CN106636197B - A method of orientation strikes multi-copy gene in drop zebra fish genome - Google Patents

Abstract

The invention discloses a kind of methods that orientation strikes multi-copy gene in drop zebra fish genome, comprising the following steps: step 1: the preparation of zebrafish embryo；Step 2: the expression vector establishment of dCas9-Eve fusion protein；Step 3: the in-vitro transcription of sgRNA, dCas9-Eve, Cas9 and gene are carried out, then sgRNA, dCas9-Eve, Cas9mRNA that synthesis is transcribed in vitro and gene mRNA are purified with RNeasy Mini Kit；Step 4: the activity identification of sgRNA；Step 5: dCas9-Eve method strikes the expression of drop multi-copy gene znfl1s, with embryo's whole mount in situ hybridization method by the expression of detection gene, determines the case where drop is struck in gene expression.The method that the present invention utilizes dCas9-Eve, in the presence of the sgRNA of efficient targeting identification gene promoter, the transcription of drop gene can specifically be struck, avoiding is influenced in early embryo development by MO toxicity or caused non-specific phenotype of missing the target in research gene, and it is zebra fish source that Eve, which inhibits transcription structure domain, therefore dCas9-Eve can be adapted for striking drop in transcriptional level to any zebra fish gene.

Description

A method of orientation strikes multi-copy gene in drop zebra fish genome

Technical field

The present invention relates to field of biotechnology more particularly to a kind of orientation to strike multi-copy gene in drop zebra fish genome Method.

Background technique

When studying function of the gene in early embryo development, we usually design morpholine in some region of gene The expression of gene drops to strike in (morpholino, MO), but since there are the inconsistencies of montage for multi-copy gene, can not design needle It verifies the function of the gene to the MO of same splice site, and MO toxicity or misses the target and often result in nonspecific phenotype. CRISPR/Cas9 is a kind of adaptive immunity defence that bacterium and archeobacteria are formed during long-term evolution, can be used to fight The virus and exogenous DNA of invasion, it has also become a kind of base suitable for realizing directed mutagenesis culture cell and entire organism Because of a group edit tool.In recent years, researcher has been constructed some novel based on traditional CRISPR/Cas9 gene editing system Gene regulation tool: the CRISPR for down-regulated gene interferes (CRISPRi) technology.

CRISPRi refers to be co-expressed using the active Cas9 of absence of endonuclease (dCas9) and single guiding RNA, is come Generate a kind of DNA recognition complex, using this compound specificity interfere transcription extend, RNA polymerase combine, or transcription because Son combines.The technology can realize very strong Gene silencing efficacy by the importing of two sgRNA.It is dry different from traditional RNA Disturb technology, CRISPRi being capable of any number of individual gene of silencing simultaneously.Also, closing non-targeted gene, there is very little risk.This Outside, interfering from RNA prevents protein generations different, and CRISPRi is to be read and write to play a role for RNA by prevention DNA information. Existing research personnel confirm to merge Kr ü ppel associated box (KRAB) structural domain with dCas9, in nematode and zebra Target gene (Lijiang Long et al., 2015, Cell Research, 25:638-641) can be effectively inhibited in fish. But KRAB structural domain does not find homologous gene in zebra fish, needs a kind of dCas9 emerging system, inhibits the structure of transcription Domain exists in zebra fish, changes gene table on or near endogenous gene expression site by the sgRNAs of targeting specific It reaches.

Summary of the invention

The purpose of the present invention is to solve disadvantage existing in the prior art, with the Eve structural domain in zebra fish source, And the method that a kind of orientation proposed strikes multi-copy gene in drop zebra fish genome, comprising the following steps:

Step 1: the preparation of zebrafish embryo；

Step 2: the expression vector establishment of dCas9-Eve fusion protein will encode the cDNA sequence and coding Eve of dCas9 CDNA sequence recombination when, between be placed in a linker sequence；

Step 3: the in-vitro transcription of sgRNA, dCas9-Eve, Cas9 and gene are carried out, then synthesis will be transcribed in vitro SgRNA, dCas9-Eve, Cas9mRNA and gene mRNA are purified with RNeasy Mini Kit；

Step 4: sgRNA and Cas9mRNA is injected into 1- cell stage zebrafish embryo simultaneously by the activity identification of sgRNA, To embryonic development to pf for 24 hours, 5 embryos are collected, shell membrane is torn off with metal tweezers, is put into PCR pipe, with zebra fish genotype Identification kit rapidly extracting genomic DNA, then with it is amplifiable go out containing sgRNA identification sequence gene promoter forward primer and Reverse primer is amplimer, carries out PCR amplification by template of the genomic DNA of said extracted, verifies PCR product size later It is whether consistent with target fragment, and PCR product is sequenced, determine whether sgRNA is active；

Step 5: dCas9-Eve method strikes the expression of drop znfl1s, and active sgRNA will be identified with final concentration 50ng/ μ l It is mixed with 250ng/ μ l dCas9-Eve, then microinjection enters the zebrafish embryo of 1- cell, extremely to embryonic development 8hpf determines the case where drop is struck in gene expression with embryo's whole mount in situ hybridization method by the expression of detection gene.

Preferably, the preparation method of the zebrafish embryo is the following steps are included: raising zebra fish in circulation In, 28.5 DEG C of room temperature, daily fixed-illumination 14 hours, 10 hours dark, upper and lower noon each feeding is primary, when collecting embryo, The raun of mating and milter are respectively placed in the both ends of mating box, centre is separated with partition, to the next morning on the day before mentioning When illumination, by drawing out partition plate, embryo is collected in male and female mating, and embryo is placed in 28.5 DEG C of constant incubator cultivate it is spare.

Preferably, purifying includes the following steps: that 4 times of volumes are added to Buffer RPE first in the step 3 Then the processed ultrapure water of DEPC is added in nuclease free dehydrated alcohol into the mRNA sample being transcribed in vitro, so that volume expands Greatly to 100 μ l, the RLT of 350 μ l is added, mixes, then mixed liquor is added to RNeasy Mini and is prepared in pipe, pipe will be prepared and put Entering in 2ml collecting pipe, 12000g is centrifuged 1 minute, loses filtrate, 500 μ l Buffer RPE, 12000g is added centrifugation 1 minute, Filtrate is lost, 500 μ l Buffer RPE, 12000g are added again centrifugation 1 minute, loses filtrate, 12000g is centrifuged 1 point again Zhong Hou will prepare pipe and be put into the EP pipe of nuclease free, and the processed ultrapure water of 30-50 μ l DEPC is added dropwise to pipe center is prepared, 12000g is centrifuged 1 minute, finally measures mRNA concentration with ultraviolet specrophotometer, identifies mRNA through 1% agarose gel electrophoresis After quality, dispenses and be stored in -80 DEG C.

Preferably, in step 4 rapidly extracting genomic DNA process are as follows: 10 μ l A liquid are added into PCR pipe, then will PCR pipe is placed in PCR instrument, through 65 DEG C 15 minutes, 95 DEG C 5 minutes, 16 DEG C of 1 minute completion extracting genome DNAs, the base of extraction It is saved backup because a group DNA is placed in -20 DEG C.

Preferably, the concrete operation step of embryo's whole mount in situ hybridization method is by 4% poly of embryo in the step 5 Formaldehyde is fixed, and 4 DEG C overnight, after second day tears shell membrane off under anatomical lens with tip metal tweezer, with 25%, 50%, dehydrated alcohol Serial dehydration, each room temperature 5 minutes, dewatered embryo are placed in -20 DEG C 1 hour, later with 25%PBST:75% ethyl alcohol, 50%PBST:50 ethyl alcohol, 1 × PBST gradient rehydration, the embryo after rehydration are added prehybridization solution, place 5 in 65 DEG C of hybrid heaters Minute, later with being added 65 DEG C of hybridization solution of yeast rna and heparin and rna probe overnight, third days, in 65 DEG C, with containing The solution of 50% formamide, 10%20 × SSC and 0.1%Tween is washed twice, 30 minutes every time, is washed once with 2 × SSCT later 15 minutes, then washed twice with 0.2 × SSCT, 30 minutes every time, then 3 times are washed with the MABT room temperature of pH7.5,5 minutes every time, later The confining liquid containing the diluted DigiTAb of 1/2000-1/5000 is changed to after being closed 1 hour with confining liquid room temperature, 4 DEG C are overnight, 4th day, washed eight times, room temperature, 30 minutes every time, developed the color later, and equilibrium liquid is first added with MABT, be placed at room temperature for 10 minutes it Afterwards, equilibrium liquid is sucked out, changes to developing solution, is protected from light, is placed at room temperature for 6-8 hours, after colour developing completely, is cleaned one time with PBST, room temperature 5 Minute, with twice of washes of absolute alcohol, room temperature 10 minutes, be added embedding liquid (2:1 mixing Bezylbenzoate and Benzylalcohol), in situ hybridization result is photographed to record with Lycra MZ16F stereoscope, image AdobePhotoshop CS5Extended software degree of comparing and luminous intensity processing.

Preferably, the prehybridization solution is the mixing of 50% deionized formamide, 25%20 × SSC and 0.1%Tween Liquid.

Preferably, the confining liquid is 2%Blocking regent, 10% sheep serum, 70%MAB and 0.1% The mixed liquor of Tween.

Preferably, the equilibrium liquid is 0.1M NaCl, 0.1M Tris-HCl (PH=9.5), 0.05M MgCl2,0.1% The mixed liquor of Tween-20 and 0.5mg/ml Lavamisol.

Preferably, the embedding liquid is the Bezylbenzoate and Benzylalcohol of 2:1 mixing.

The method that a kind of orientation provided by the invention strikes multi-copy gene in drop zebra fish genome, utilizes dCas9-Eve Method specifically strike drop gene transcription, according in drosophila Eve inhibit functional domain, find homologous zebra fish Eve functional domain, Inhibit functional domain to do fusion protein the dCas9 and Eve of zebra fish, can identify that the sgRNA of gene promoter is deposited with efficient targeting The case where, while Eve and dCas9 be combined together after dCas9-Eve can significantly inhibit the expression of any zebra fish gene, It is applied widely, and avoid and studying gene in early embryo development by MO toxicity or caused non-specificity of missing the target The influence of phenotype.

Detailed description of the invention

Fig. 1 is to strike the method implementation for dropping multi-copy gene in zebra fish genome according to a kind of orient proposed by the present invention Experiment display figure.

Wherein: A is the structural schematic diagram of the Eve fusion protein construction in dCas9 and zebra fish source, and NLS refers to nuclear location Sequence (Nuclear localization sequence), B are to inject sgRNA1, sgRNA2, sgRNA3 and Cas9mRNA Embryo later extracts the result map that genomic DNA is sequenced, the binding site that the sequence in box is sgRNA3, arrow The signified place of head is the initiation site that effect occurs for sgRNAs, C be not plus the znfl1s of dCas9-Eve primitive gut mid-term table Up to situation, D is expression of the znfl1s in primitive gut mid-term that dCas9-Eve is added.

Specific embodiment

Combined with specific embodiments below the present invention is made further to explain.

Referring to Fig.1, the method that a kind of orientation proposed by the present invention strikes multi-copy gene in drop zebra fish genome, including with Lower step:

Step 1: the preparation of zebrafish embryo, zebra fish are raised in circulation, and 28.5 DEG C of room temperature, daily Fixed-illumination 14 hours, 10 hours dark, upper and lower noon each feeding was primary, when collecting embryo, mentioned the previous day for the raun of mating The both ends of mating box are respectively placed in milter, centre is separated with partition, when the next morning illumination, by drawing out partition plate, male and female Mating, produced embryo collect embryo, and embryo is placed in 28.5 DEG C of constant temperature incubation since gravity can sink to mating cassette bottom portion It is cultivated in case spare；

Step 2: the expression vector establishment of dCas9-Eve fusion protein will encode the cDNA sequence and coding Eve of dCas9 CDNA sequence recombination when, between be placed in a linker sequence, in which: dCas9 expression vector is by Nanjing Yao along Yu Biotechnology Co., Ltd provides, and the sequence for encoding the albumen is the sequence of humanization；

Zebra fish Eve sequence are as follows:

ATGGAAACCACAATAAAGGTTTGGTTTCAGAACCGTCGCATGAAGGACAAGAGACAGCGTCTGGCTATG ACCTGGCCGCATCCTGCCGACCCCGCCTTTTACACCTATATGATGAGCCATGCTGCAGCAACGGGCAGTCTGCCCTA TCCATTTCAATCTCATCTTCCCCTTCC

TTACTATTCTCCACTAAGCAGTGTGACTGCAGGTTCAGCCACTGCCACTGCGGGTCCATTCTCAAATC CCCTGCGCTCGCTGGATAGTTTTCGGGTGCTTTCGCATCCATACCCGCGACCTGAACTGCTGTGCGCCTTCAGACA CCCATCACTGTACCCCAGCCCGGGTCATGGGCTTGGTCCCGGTGGAAGTCCATGCTCCTGCCTTGCTTGCCACGCT TCCAGTCAAACAAACGGGCTCCAACATAGATCCAATAATGCAGAATTCTCGTGTTCGCCCACGACCAGGACTGAGG CCTTCCTCACTTTCTCGCCAGCAGTCATCAGCAAATCATCTTCGGTGTCTTTGGACCAGAGGGAGGAAGTGCCACT AACTAGA；

Linker sequence are as follows:

AGCCCCAAGAAGAAGAGAAAGGTGGAGGCCAGCGGAGGTACGCGTTCTAGAACC；

Step 3: the in-vitro transcription of sgRNA, dCas9-Eve, Cas9 and znfl1s are carried out, 3 identification znfl1s is designed and opens The sequence of the gRNA of sub-area is respectively as follows:

gRNA1(GCACTGTCCTGTACTTCCCATGG)、

gRNA2(GTTAGTAGCCAAATAAGATTTGG)、

GRNA3 (ACAACATCAGAAAAACATGG), wherein underlined sequences are PAM sequence, and corresponding sgRNA uses body The method of outer transcription synthesizes, synthesize in vitro it is template used obtained by PCR amplification, the forward primer of PCR reaction is respectively as follows:

gRNA1F(TAATACGACTCACTATAggcactgtcctgtacttcccaGTTTTAGAGCTAGAAATAGC)、 gRNA2F(TAATACGACTCACTATAggttagtagccaaataagattGTTTTA GAGCTAGAAATAGC)、gRNA3F(T AATACGACTCACTATAggacaacatcagaaaaacaGTTTTAGAGCTAGAAATAGC- 3 '), the front end capitalization of the primer Sequence is T7 promoter sequence, and intermediate small write sequence is former interval, and PCR reverse primer sequences are CTATTTCTAGCTCTAAAAC； Expanding the template used is pMD 19-gRNA carrier；The plasmid is given by the laboratory Xiong Jingwei；PCR reacted constituent are as follows: 10 μ L2MasterMix, 7 μ l ultrapure waters, 5 μM it is positive/negative to each 1 μ l and pMD 19-gRNA carrier, 1 μ l of primer, reaction condition are as follows: 94 DEG C 2 minutes, 35 circulations (94 DEG C 15 seconds, 58 DEG C 30 seconds and 72 DEG C 20 seconds), 72 DEG C 10 minutes；Product after PCR amplification is through PCR Clean Up kits；When sgRNA is transcribed in vitro, to purify obtained PCR product as template, MAXIscript is used In Vitro Transcription Kit be transcribed in vitro sgRNA, and in vitro transcription synthesis gRNA when, digoxigenin labeled is not added UTP；The kit that mRNA is transcribed in vitro is mMESSAGEmMACHINE T7, and the kit of mRNA tailing is Poly (A) Tailing Kit；

When Cas9 and dCas9-Eve synthesis Cas9 and dCas9-Eve mRNA is transcribed in vitro, distinguished using XbaI and XhoI Digested plasmid PXT7-cas9 and pKS-dCas9-dmEVE make its linearisation, are detected with 1% agarose gel electrophoresis, will be linear Change complete plasmid PCR Clean Up kit recycling template, is dissolved with DEPC water, the EP Guan Zhongjia of Xiang Hanyou DNA profiling Enter 10 μ l 2NTP/CAP, 2 μ l 10Reaction Buffer and 2 μ l T7enzyme Mix, flicks the mixing of EP pipe, and after centrifugation It is put in 37 DEG C to react 2 hours, be reacted 15 minutes after 1 μ l TURBO DNase is added in 37 DEG C, when carrying out tailings reactions, to 20 μ l 36 μ l DEPC water, 20 μ l 5E-PAP Buffer, 10 μ l 25mM MnCl2,10 μ l are added in above-mentioned reaction system ATPSolution adds 4 μ l E-PAP, soft to mix, and reacts 45 minutes in 37 DEG C, 50 μ l are added into reaction solution LiCl is put in -80 DEG C 1 hour after mixing, 4 DEG C of centrifugations, 12000g after ten minutes, removes supernatant, after being added 75% without enzyme ethyl alcohol, 4 DEG C of 12000g are centrifuged 10 minutes, remove supernatant, collect mRNA, are dissolved in DEPC water, identify mRNA matter through 1% agarose gel electrophoresis After amount, dispenses and be stored in -80 DEG C；When znfl1s mRNA is transcribed in vitro, make it using SmaI digested plasmid pXT7-znfl1s Linearisation is recycled linear after 1% agarose gel electrophoresis detection confirmation linearisation completely with PCR Clean Up kit Change template, be dissolved in DEPC water, the in-vitro transcription of step same sgRNA, dCas9-Eve and Cas9mRNA is transcribed in vitro；

