
CN1318587C (en) * 2004-04-30 2007-05-30 成都芝田生物工程有限公司 Recombination preparation method of amidating Exendin-4 polypeptide
CN101240033B (en) * 2008-03-04 2011-10-05 无锡和邦生物科技有限公司 Fusion protein of insulin secretion accelerating peptide and human serum albumin, and preparation method thereof
CN101525386B (en) * 2008-03-05 2011-09-07 浙江华阳药业有限公司 Fusion protein of Exendin-4 tandem polypeptide and human serum albumin, preparation and application thereof
CN101586104B (en) * 2008-05-19 2010-11-24 河南农业大学 Method for constructing Exendin-4 high-yielding engineering bacterial strain
CN112552392A (en) * 2020-12-18 2021-03-26 北京博康健基因科技有限公司 Purification method of recombinant Exendin-4 polypeptide
CN112608964A (en) * 2020-12-18 2021-04-06 北京博康健基因科技有限公司 Fermentation method for large-scale production of recombinant Exendin-4 polypeptide

Similar Documents

Publication Publication Date Title
RU2354703C2 (en) Producing il-21 in prokaryotic host cells
WO2022012020A1 (en) Preparation method for glp-1 analogue polypeptide and use thereof in type ii diabetes
CN1924006A (en) Anti-glioma peptide of scorpion, preparation method and application thereof
WO2023045682A1 (en) Method for increasing soluble expression quantity of polypeptide
CN1455001A (en) Exendin-4 polypeptide preparation method
CN1916172A (en) Method for preparing parathormone 1-34
CN107043757B (en) Recombinant pichia pastoris for heterologous high-efficiency expression of rhizomucor miehei lipase and application thereof
CN1793375A (en) Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor
CN1746302A (en) Production of Non-N glycosylated protein from yeast
CN1105727C (en) Process for preparing recombined human serum albumin
CN1861790A (en) Preparation process of human recombined parathyroid hormone 1 84
CN101037692A (en) Method for expressing human insulin by using plant seed oil body
CN101067118A (en) Expression of recombinant cow follitropin in Pichia yeast
CN102936602A (en) Recombinant human insulin-like growth factor-2 protein and production method thereof
CN112646044B (en) TFF2-Fc fusion protein and high-efficiency expression production method thereof
CN113249288B9 (en) Recombinant bacterium for expressing GLP-1 analogue and application thereof
CN1163608C (en) Procaryon secreted expression carrier and its use
CN101067138A (en) Gene engineering process of preparing human hair papilla cell protein HSPC016 and its expression vector and engineering bacterium
CN1560229A (en) Process of preparing D-amino acid oxydase
CN1560258A (en) Preparation process of antibacterial peptide
CN1268751C (en) Purification method of recombinant yeast strain and rhGM-CSF to express human granulocyte-macrophage colony stimulating factor
CN1225481C (en) Recombinant fusion resisting tomur attack and transfer
CN1485431A (en) Gene engineering yeast strain of expressing beta-1,3-1,4-glucanase
CN118308360B (en) Promoter for driving gene to express human serum albumin in yeast and application
CN1185012C (en) DNA vaccine pVFS for SARS virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication