CN110669795A - Technology for realizing precise fixed-point RNA shearing in fish embryo - Google Patents
Technology for realizing precise fixed-point RNA shearing in fish embryo Download PDFInfo
- Publication number
- CN110669795A CN110669795A CN201910994671.7A CN201910994671A CN110669795A CN 110669795 A CN110669795 A CN 110669795A CN 201910994671 A CN201910994671 A CN 201910994671A CN 110669795 A CN110669795 A CN 110669795A
- Authority
- CN
- China
- Prior art keywords
- rna
- sequence
- mrna
- casrx
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000005516 engineering process Methods 0.000 title claims abstract description 24
- 241000251468 Actinopterygii Species 0.000 title claims abstract description 13
- 238000010008 shearing Methods 0.000 title claims abstract description 10
- 210000001161 mammalian embryo Anatomy 0.000 title claims description 22
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims abstract description 59
- 108020004999 messenger RNA Proteins 0.000 claims abstract description 49
- 210000002257 embryonic structure Anatomy 0.000 claims abstract description 44
- 108020005004 Guide RNA Proteins 0.000 claims abstract description 17
- 230000001404 mediated effect Effects 0.000 claims abstract description 11
- 238000010357 RNA editing Methods 0.000 claims abstract description 10
- 230000026279 RNA modification Effects 0.000 claims abstract description 10
- 108020004414 DNA Proteins 0.000 claims description 59
- 102000053602 DNA Human genes 0.000 claims description 54
- 241000252212 Danio rerio Species 0.000 claims description 34
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 29
- 108090000623 proteins and genes Proteins 0.000 claims description 25
- 238000013518 transcription Methods 0.000 claims description 24
- 230000035897 transcription Effects 0.000 claims description 24
- 238000011144 upstream manufacturing Methods 0.000 claims description 24
- 238000000338 in vitro Methods 0.000 claims description 22
- 230000008014 freezing Effects 0.000 claims description 18
- 238000007710 freezing Methods 0.000 claims description 18
- 238000000034 method Methods 0.000 claims description 16
- 230000030648 nucleus localization Effects 0.000 claims description 15
- 108091006047 fluorescent proteins Proteins 0.000 claims description 14
- 102000034287 fluorescent proteins Human genes 0.000 claims description 14
- 238000003776 cleavage reaction Methods 0.000 claims description 12
- 238000000520 microinjection Methods 0.000 claims description 12
- 230000007017 scission Effects 0.000 claims description 12
- 238000003753 real-time PCR Methods 0.000 claims description 9
- 238000004458 analytical method Methods 0.000 claims description 8
- 230000000295 complement effect Effects 0.000 claims description 8
- 238000010839 reverse transcription Methods 0.000 claims description 8
- 230000002194 synthesizing effect Effects 0.000 claims description 8
- 239000011259 mixed solution Substances 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000002073 fluorescence micrograph Methods 0.000 claims description 6
- 108091033409 CRISPR Proteins 0.000 claims description 5
- 238000010354 CRISPR gene editing Methods 0.000 claims description 4
- 238000013461 design Methods 0.000 claims description 3
- 238000011161 development Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 238000010586 diagram Methods 0.000 claims description 2
- 230000007022 RNA scission Effects 0.000 claims 1
- 238000003197 gene knockdown Methods 0.000 abstract description 11
- 108020004459 Small interfering RNA Proteins 0.000 abstract description 2
- 125000004573 morpholin-4-yl group Chemical group N1(CCOCC1)* 0.000 abstract description 2
- 230000008685 targeting Effects 0.000 abstract description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 11
- 230000015572 biosynthetic process Effects 0.000 description 9
- 238000003786 synthesis reaction Methods 0.000 description 9
- 230000006870 function Effects 0.000 description 8
- 108010048367 enhanced green fluorescent protein Proteins 0.000 description 6
- 238000011160 research Methods 0.000 description 6
- 238000011529 RT qPCR Methods 0.000 description 5
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 4
- 241000702421 Dependoparvovirus Species 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 238000003752 polymerase chain reaction Methods 0.000 description 4
- 108091079001 CRISPR RNA Proteins 0.000 description 3
- 230000004570 RNA-binding Effects 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 108010068991 arginyl-threonyl-prolyl-prolyl-prolyl-seryl-glycine Proteins 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 231100000419 toxicity Toxicity 0.000 description 3
- 230000001988 toxicity Effects 0.000 description 3
- 101100385364 Listeria seeligeri serovar 1/2b (strain ATCC 35967 / DSM 20751 / CCM 3970 / CIP 100100 / NCTC 11856 / SLCC 3954 / 1120) cas13 gene Proteins 0.000 description 2
- 238000012228 RNA interference-mediated gene silencing Methods 0.000 description 2
- 108091092328 cellular RNA Proteins 0.000 description 2
- 230000001413 cellular effect Effects 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 230000009368 gene silencing by RNA Effects 0.000 description 2
- 230000004807 localization Effects 0.000 description 2
- 101150025372 neurog1 gene Proteins 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 230000009437 off-target effect Effects 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 125000006850 spacer group Chemical group 0.000 description 2
- 230000002103 transcriptional effect Effects 0.000 description 2
- 238000010200 validation analysis Methods 0.000 description 2
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108091034117 Oligonucleotide Proteins 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 108091093126 WHP Posttrascriptional Response Element Proteins 0.000 description 1
- 230000032683 aging Effects 0.000 description 1
- 239000000074 antisense oligonucleotide Substances 0.000 description 1
- 238000012230 antisense oligonucleotides Methods 0.000 description 1
- 230000027455 binding Effects 0.000 description 1
- 230000008827 biological function Effects 0.000 description 1
- -1 but not limited to Proteins 0.000 description 1
- 230000001364 causal effect Effects 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 239000012636 effector Substances 0.000 description 1
- 235000013601 eggs Nutrition 0.000 description 1
- 230000013020 embryo development Effects 0.000 description 1
- 238000010362 genome editing Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 231100000086 high toxicity Toxicity 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000002493 microarray Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000007481 next generation sequencing Methods 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 108010008359 protein kinase C lambda Proteins 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 231100000331 toxic Toxicity 0.000 description 1
- 230000002588 toxic effect Effects 0.000 description 1
- 230000009261 transgenic effect Effects 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
- 238000012070 whole genome sequencing analysis Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/40—Fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a technology for realizing precise fixed-point RNA shearing in fish embryos, which can realize precise fixed-point RNA knock-down in fish embryos by using a CasRx-mediated RNA editing technology and only needing to provide mRNA of CasRx and a specific targeting guide RNA. The problems that the efficiency of the prior siRNA technology is low, the Morpholino technology mediated gene knock-down technology is high in cost and easy to miss, and the like are solved.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to a technology for realizing precise fixed-point RNA shearing in fish embryos.
Background
With the continuous development and improvement of whole genome sequencing technology and the implementation of large genome annotation projects, the research of biological science enters the post-genome era. In the post-genome era, the focus of genomic research is shifting to gene function, i.e., the study of biological functions from the molecular ensemble level by determining the DNA sequence of genes and interpreting all genetic information of life, and exploring the human health and disease at a molecular level (pelton and McKusick, 2001). Researchers have begun to try to bring the results of genome research into various fields of basic scientific research and personalized medicine (Chan and Ginsburg, 2011) as early as possible through various attempts. However, in the face of massive and boring genome information, a key to solving the problem is to develop an efficient and reliable method for helping researchers to research the influence of genotype on phenotype (phenotype) as soon as possible.
By technological advances, mapping of cellular functional and disease transcriptome changes has been translated from microarrays (Schena et al, 1995) to next generation sequencing and single cell studies (sheddere et al, 2017). However, interrogating the function of individual transcriptional kinetics and establishing causal relationships between observed transcriptional changes and cellular phenotype requires the ability to actively control or modulate the desired transcription. DNA engineering techniques such as CRISPR-Cas9 (Doudna Charpentier, 2014; Hsu, 2014) enable researchers to dissect the function of a particular genetic element or correct a pathogenic mutation. However, simple and scalable tools for studying and manipulating RNA are significantly behind their DNA counterparts. Existing RNA interference technologies are capable of breaking down or suppressing the desired transcript, have significant off-target effects (off-targeteffect) due to their critical role in the endogenous process, and remain a challenging goal (Birming-Ham et al, 2006; Jackson et al, 2003). Therefore, methods for directly investigating the function of RNA function are still limited.