SgRNA, dCas9-Eve, Cas9mRNA and znfl1s mRNA RNeasy Mini Kit of synthesis is transcribed in vitro It is purified, purification step is as follows: the nuclease free dehydrated alcohol of 4 times of volumes is added to Buffer RPE first, then toward body The processed ultrapure water of DEPC is added in the mRNA sample of outer transcription, the RLT of 350l is added so that volume is extended to 100l, mixes It is even, then mixed liquor is added to RNeasy Mini and is prepared in pipe, pipe will be prepared and be put into 2ml collecting pipe, 12000g is centrifuged 1 point Clock loses filtrate, and 500l Buffer RPE is added, and 12000g is centrifuged 1 minute, loses filtrate, 500l is added again BufferRPE, 12000g are centrifuged 1 minute, lose filtrate, after 12000g is centrifuged 1 minute again, will be prepared pipe and are put into nuclease free EP pipe in, to prepare pipe center be added dropwise the processed ultrapure water of 30-50l DEPC, 12000g be centrifuged 1 minute, finally with ultraviolet Spectrophotometric determination mRNA concentration dispenses after 1% agarose gel electrophoresis identifies mRNA mass and is stored in -80 DEG C；

Step 4: the activity identification of sgRNA, comprising the following steps: first by 50pg sgRNA and 250pg Cas9mRNA It is injected into 1- cell stage zebrafish embryo simultaneously, to embryonic development to pf for 24 hours, collects 5 embryos, tears shell off with metal tweezers Film is put into PCR pipe, with zebra fish genotyping kit rapidly extracting genomic DNA, process are as follows: into PCR pipe 10 μ l A liquid are added, then PCR pipe is placed in PCR instrument, through 65 DEG C 15 minutes, 95 DEG C 5 minutes, 16 DEG C of 1 minute completion bases Because group DNA is extracted, the genomic DNA of extraction is placed in -20 DEG C and saves backup, then identifies sequence containing sgRNA out with amplifiable Znfl1s promoter forward primer (GGCTTGATTCTTGCTTTG) and reverse primer (GTGAGTGCTTGATGCTGT) are amplification Primer, using the genomic DNA of said extracted as template, carry out PCR amplification, amplification condition are as follows: 95 DEG C 3 minutes, 35 circulation (95 DEG C 30 seconds, 58 DEG C 30 seconds and 72 DEG C 30 seconds 1 minute), 72 DEG C 10 minutes, 16 DEG C 10 minutes, it is big with electrophoresis verifying PCR product later It is small whether consistent with target fragment 1004bp, directly sequencing company is sent to be sequenced PCR product, sequencing primer is reversely to draw Object starts whether occur obviously covering peak in PAM sequence attachment according to what sequencing result was shown, determines whether sgRNA is active；

Step 5: dCas9-Eve method strikes the expression of drop znfl1s, and active sgRNA will be identified with final concentration 50ng/ μ l It is mixed with 250ng/ μ l dCas9-Eve, then microinjection enters the zebrafish embryo of 1- cell, extremely to embryonic development 8hpf determines the case where drop is struck in zfnl1s gene expression with embryo's whole mount in situ hybridization method by the expression of detection zfnl1s；

In the present invention, Znfl1s is the transcription factor containing a Zinc finger domain, and znfl1s gene contains in zebra fish There are 13 copies, the genome sequence that this 13 are copied is (to translation termination sequence from the about 2kbp of translation initiation site upstream Downstream 1kbp stops) sequence of about 7k is compared, it is found that these genes are mutually unison very high on genome sequence.

