CN108707591A - A kind of preparation and purification method and its application of DAO albumen - Google Patents
A kind of preparation and purification method and its application of DAO albumen Download PDFInfo
- Publication number
- CN108707591A CN108707591A CN201810579401.5A CN201810579401A CN108707591A CN 108707591 A CN108707591 A CN 108707591A CN 201810579401 A CN201810579401 A CN 201810579401A CN 108707591 A CN108707591 A CN 108707591A
- Authority
- CN
- China
- Prior art keywords
- dao
- albumen
- preparation
- purification method
- prepared
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
- C12N9/0024—D-Amino acid oxidase (1.4.3.3)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/03—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
- C12Y104/03003—D-Amino-acid oxidase (1.4.3.3)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Neurosurgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Psychiatry (AREA)
- Neurology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention proposes a kind of preparation and purification method of DAO albumen, includes the following steps：Step 1: prepared by plasmid；Step 2: the expression of protein；Step 3: the purifying of protein.The molecular weight of the DAO-6H is 38kDa, is analyzed via Western blotting, is detected and is found using anti-His antibody, and DAO-6H has solvable part for purifying.DAO albumen prepared by the present invention is the albumen being had a major impact in schizophrenia, its preparation and purification can be used in a series of researchs of schizophrenia pathology, contribute to further investigation of the modern medicine for mental illness, method is provided to capturing the series of disease.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to a kind of preparation and purification method of DAO albumen.
Background technology
Genetics research finds that schizophrenic onset mechanism is the result of multiple Disease-causing genes accumulation in vivo.With point
The development of sub- biology, more and more researchs confirm schizophreniac, and there are the exceptions in terms of gene, including dopamine
D2 and D3 acceptor genes, reelin genes, GIuR6 genes, mthfr gene, NRGl genes and bdnf genes etc..In mammal
In there are D types serine (D-ser), research later finds mammal including humans, and in central nervous system, there are areas
The high concentration D-ser of domain property.Research shows that D-ser has the activation efficiency more stronger than glycine.Serine racemase enzyme (SR)
Can specificity catalysis L-ser be converted into D-ser；DAO is present in mammalian central nervous system and surrounding tissue, plays
It and neutrality D-ser is promoted to aoxidize the effect to deaminize, this enzyme plays an important role in the metabolic process of D-ser.With just
Ordinary person is reduced respectively compared to schizophrenia, severe depression and Bipolar Disorder patient cortex of frontal lobe and the SR of hippocampus
39% and 21%, in cortex of frontal lobe DAO and unchanged, and obviously increased in hippocampus DAO albumen.CSF of schizophrenic patients
D-ser levels are to reduce.
DAO, D conformation amino acid oxidase are a kind of using FAD as the flavoprotein of prothetic group, are existed in the form of dimer
In human liver, kidney and brain, there is optically-active specificity to receptor, can D type amino acid be subjected to oxidative deamination, generated
Ammonia and corresponding α types ketone acid, while oxygen molecule is reduced into hydrogen peroxide.Have been found that DAO is controllable in human brain at present
D-serine and the activity for influencing nmda receptor.DAO is pointed out in many documents can degrade the D- of glial cell in brain
Serine, this phenomenon may be related to schizophrenia.Although DAO was just sent out early in 1988, just start in recent years
Have and largely is reported out about DAO correlative studys.
Miranda etc. is isolated to SR genes in normal human blood for the first time, and research finds SR genetic mutations and spirit point
Splitting disease has correlation, then it has also been found that SR genes and schizophrenia are closely related.Xi'an region DAO gene polynorphisms with
Schizophrenia has correlation.Case-control is used in 340 normal persons of Japanese population pair and 340 schizophreniacs
Research, as a result, it has been found that DAO haplotypes are with schizophrenia, there are relevances.Research in Irish crowd is it has also been found that DAO bases
Because closely related with schizophrenia.Distribution and storage machine for releasing of the synthesis in relation to D-ser with metabolism, in central nervous system
System has more report both at home and abroad, and gene is the internal factor for determining character, rests on base for the research of SR and DAO at present
Because on sequence level, the property that protein three-dimensional structure is risen to by gene is rarely reported at home.Three-dimensional structure details
Missing, can hinder the further research of the function to the albumen, catalytic mechanism etc..Use homologous modeling and molecular dynamics simulation
Method can be advantageously applied to the theoretical modeling of large biological molecule, and guide experimental phenomena.
Invention content
In order to solve the above technical problems, the present invention provides a kind of preparation and purification method and its application of DAO albumen,
It is intended that obtaining the higher DAO albumen of purity, by the DAO albumen of the purifying, it to be used for a system of schizophrenia pathology
In row research, contributes to further investigation of the modern medicine for mental illness, method is provided to capturing the series of disease.