One key limitation in RNA engineering is the lack of an RNA binding domain that can be easily relocated and introduced into target cells. For example, the ms2-RNA binding domain recognizes an invariant 21 nucleotide (nt) RNA sequence (diabody, 1993), and thus requires genomic modification to label the desired transcript. The Pumilio homeodomains have modular repeats, each protein module recognizing a single RNA base, but they can only target short 8nt RNA sequences (Cheong, Hall, 2006). While previously characterized type II (Batra et al, 2017; O' Connell et al, 2014) and type VI (Abudayyeh et al, 2016; East Seletsky et al, 2016) CRISPR-Cas systems could be reprogrammed to recognize 20-30 nt RNAs, their large size (about 1200 aa) made it difficult to package into adeno-associated viruses (AAV) for primary cell and in vivo delivery. CasRx, one of the most compact single-cell effector Cas enzymes, can also be flexibly packaged into adeno-associated viruses.
Gene knock-down technology (gene knock-down) is needed for gene function screening, and because the siRNA technology has poor effect in zebra fish, the gene knock-down operation on zebra fish embryos mainly adopts antisense oligonucleotide (MO) technology (Nasevicius and Ekker, 2000). Although the MO technique has good effects, because of easy off-target, two specific MO sequences are generally required to be designed when performing knock down on each gene, and the current MO synthesis company is not in China, resulting in a long ordering period. Furthermore, MO technology has drawbacks such as high toxicity in addition to off-target (Stainier et al, 2017; Van Gils and Vanakker, 2019). Therefore, establishing a new RNA interference technology in the zebra fish has important significance for researching the gene function of the zebra fish.
Disclosure of Invention
The invention aims to provide a technology for realizing precise fixed-point RNA shearing in a fish embryo, the CasRx-mediated knockout has higher efficiency and specificity, the CasRx can be flexibly packaged into adeno-associated virus, the CasRx is a programmable RNA binding module, the cellular RNA can be effectively positioned, the CasRx can be used for shearing off the RNA corresponding to the exogenous fluorescent protein with high efficiency, and the visualized genetic marker is weakened; CasRx can also be used for efficiently knocking down some RNAs corresponding to genes with obvious phenotypes or key genes so as to lead the RNAs to have different phenotypes or die.
In order to achieve the purpose, the invention adopts the following technical scheme:
a technology for realizing precise site-specific RNA shearing in fish embryos comprises the following steps:
A. designing and preparing a wild type CasRx sequence, exogenous fluorescent protein (GFP and BFP) mRNA and corresponding guide RNA (sgRNA) and guide RNA (sgRNA) of an endogenous gene;
B. determining the dosage of each component of RNA during microinjection;
C. a method for detecting the cutting efficiency of exogenous mRNA in zebra fish embryos;
D. a method for detecting the cutting efficiency of endogenous mRNA in zebra fish embryos;
E. a method for knocking down multiple endogenous genes simultaneously.
The method specifically comprises the following steps:
(1) designing and preparing a wild type CasRx sequence, exogenous fluorescent protein (GFP and BFP) mRNA and corresponding guide RNA (sgRNA) and guide RNA (sgRNA) of an endogenous gene;
adding a nuclear localization sequence (nucleous localization sequence) into the CasRx sequence respectively, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a capped (capped) and a polyA tail by using an in vitro transcription kit, purifying the extracted RNA, and freezing at-80 ℃ for later use; designing primers of exogenous fluorescent protein (GFP, BFP) DNA to synthesize DNA, synthesizing mRNA through in vitro transcription, purifying the extracted RNA, and freezing at-80 ℃ for later use; different sgRNAs are synthesized into a fixed sequence with a T7 promoter at the upstream and different downstream sequences partially complementary with the upstream through DNA, double-stranded DNA is obtained through PCR amplification, the double-stranded DNA is obtained by using an in vitro transcription kit, and the purified and extracted RNA is frozen at-80 ℃ for later use.