In the present invention, the concrete operation step of embryo's whole mount in situ hybridization method is to fix embryo with 4% paraformaldehyde, 4 DEG C overnight；After second day tears shell membrane off under anatomical lens with tip metal tweezer, with 25% (1 time), 50% (1 time), dehydrated alcohol (2 times) serial dehydration, each room temperature 5 minutes, dewatered embryo are placed in -20 DEG C 1 hour, use 25%PBST:75% second later Alcohol (1 time), 50%PBST:50 ethyl alcohol (1 time), 1 × PBST (130mM NaCl, 7mM Na2HPO4 and 7mM NaH2PO4) gradient Rehydration, wherein T refers to 0.1%Tween；Embryo after rehydration be added prehybridization solution (50% deionized formamide, 25%20 × SSC and 0.1%Tween), it is placed in 65 DEG C of hybrid heaters 5 minutes, later with addition yeast rna (500 μ g/ml) and heparin (50 μ g/ml) and 65 DEG C of hybridization solution of rna probe of final concentration of 1ng/ μ l overnight；Third day, in 65 DEG C, with containing 50% formyl The solution of amine, 10%20 × SSC and 0.1%Tween is washed twice, 30 minutes every time, is washed one time 15 minutes with 2 × SSCT later, It is washed twice with 0.2 × SSCT again, 30 minutes every time, then with MABT (100mM maleic acid, 150mM sodium chloride, the pH=of pH7.5 7.5,0.1%Tween-20) room temperature is washed 3 times, 5 minutes every time, uses confining liquid (2%Blocking regent, 10% silk floss later Sheep blood serum, 70%MAB and 0.1%Tween) after room temperature is closed 1 hour change it is anti-containing the diluted digoxin of 1/2000-1/5000 The confining liquid of body (Anti-Digoxigenin-AP Fab fragment), 4 DEG C overnight；4th day, eight times are washed with MABT, room Temperature 30 minutes every time, develops the color later, and first be added equilibrium liquid (0.1M NaCl, 0.1M Tris-HCl (PH=9.5), 0.05MMgCl2,0.1%Tween-20,0.5mg/ml Lavamisol), it is placed at room temperature for after 10 minutes, equilibrium liquid is sucked out, changes Enter developing solution (1.2mg/ml Lavamisol, the NBT/BCIP stock solution of 20 μ l are added in equilibrium liquid), is protected from light, is placed at room temperature for 6- It 8 hours, after colour developing completely, is cleaned one time with PBST, room temperature 5 minutes, with twice of washes of absolute alcohol, room temperature 10 minutes, is added Embed liquid (Bezylbenzoate and Benzylalcohol of 2:1 mixing), in situ hybridization result Lycra MZ16F stereomicroscopy Mirror photographs to record, image Adobe Photoshop CS5Extended software degree of comparing and luminous intensity processing.

The present embodiment is using dCas9-Eve by being incorporated in target gene promoter sequence, influence turn under sgRNA guidance Complex is recorded to the functional transcription of target gene, and can recognize different sequences for having synthesized altogether on the promoter sequence of znfl1s The activity of 3 sgRNA of column, activity verifying display sgRNA1 are obvious, but sgRNA3 is lower without activity or activity, and sgRNA2 Activity influence bad judgement since sgRNA1 is active, be the activity of accurate judgement sgRNA, we strike drop in dCas9-Eve In experiment, after being mixed using these three sgRNA and dCas9-EvemRNA co-injection is into 1-2 cell stage zebrafish embryo, so Znfl1s is observed in the expression of primitive gut mid-term by embryo's whole mount in situ hybridization afterwards.The results show that the expression of znfl1s by Inhibit to apparent, illustrates the expression for largely inhibiting znfl1s using dCas9-Eve and sgRNA, to realize Drop is struck to znfl1s function.

The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto, Anyone skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its Inventive concept is subject to equivalent substitution or change, should be covered by the protection scope of the present invention.