The present invention provides a kind of preparation and purification method of DAO albumen, includes the following steps：
Step 1: prepared by plasmid：Using cDNA as template, primer is added and carries out PCR, after carrying out 30 cycles, with Pro-Taq
After DAO gene magnifications, DAO is accessed after enzyme NdeI and XhoI processing in pET23a (+) plasmid, it is solidifying by agar
Gel electrophoresis and the purifying of DNA Gel fragments, obtain PCR product after purification, with restriction enzyme NdeI and XhoI processing purifying
Later DAO segments and pET23a (+) carrier so that DAO-6H has palindromic sequence that can be complementary with pET23a (+), with agaropectin
Carrier and DAO segments are purified from colloid, and with restriction enzyme HindIII and BamHI processing purifying, ligase and buffer solution is added
It is reacted 2 hours at 25 DEG C, so that DAO is engaged into pET23a (+) carrier, be then transformed into Escherichia coli Top10F ', in 37 DEG C
Culture to the next day, and after confirming successful connection with bacterium colony PCR methods bacterium colony is provoked sequencing company is sent to be sequenced, confirm that sequence is correct
After errorless prepared by i.e. completion plasmid, completes i.e. DAO- of the Escherichia coli TOP10F ' great expressions with His-tag after prepared by plasmid
6H；
Step 2: the expression of protein：The plasmid for expressing DAO-6H is transferred to competent escherichia coli cell bacterial strain, picking
Single bacterium colony is incubated in LB culture solutions, and in culture solution China and foreign countries plus ampicillin and chloramphenicol, after 37 DEG C of cultures overnight,
The fresh LB of 0.5ml additions 5ml are taken out from culture solution to cultivate in 37 DEG C, when cell concentration reaches OD600 to 0.4-0.6,
Temperature is maintained at 25 DEG C, additional ultimate density is the isopropylthiogalactoside of 0.5mM, after culture overnight, takes out 1ml bacterium
Suitable PBS is added later with centrifugation, removal supernatant at 4 DEG C in body, and Ultrasonic Cell Disruptor breaks cell wall, divides after centrifugation
Separate out soluble matter and insoluble object；
Step 3: the purifying of protein：The Escherichia coli for expressing DAO-6H albumen are dissolved in combination buffer, and are added
Protease inhibitors, then broken cell is shaken with Ultrasonic Cell Disruptor, in 4 DEG C, cell fragment is removed in 20 minutes with centrifugation, filters supernatant
The injection of this supernatant is cleaned tubing string by liquid in advance by the metal chelate chromatography tubing string of combination buffer with cleaning buffer solution,
Then DAO-6H albumen is flushed out with dcq buffer liquid.
As further improvement of the invention, primer is：
pET23a-DAO-6H:
DAO-F’-NdeI:ATATCATATGCGTGTGGTGGTGATTGG
DAO-R’-XhoI:TATACTCGAGGAGGTGGGATGGTGGCATTC。
As further improvement of the invention, the Tris-HCl that combination buffer is 7.9 by 0.5M NaCl and 20mM pH
It is prepared.
As further improvement of the invention, for protease inhibitors by 1mM phenylmethylsulfonyl fluorides, 0.04mM 1,10- is adjacent luxuriant and rich with fragrance
Hello quinoline, 0.04mM benzamidine hcls are prepared.
As further improvement of the invention, the aperture of filter is 0.45 μm.
It is improved as of the invention further, Tris-HCl that cleaning buffer solution is 7.9 by 0.5M NaCl, 20mM pH,
Penta ring of 10mM-100mM 1,3- diaza is prepared, the Tris- that dcq buffer liquid is 7.9 by 0.5M NaCl, 20mM pH
Penta ring of HCl and 300mM-1M 1,3- diazas is prepared.
As further improvement of the invention, centrifugal condition 9000rpm-15000rpm.
As further improvement of the invention, a concentration of 50 μ g/ml of ampicillin, a concentration of 25 μ of the chloramphenicol
g/ml。
The present invention, which further protects, a kind of to exist the DAO albumen obtained according to the preparation and purification method of above-mentioned DAO albumen
Treat the application in schizophrenia drug.
The present invention has the advantages that：
The present invention will recombinate DAO using Protocols in Molecular Biology and express and be purified, and obtain the higher DAO eggs of purity
In vain, it can be applied in a series of researchs of schizophrenia pathology, modern medicine is contributed to go deep into mental illness
Research, method is provided to capturing the series of disease.
Description of the drawings
Fig. 1 is the preparation and purification process flow chart of DAO albumen；
Fig. 2 is the electrophoretic analysis of DAO protein expression plasmids；M：DNA standard items；PET23a-DAO-6H is with restriction enzyme
After NdeI and XhoI processing and carry out electrophoretic analysis；
Fig. 3 selects figure for high expression quantity bacterium colony；M:Protein standard substance, No. 1 to No. 8 is the albumen expressed by different bacterium colonies
As a result matter shows the DAO-6H expression quantity no significant differences of No. 2 to No. 8 bacterium colonies by thalline with SDS-PAGE electrophoretic analysis；
Fig. 4 is to purify DAO-6H with AKTA prime；
Fig. 5 is classified as the 1st through the residue after tubing string, and the 2nd, 3,4 row are respectively that 1,3 diaza, penta rings are a concentration of
The nonstandard albumen for being eluted out when 60mM, 100mM, and the 5th, 6,7,8 row are then a concentration of 150mM of 1,3 diaza, penta ring
The sample DAO-6H flushed out, molecular weight 38kDa；
Fig. 6 is to express recombinant proteins from No. 2 to No. 4 bacterial strains of picking in Fig. 3 and divide supernatant (Soluble after breaking thalline
) and sediment (Insoluble fraction) fraction；
Fig. 7 is Western blotting analysis charts, and DAO-6H albumen is proved using anti-His, is soluble protein (S),
But still it is insoluble (I) to have small part；
Specific implementation mode
Below in conjunction with the embodiment of the present invention, technical solution in the embodiment of the present invention carries out clear, complete description,
Obviously, the embodiment described is the embodiment of the part of representative of the present invention, rather than whole embodiments, this field are general
Other all embodiments that logical technical staff is obtained without making creative work belong to the protection of the present invention
Range.
The preparation and purification of 1 DAO albumen of embodiment
1, bacterial strain and plasmid (table 1)
1 research bacterial strain of table and plasmid
| Bacterial strain and plasmid | Description |
| E. coli Top10F | Preparation for plasmid |
| E. coli BL21 (DE3) pLysS | For protein expression |
| PGEM-T easy plasmids | It is cloned for T-A |
| PET23a (+) plasmid | For protein expression |
2, primer
pET23a-DAO-6H:
DAO-F’-NdeI:ATATCATATGCGTGTGGTGGTGATTGG
DAO-R’-XhoI:TATACTCGAGGAGGTGGGATGGTGGCATTC
3, the preparation of main solution and culture medium
(1) plasmid extraction reagent：
(1) solution I：50mM glucose, 25mM Tris-Cl (PH8.0), 10mM EDTA (PH8.0)；Solution II：0.2M
NaOH, 1%SDS (match) before use；
Solution III：60ml 5M potassium acetates, 11.5ml glacial acetic acids, 28.5ml distilled water
(2) 3M sodium acetates (PH 5.2)：It weighs 40.8gNaAc to be added in DDW, it is about 60ml to make total volume, is heated to 68
DEG C hydrotropy, ice acetic acid are adjusted to PH5.2, and solution, which is cooled to room temperature, is settled to 100ml.
1.034 × 105Pa, 20min high pressure sterilization, room temperature storage.
(3) TE buffer solutions (PH8.0)：10mM Tris-Cl (PH8.0), 1mM EDTA (PH8.0).
(4) STE solution：0.1M NaCl, 10mM Tris-Cl (PH8.0), 1mM EDTA.
(2) agarose gel electrophoresis buffer solution (50 × TAE)：Tris 242g；Glacial acetic acid 57.1ml；0.5M EDTA
(PH8.0)100ml；Distilled water is added to be settled to 1000ml, room temperature preservation.Working solution dilutes 50 times.
(3) LB culture solutions and culture medium：Tryptone 10g；Yeast Extract 5g；NaCl 10g, add distilled water
To 900ml, adjusts pH value to 7.0~7.2 with 5N NaOH (about 200 μ l), be settled to 1L, 20~30min of high pressure sterilization, set 4 DEG C of storages
It deposits spare；It is solid LB media that 15g agar powders are added in every liter of LB liquid, and 20~30min of high pressure sterilization sets 4 DEG C of storages
It deposits spare.
(4) PBS (PH 7.4)：NaCl 8g；KCl 0.2g；Na2HPO4 1.42g；KH2PO4 0.27g, add deionization
Water fully dissolves, and it is 7.4 that concentrated hydrochloric acid, which adjusts pH value, is settled to 1L, high temperature and pressure 20min sterilizings, room temperature preservation.