Sequence table

<110>Nanjing Women and Children Healthcare Hospital

Nanjing University

Nanjing Yao Shunyu Biotechnology Co., Ltd

<120>a kind of method that orientation strikes multi-copy gene in drop zebra fish genome

<141> 2019-04-11

<160> 11

<170>SIPOSequenceListing 1.0

<210> 1

<211> 552

<212> DNA

<213> zebrafish

<400> 1

atggaaaccacaataaaggtttggtttcagaaccgtcgcatgaaggacaagagacagcgt 60

ctggctatgacctggccgcatcctgccgaccccgccttttacacctatatgatgagccat 120

gctgcagcaacgggcagtctgccctatccatttcaatctcatcttccccttccttactat 180

tctccactaagcagtgtgactgcaggttcagccactgccactgcgggtccattctcaaat 240

cccctgcgctcgctggatagttttcgggtgctttcgcatccatacccgcgacctgaactg 300

ctgtgcgccttcagacacccatcactgtaccccagcccgggtcatgggcttggtcccggt 360

ggaagtccatgctcctgccttgcttgccacgcttccagtcaaacaaacgggctccaacat 420

agatccaataatgcagaattctcgtgttcgcccacgaccaggactgaggccttcctcact 480

ttctcgccagcagtcatcagcaaatcatcttcggtgtctttggaccagagggaggaagtg 540

ccactaactaga 552

<210> 2

<211> 54

<212> DNA

<213> artificial

<400> 2

agccccaagaagaagagaaaggtggaggccagcggaggtacgcgttctagaacc 54

<210> 3

<211> 23

<212> DNA

<213> artificial

<400> 3

gcactgtcctgtacttcccatgg 23

<210> 4

<211> 23

<212> DNA

<213> artificial

<400> 4

gttagtagccaaataagatttgg 23

<210> 5

<211> 20

<212> DNA

<213> artificial

<400> 5

acaacatcagaaaaacatgg 20

<210> 6

<211> 58

<212> DNA

<213> artificial

<400> 6

taatacgactcactataggcactgtcctgtacttcccagttttagagctagaaatagc 58

<210> 7

<211> 58

<212> DNA

<213> artificial

<400> 7

taatacgactcactataggttagtagccaaataagattgttttagagctagaaatagc 58

<210> 8

<211> 56

<212> DNA

<213> artificial

<400> 8

taatacgactcactataggacaacatcagaaaaacagttttagagctagaaatagc 56

<210> 9

<211> 19

<212> DNA

<213> artificial

<400> 9

ctatttctagctctaaaac 19

<210> 10

<211> 18

<212> DNA

<213> artificial

<400> 10

ggcttgattcttgctttg 18

<210> 11

<211> 18

<212> DNA

<213> artificial

<400> 11

gtgagtgcttgatgctgt 18

Claims (8)

1. a kind of method that orientation strikes multi-copy gene in drop zebra fish genome, which comprises the following steps:

Step 1: the preparation of zebrafish embryo；

Step 2: the expression vector establishment of dCas9-Eve fusion protein by the cDNA sequence for encoding dCas9 and encodes Eve's When cDNA sequence recombinates, it is placed in a linker sequence, the DNA sequence dna of the Eve such as SEQ ID No.1 institute between Show；

Step 3: the in-vitro transcription of sgRNA, dCas9-Eve, Cas9 and znfl1s gene is carried out, then synthesis will be transcribed in vitro SgRNA, dCas9-Eve, Cas9mRNA and znfl1s gene mRNA are purified with RNeasy Mini Kit；

Step 4: sgRNA and Cas9mRNA is injected into 1- cell stage zebrafish embryo simultaneously, to embryo by the activity identification of sgRNA Tire is developed to pf for 24 hours, collects 5 embryos, tears shell membrane off with metal tweezers, is put into PCR pipe, with zebra fish genotype identification Kit rapidly extracting genomic DNA, then with it is amplifiable go out the gene promoter forward primer of the identification sequence containing sgRNA and reversed Primer is amplimer, carries out PCR amplification by template of the genomic DNA of said extracted, whether verifies PCR product size later It is consistent with target fragment, and PCR product is sequenced, determine whether sgRNA is active；

Step 5: dCas9-Eve method strikes the expression of drop znfl1s, will identify active sgRNA with final concentration 50ng/ μ l and 250ng/ μ l dCas9-Eve is mixed, and then microinjection enters the zebrafish embryo of 1- cell stage, extremely to embryonic development 8hpf determines the case where drop is struck in gene expression with embryo's whole mount in situ hybridization method by the expression of detection gene.