(5) protein electrophoresis related reagent
1 × Tris-Glycine of protein electrophoresis buffer solution：Tris.HCl 25mM, Glycine250mM, SDS0.1%,
pH8.3
Fixer：Ethyl alcohol 400ml, glacial acetic acid 100ml, adds water to 1,000ml
Coomassie brilliant blue staining liquid：0.29g Coomassie brilliant blue G250s, add water to 250ml
Destainer：Ethyl alcohol 250ml, glacial acetic acid 80ml, adds water to 1,000ml
(6) Western blot related reagents
Transferring film buffer solution：Glycine2.9g, Tris.base 5.8g, SDS0.27g add water to 1,000ml, before use
The methanol of fresh addition 20%；
TBS：Tris-HCl 50mM (pH7.6), NaCl 150mM；
TBST：Tris-HCl 50mM (pH7.6), NaCi 150mM, 0.1%Tween20；
Confining liquid：5% skimmed milk power, is dissolved in TBST；
Alkaline phosphatase substrate buffer solution：NaCl 100mM, MgCl25mM, Tris-HCl 100mM, pH9.5.
(7) protein purification related reagent
The cleaning buffer solution of SsaX protein purifications：50mM HEPES, pH 7.4,1mM EDTA, 50mM 1,3- diazas penta
Ring；
The dcq buffer liquid of SsaX protein purifications：50mM HEPES, pH 7.4, l mM EDTA, 200mM 1,3- diazas
Penta ring；
SsaX albumen preserves buffer solution：50mM HEPES, pH 7.4,10%glycerol, 2mM DTT.
4, toolenzyme and antibody
Restriction enzyme, T4DNA ligases, 10. HS DNAPolymerase are biological purchased from treasured by RNase, PrimeSTAR
(Dalian) Engineering Co., Ltd；Lysozyme is purchased from Sigma companies；Proteinase K and intestinal alkaline phosphatase are purchased from NEB companies；It is small
Horse anti-mouse IgG (H+L) antibody of the anti-His-tag monoclonal antibodies of mouse and alkali phosphatase enzyme mark is purchased from China fir gold in Beijing
Bridge Bioisystech Co., Ltd.
5, DNA and Protein Marker
DNAmarker is purchased from precious biological (Dalian) Engineering Co., Ltd；1Kb plus DNA ladder and 100bp plus
DNA ladder are purchased from Beijing Quanshijin Biotechnology Co., Ltd.
6, kit
DNA gel recovery purifying kit and the small extraction reagent kit of plasmid are purchased from Beijing Quanshijin Biotechnology Co., Ltd；
TA Cloning Kits are purchased from Promega companies.
7, prepare and purify method：
Step 1: prepared by plasmid
(1) monoclonal screens
(1) polymerase chain reaction
Using cDNA as template, and above-mentioned primer is added and carries out PCR, reaction condition is respectively 95 DEG C of reaction of degeneration (RD), 30 seconds, move back
55 DEG C of fire, 30 seconds, 72 DEG C, 1 minute of extension.After carrying out 30 cycles, DAO genes can expand.With Pro-Taq by DAO
After gene magnification, accesses in pGEM-T easy plasmids and confirm that sequence is correct.It will after enzyme NdeI and XhoI processing by DAO
It is accessed in pET23a (+) plasmid.In addition also by DAO with BamHI and HindIII processing, pMAL-C2G plasmids are accessed.It is inverted
Effect is chosen single bacterium colony after plasmid is sent into E. coli Top10F ' and send biotechnology public after being confirmed with PCR again
Department is sequenced.
With the DAO segments of PCR amplification to be engaged with pET23a (+) carrier after restriction enzyme NdeI and XhoI cutting.The base of DAO
Because length is 1,044 base-pair, pET23a (+) plasmid is 3,586 base-pairs.As shown in Figure 1, DAO is successfully engaged in
PET23a (+) carrier, the plasmid size in conjunction with completion is about 4,630bp and 4,047bp, and the C-terminal band His-tag of this gene can
It is used for protein purification.
(2) agar gel body electrophoretic analysis
Coordinate DNA fragmentation size, weighing the heating of agar Icing Sugar according to required concentration is dissolved in 1 × TBE buffer (90mM
Tris, 90mM H3BO3,2mM EDTA pH 8.0) in, stripping fork is plugged, room temperature condensation is placed in, is configured to the glue of debita spissitudo
Body.Wait for removing stripping fork after colloid solidification, colloid be positioned over electrophoresis tank, be added TBE buffer to colloid be completely soaked in
In buffer.The sample DNA analyzed and 6 × DNAloading dye (PROTECH) are intended to 5:1 injects colloid after mixing
Groove in, and be added with specified molecular weight standard items.Confirm that electrophoresis direction is cathode toward after positive, proceeds by electricity
Swimming.Colloid is soaked in EtBr (10mg/ml, AMRESCO) stain and dyes 15 minutes after completing by electrophoretic analysis, then by colloid
It is placed under UV lamp system (ImageQuant 300) and observes and photograph to record, sample dna fragment can be compared using DNA standard items
Size.
(3) DNA Gel fragments purify
By PCR product by DNA gel electrophoresis after, observed under UV lamp system, target fragment cut, be mounted in
In 1.5ml microcentrifugal tubes, DNA is purified using colloid purification kit.The DF buffer of 500 μ l are first added and add
Heat waits for that colloid all dissolves to 60 DEG C, then the sample of dissolving is added in the micro tubing strings of DF, and room temperature centrifuges 10,000rpm, 30 seconds,
The waste liquid of tubing string lower layer is outwelled, 0.7ml cleaning buffer solutions (spirituosity) are added, room temperature centrifuges 10,000rpm, 30 seconds, in repetition
After stating step, then with 12,000rpm, centrifuge 2 minutes, to remove residual alcohol.The lower layer of the micro tubing strings of DF is changed into new micro-
Centrifuge tube is measured, 50 μ l dcq buffer liquid are added, after being placed in room temperature 2 minutes, is centrifuged 12,000rpm, 2 minutes.In micro after centrifugation
Liquid is PCR product after purification in centrifuge tube.
(4) endonuclease reaction is limited
Method described above from after being purified colloid, handles target gene after purifying with restriction enzyme NdeI and XhoI
DAO segments and pET23a (+) carrier so that DAO-6H has palindromic sequence that can be complementary with pET23a (+).It is carried for pMAL-c2G
Body is purified carrier and DAO segments from colloid with agaropectin, and with restriction enzyme HindIII and BamHI processing purifying.
(5) DNA connection reaction
The DAO DNA fragmentations crossed by restriction enzyme treatment is mixed with pET23a (+) carrier equally through restriction enzyme treatment respectively
It is reacted 2 hours at 25 DEG C with rear addition ligase and buffer solution, so that DAO is engaged into pET23a (+) carrier, be then transformed into
Escherichia coli Top10F '.In 37 DEG C of cultures to the next day, and bacterium colony provoked send survey after confirming successful connection with bacterium colony PCR methods
Sequence company is sequenced, and confirms that sequence is correctly completed plasmid and prepared afterwards.Completing can Escherichia coli after prepared by plasmid
TOP10F ' great expressions carry the DAO-6H of His-tag.
(2) plasmid purification
By the Escherichia coli after conversion using the single bacterium colony of toothpick picking, it is put into the LB that 5ml contains corresponding antibiotic
Test tube is placed in 37 DEG C and cultivates 16~18 hours, and bacterium solution is centrifuged with 12,000rpm, supernatant is removed, reagent is carried using plasmid is small
Box (Gene-Spin) extracts plasmid.The buffer solution I that 0.2ml is added in the first step breaks up the thalline of deposition, adds 0.2ml's
Buffer solution II, which is spun upside down to solution, to be presented limpid, is eventually adding after the buffer solution III of 0.2ml and is uniformly mixed, centrifugation 12,
000rpm, 5 minutes.Supernatant is taken out after centrifugation and is added in micro tubing string, centrifuges 12,000rpm, 30 seconds, outwells micro tube
Waste liquid under column.0.7ml cleaning buffer solutions are added, centrifuges 30 seconds, outwells the waste liquid under micro tubing string, it is clear that 0.7ml is added again
Wash buffer centrifuges 30 seconds, outwells the waste liquid under micro tubing string, then with 12,000rpm, centrifuge 2 minutes to remove residual alcohol.
The lower layer of micro tubing string changes into new microcentrifugal tube, 100 μ l dcq buffer liquid are added, after being placed in room temperature 2 minutes, with 12,
000rpm is centrifuged 2 minutes.Liquid is the plasmid extracted in microcentrifugal tube.
Step 2：The preparation of albumen：
The plasmid for expressing DAO-6H and G72-6H is transferred to single bacterium colony training of E.coli BL21 (DE3) pLysS and picking
It supports in LB culture solutions, and in culture solution China and foreign countries plus ampicillin (50 μ g/ml) and chloramphenicol (25 μ g/ml).It is overnight in 37 DEG C
After culture, 0.5ml is taken out from culture solution, the fresh LB of 5ml are added in 37 DEG C of cultures, when cell concentration reaches predetermined OD600
When to 0.4-0.6, temperature is maintained at 25 DEG C, the IPTG (isopropyl-β-D thio half that then additional ultimate density is 0.5mM again
Lactoside).Behind 0,1,2,3,4 hour and culture overnight, takes out 1ml thalline and centrifuged with 12,000rpm at 4 DEG C, in removal
Suitable PBS is added after clear liquid to break cell wall with Ultrasonic Cell Disruptor, may separate out after centrifugation soluble matter with can not
Molten object.Suitable soluble matter and insoluble object is taken to analyze DAO-6H with 12% and 15%SDS-PAGE respectively, and with Western
Blotting is identified.