2. the method that a kind of orientation according to claim 1 strikes multi-copy gene in drop zebra fish genome, feature exist In the preparation method of the zebrafish embryo is the following steps are included: raise the room temperature in circulation for zebra fish 28.5 DEG C, daily fixed-illumination 14 hours, 10 hours dark, upper and lower noon each feeding is primary, and when collecting embryo, mentioning the previous day will The raun and milter of mating are respectively placed in the both ends of mating box, and centre is separated with partition, will be every when the next morning illumination Plate extraction, male and female mating, collects embryo, and embryo is placed in 28.5 DEG C of constant incubator cultivate it is spare.

3. the method that a kind of orientation according to claim 1 strikes multi-copy gene in drop zebra fish genome, feature exist In purifying includes the following steps: that nuclease free dehydrated alcohol is added to Buffer RPE first in the step 3, then toward body The processed ultrapure water of DEPC is added in the mRNA sample of outer transcription, so that volume is extended to 100 μ l, the RLT of 350 μ l is added, It mixes, then mixed liquor is added to RNeasy Mini and is prepared in pipe, pipe will be prepared and be put into collecting pipe, filtrate is centrifuged and loses, Buffer RPE is added, is centrifuged and loses filtrate, Buffer RPE is added again, is centrifuged and loses filtrate, it, will after being centrifuged again It prepares pipe to be put into the EP pipe of nuclease free, the processed ultrapure water of DEPC, centrifugation, finally with ultraviolet is added dropwise to pipe center is prepared Spectrophotometric determination mRNA concentration dispenses after 1% agarose gel electrophoresis identifies mRNA mass and is stored in -80 DEG C.

4. the method that a kind of orientation according to claim 1 strikes multi-copy gene in drop zebra fish genome, feature exist In, the concrete operation step of embryo's whole mount in situ hybridization method is to fix embryo with 4% paraformaldehyde in the step 5,4 DEG C Overnight, after second day removing shell membrane, serial dehydration is carried out, dewatered embryo is placed in -20 DEG C 1 hour, then carries out gradient rehydration, Prehybridization solution is added in embryo after rehydration, places 5 minutes in 65 DEG C of hybrid heaters, later with addition yeast rna and heparin and 65 DEG C of hybridization solution of rna probe overnight, successively use in 65 DEG C and contain 50% formamide, 10%20 × SSC and 0.1% by third day The solution of Tween, 2 × SSCT, 0.2 × SSCT cleaning, then cleaned with the MABT room temperature of pH7.5, it is sealed later with confining liquid room temperature The confining liquid containing the diluted DigiTAb of 1/2000-1/5000 is changed to after closing 1 hour, 4 DEG C overnight, the 4th day, are used MABT It develops the color after room temperature cleaning, and equilibrium liquid is first added, be placed at room temperature for after 10 minutes, equilibrium liquid is sucked out, change to developing solution, keep away Light is placed at room temperature for 6-8 hours, after colour developing completely, successively uses PBST and washes of absolute alcohol, and embedding liquid, in situ hybridization knot is added Fruit is photographed to record with Lycra MZ16F stereoscope, is handled image degree of comparing and luminous intensity.

5. the method that a kind of orientation according to claim 4 strikes multi-copy gene in drop zebra fish genome, feature exist In the prehybridization solution is the mixed liquor of 50% deionized formamide, 25%20 × SSC and 0.1%Tween.

6. the method that a kind of orientation according to claim 4 strikes multi-copy gene in drop zebra fish genome, feature exist In the confining liquid is the mixed liquor of 2%Blocking regent, 10% sheep serum, 70%MAB and 0.1%Tween.

7. the method that a kind of orientation according to claim 4 strikes multi-copy gene in drop zebra fish genome, feature exist In the equilibrium liquid is 0.1M NaCl, 0.1M Tris-HCl, 0.05M MgCl₂, 0.1%Tween-20 and 0.5mg/ml The mixed liquor of Lavamisol.

8. the method that a kind of orientation according to claim 4 strikes multi-copy gene in drop zebra fish genome, feature exist In the embedding liquid is the Bezylbenzoate and Benzylalcohol of 2:1 mixing.