Step 3: the purifying of albumen
It (is 7.9 by 0.5M NaCl and 20mM pH that the E.coli for expressing DAO-6H albumen, which is dissolved in combination buffer,
Tris-HCl is prepared) in, and protease inhibitors is added (by 1mM phenylmethylsulfonyl fluorides, 0.04mM 1,10- neighbour's phenanthrene hello
Quinoline, 0.04mM benzamidine hcls are prepared), then broken cell is shaken with Ultrasonic Cell Disruptor.In 4 DEG C, 20 points are centrifuged with 9,500rpm
Clock removes cell fragment.Again with 0.45 μm of filter filtering supernatant, the injection of this supernatant has been buffered by combining in advance
The metal chelate chromatography tubing string of liquid.It is cleaned to OD with combination buffer280Numerical stability, then with cleaning buffer solution (by 0.5M
Tris-HCl, 10mM-100mM 1 that NaCl, 20mM pH are 7.9, penta ring of 3- diazas is prepared) cleaning tubing string, then with
Dcq buffer liquid (by 0.5M NaCl, 20mM pH for 7.9 penta ring of Tris-HCl and 300mM-1M 1,3- diazas prepare and
At) flush out DAO-6H albumen.
Thalline is broken with Ultrasonic Cell Disruptor after going out DAO-6H with TB great expressions, is soluble protein moiety, collects
Supernatant after broken bacterium is after 0.45 μm of filter filters again by albumen injection His-Tag purifying liquid chromatography systems (AKTA
Prime system), a wave crest can be observed when 1,3 diaza, penta ring is the concentration of 150mM, this is the DAO- flushed out
6H albumen, molecular weight are 38kDa (Fig. 4-5).
8, protein electrophoresis
The molecular weight of DAO-6H is 38kDa (Fig. 3).Shown at arrow DAO-6H can great expression, and different bacterium colony pair
Protein expression amount no significant difference, therefore it is strain that we, which retain No. 2 to No. 8 bacterial strains, used in subsequent protein expression.
By No. 2 to No. 4 bacterial strains of picking in different bacterium colonies, supernatant and sediment are divided after thalline is broken, shows that DAO-6H can at arrow
There can be part to be located at soluble part (Fig. 6), be analyzed via Western blotting, be detected and sent out using anti-His antibody
Existing, DAO-6H has solvable part for purifying (Fig. 7).
Those skilled in the art is not under conditions of departing from the spirit and scope of the present invention of claims determination, also
Various modifications can be carried out to the above content.Therefore the scope of the present invention is not limited in above explanation, but by
The range of claims determines.
Claims (9)
1. a kind of preparation and purification method of DAO albumen, which is characterized in that include the following steps：
Step 1: prepared by plasmid：Using cDNA as template, primer is added and carries out PCR, it, will with Pro-Taq after carrying out 30 cycles
After DAO gene magnifications, DAO is accessed after enzyme NdeI and XhoI processing in pET23a (+) plasmid, agar gel is passed through
Body electrophoretic analysis and the purifying of DNA Gel fragments, are obtained PCR product after purification, were purified with restriction enzyme NdeI and XhoI processing
DAO segments afterwards and pET23a (+) carrier so that DAO-6H has palindromic sequence that can be complementary with pET23a (+), will with agaropectin
Carrier and DAO segments are purified from colloid, and with restriction enzyme HindIII and BamHI processing purifying, be added ligase and buffer solution in
It is reacted 2 hours at 25 DEG C, so that DAO is engaged into pET23a (+) carrier, be then transformed into Escherichia coli Top10F ', in 37 DEG C of trainings
Support to the next day, and after confirming successful connection with bacterium colony PCR methods bacterium colony is provoked sequencing company is sent to be sequenced, confirm the correct nothing of sequence
After accidentally prepared by i.e. completion plasmid, completes i.e. DAO- of the Escherichia coli TOP10F ' great expressions with His-tag after prepared by plasmid
6H；
Step 2: the expression of protein：The plasmid for expressing DAO-6H is transferred to competent escherichia coli cell bacterial strain, picking is single
Bacterium colony is incubated in LB culture solutions, and in culture solution China and foreign countries plus ampicillin and chloramphenicol, after 37 DEG C of cultures overnight, from training
The fresh LB of 0.5ml additions 5ml are taken out in nutrient solution to cultivate in 37 DEG C, it, will be warm when cell concentration reaches OD600 to 0.4-0.6
Degree is maintained at 25 DEG C, and additional ultimate density is the isopropylthiogalactoside of 0.5mM, after culture overnight, take out 1ml thalline in
Suitable PBS is added with centrifugation, removal supernatant later at 4 DEG C, Ultrasonic Cell Disruptor breaks cell wall, isolates after centrifugation
Soluble matter and insoluble object；
Step 3: the purifying of protein：The Escherichia coli for expressing DAO-6H albumen are dissolved in combination buffer, and albumen is added
Enzyme inhibitor, then broken cell is shaken with Ultrasonic Cell Disruptor, in 4 DEG C, cell fragment is removed for 20 minutes with centrifugation, filtering supernatant will
The injection of this supernatant in advance by the metal chelate chromatography tubing string of combination buffer, cleans tubing string, then with cleaning buffer solution
DAO-6H albumen is flushed out with dcq buffer liquid.
2. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the primer is：
pET23a-DAO-6H:
DAO-F’-NdeI:ATATCATATGCGTGTGGTGGTGATTGG
DAO-R’-XhoI:TATACTCGAGGAGGTGGGATGGTGGCATTC。
3. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the combination buffering
Liquid is prepared by 0.5M NaCl and 20mM the pH Tris-HCl for being 7.9.
4. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the protease suppression
Preparation is prepared by 1mM phenylmethylsulfonyl fluorides, 0.04mM 1,10- phenanthrolines, 0.04mM benzamidine hcls.
5. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the filter
Aperture is 0.45 μm.
6. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the cleaning buffering
Tris-HCl, 10mM-100mM 1 that liquid is 7.9 by 0.5M NaCl, 20mM pH, penta ring of 3- diazas are prepared, and rinse slow
Fliud flushing is prepared by 0.5M NaCl, 20mM pH penta ring of Tris-HCl and 300mM-1M 1,3- diazas for being 7.9.
7. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the centrifugal condition
For 9000rpm-15000rpm.
8. a kind of preparation and purification method of DAO albumen according to claim 1, which is characterized in that the ampicillin
A concentration of 50 μ g/ml, a concentration of 25 μ g/ml of the chloramphenicol.
9. the DAO eggs that a kind of preparation and purification method by a kind of DAO albumen according to any of the above-described claim obtains
Application in treating schizophrenia drug in vain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810579401.5A CN108707591A (en) | 2018-06-07 | 2018-06-07 | A kind of preparation and purification method and its application of DAO albumen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810579401.5A CN108707591A (en) | 2018-06-07 | 2018-06-07 | A kind of preparation and purification method and its application of DAO albumen |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108707591A true CN108707591A (en) | 2018-10-26 |
Family
ID=63871360
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810579401.5A Pending CN108707591A (en) | 2018-06-07 | 2018-06-07 | A kind of preparation and purification method and its application of DAO albumen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108707591A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH07108225B2 (en) * | 1986-09-16 | 1995-11-22 | 旭化成工業株式会社 | D-amino acid oxidase gene |
| CN1560229A (en) * | 2004-03-09 | 2005-01-05 | 复旦大学 | Process of preparing D-amino acid oxydase |
| RU2310688C1 (en) * | 2006-03-17 | 2007-11-20 | Центр "Биоинженерия" Ран | RECOMBINANT DNA ENCODING FUNCTIONALLY ACTIVE HYBRID PROTEIN OF D-AMINO ACID OXYDASE WITH CHITIN-COUPLING DOMAIN (DAOcbd), pVR1 RECOMBINANT PLASMID PROVIDING SYNTHESIS THEREOF IN Escherichia coli CELLS AND RECOMBINANT Escherichia coli STRAIN C 41 (DE3)/pVR1 AS PRODUCER OF DAOcbd |
| CN103103167A (en) * | 2013-01-29 | 2013-05-15 | 河北师范大学 | Mutant zymoprotein of D-amino acid oxidase and preparation method of mutant zymoprotein |
| CN107881159A (en) * | 2017-12-15 | 2018-04-06 | 江南大学 | A kind of method of raising D amino acid oxidase solubility heterogenous expressions |
-
2018
- 2018-06-07 CN CN201810579401.5A patent/CN108707591A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH07108225B2 (en) * | 1986-09-16 | 1995-11-22 | 旭化成工業株式会社 | D-amino acid oxidase gene |
| CN1560229A (en) * | 2004-03-09 | 2005-01-05 | 复旦大学 | Process of preparing D-amino acid oxydase |
| RU2310688C1 (en) * | 2006-03-17 | 2007-11-20 | Центр "Биоинженерия" Ран | RECOMBINANT DNA ENCODING FUNCTIONALLY ACTIVE HYBRID PROTEIN OF D-AMINO ACID OXYDASE WITH CHITIN-COUPLING DOMAIN (DAOcbd), pVR1 RECOMBINANT PLASMID PROVIDING SYNTHESIS THEREOF IN Escherichia coli CELLS AND RECOMBINANT Escherichia coli STRAIN C 41 (DE3)/pVR1 AS PRODUCER OF DAOcbd |
| CN103103167A (en) * | 2013-01-29 | 2013-05-15 | 河北师范大学 | Mutant zymoprotein of D-amino acid oxidase and preparation method of mutant zymoprotein |
| CN107881159A (en) * | 2017-12-15 | 2018-04-06 | 江南大学 | A kind of method of raising D amino acid oxidase solubility heterogenous expressions |
Non-Patent Citations (5)
| Title |
|---|
| ROMANO等: "Optimization of human D-amino acid oxidase expression in Escherichia coli", 《PROTEIN EXPRESSION AND PURIFICATION》 * |
| 史训龙等: "基因工程酵母菌来源的D-氨基酸氧化酶分离纯化 ", 《复旦学报(医学版)》 * |
| 孙兵兵等: "D-氨基酸氧化酶的研究进展 ", 《化学与生物工程》 * |
| 王筱兰等: "D-氨基酸氧化酶的分离纯化及固定化研究 ", 《南昌大学学报(工科版)》 * |
| 薛瀚等: "一种简便高效纯化重组D-氨基酸氧化酶的方法", 《河北化工》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102469450B1 (en) | Polynucleotides Encoding Interleukin-12 (IL12) and Uses Thereof | |
| JP2512746B2 (en) | Method for producing polypeptide showing hepatitis B virus antigenicity | |
| KR20080073710A (en) | Modified proteases that inhibit complement activation | |
| JP2008113660A (en) | Histone deacetylase-related gene and protein | |
| EP0344024B1 (en) | Vector for the expression of mammalian membrane receptors in unicellular organisms and method of studying ligands recognising these receptors | |
| WO2019104860A1 (en) | Anti-pd-1 nanobody pd-1/nb52, preparation method therefor and use thereof | |
| Fujimoto et al. | Changes in polyadenylation of lactate dehydrogenase‐X mRNA during spermatogenesis in mice | |
| JP2949440B2 (en) | Fusion genes and their protein products for treatment and diagnosis of congenital or acquired genetic diseases | |
| KR101064783B1 (en) | Single protein production in living cells facilitated by a messenger rna interferase | |
| CN108707591A (en) | A kind of preparation and purification method and its application of DAO albumen | |
| CN106636197B (en) | A method of orientation strikes multi-copy gene in drop zebra fish genome | |
| JPS5980615A (en) | Dna and its use | |
| Sahin-Tóth et al. | Association between the amino-and carboxyl-terminal halves of lactose permease is specific and mediated by multiple transmembrane domains | |
| EP1315822A2 (en) | Modified construct downstream of the initiation codon for recombinant protein overexpression | |
| CN108752449A (en) | G72 albumen and its three kinds of mutant proteins and its preparation, purification process and application | |
| JPS626679A (en) | Biological production of human lysozyme | |
| JPS63500142A (en) | bacterial enzymes | |
| RU2426780C2 (en) | EXPRESSION PLASMID DNA p6E-tTF CODING EXTRACELLULAR AND TRANSMEMBRANE DOMAINS OF HUMAN TISSUE FACTOR AND E.coli BL21 [DE3]/p6E-tTF STRAIN - PRODUCER OF RECOMBINANT HUMAN TISSUE FACTOR | |
| CN114058636A (en) | Method for cloning, expressing and purifying transthyretin gene | |
| JPH04503054A (en) | Novel protein, DNA encoding it and its use | |
| CN117229381A (en) | Recombinant ginseng hypoglycemic peptide and preparation method and application thereof | |
| CN113755493A (en) | Anti-osteoarthritis recombinant miR-140 and production method and application thereof | |
| JP2014045774A (en) | Recombination vector, recombinant fish egg produced by applying it and biomaterial | |
| KR0177497B1 (en) | Method for producing human osteocalcin using E. coli | |
| KR100225467B1 (en) | Novel acetylcholinestrase gene and method of producing asetylcholinesterase in e.coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181026 |
|
| RJ01 | Rejection of invention patent application after publication |