(2) Determining the dosage of each component of RNA in the mixed solution during microinjection;
a. the final mRNA concentration of each fluorescent protein in the mixed solution is 600ng/ul, the final concentration of sgRNA is 100ng/ul, the final concentration of CasRx mRNA is 200 ng/ul., and about ~ 1nl is injected into each embryo;
b. the final concentration of sgRNA in the mixture was 100ng/ul, and the final concentration of CasRxmRNA was 200 ng/ul., and about ~ 1nl per embryo was injected for the microinjection of endogenous genes.
(3) A method for detecting the cutting efficiency of exogenous mRNA in zebra fish embryos;
after injecting corresponding experimental group and control group components in the zebra fish embryo unicellular stage, taking a plurality of fluorescence images of microinjected control group and each experimental group embryo by confocal shooting at about 12 h, then respectively taking 30 embryos of the control group and each experimental group, subpackaging 2 tubes of EP tubes (15 embryos each), adding 200ul Trizol into the EP tubes, freezing at-80 ℃, and then extracting RNA. The RNA is used for reverse transcription by a reverse transcription kit, and the obtained DNA is used for real-time fluorescence quantitative PCR. The fluorescence images shot by confocal and the quantitative PCR images shot by LightCycler 96 SW 1.1 and GraphPad Prism 5 were analyzed by corresponding software LAS AFLite, GraphPad Prism 5 and ImageJ.
(4) A method for detecting the cutting efficiency of endogenous mRNA in zebra fish embryos;
after injecting corresponding experimental group and control group components in the zebra fish embryo unicellular stage, respectively carrying out phenotype photographing on microinjected WT and untreated WT by using a fluorescence inverted microscope at 24h and carrying out deformity statistics at 24h, taking 30 malformed embryos of the control group and each experimental group after 24h, subpackaging 3 tubes of EP (10 embryos) and adding 200ul Trizol into the EP tubes, freezing at-80 ℃, and then extracting RNA. The RNA is used for reverse transcription by a reverse transcription kit, and the obtained DNA is used for real-time fluorescence quantitative PCR. The quantitative PCR graphs were analyzed using the corresponding software LightCycler 96 SW 1.1, GraphPad Prism 5.
(5) A method for knocking down multiple endogenous genes simultaneously.
Preparing a mixed solution with the final concentration of CasRx mRNA of 200 ng/ul, the final concentration of A gene-oriented sgRNA of 100ng/ul, the final concentration of B gene-oriented sgRNA of 100ng/ul and the final concentration of C gene-oriented sgRNA of 100ng/ul, injecting the components into zebrafish embryos at the same time, and observing the development condition of the zebrafish embryos.
The invention utilizes CRISPR/CasRx mediated RNA editing technology capable of RNA targeted editing to act on zebra fish embryos, CasRx mediated knockout has higher efficiency and specificity, CasRx can be flexibly packaged into adeno-associated virus, CasRx is a programmable RNA binding module, cellular RNA can be effectively positioned, and the CasRx can be used for efficiently shearing off RNA corresponding to exogenous fluorescent protein to weaken visual genetic markers; CasRx can also be used to knock down RNA corresponding to genes with obvious or key phenotype to cause the RNA to have different phenotypes or die.
CasRx is one of Cas13 d. The Cas13 RNA editing system consists of a Cas13 protein and a strand of CRISPR RNA (crRNA) 64 to 66 nt in length that is capable of recognizing a 22 to 30 nt specific RNA sequence by a spacer. The Cas13 system has several major advantages as an RNA editing tool: 1. cas13 is able to recognize all target RNAs by changing the sequence of the crRNA spacer; 2. cas13 differs from Cas9 and Cpf1 in that no specific sequence elements (such as PAM sites) are required for the target sequence; 3. the effective complex of Cas13 is the simplest one of CRISPR-Cas systems, and a system consisting of Cas 13-crRNA is easier to handle and deliver than a trimeric multimerization system; 4. multiple crRNAs directed against different target sequences can be delivered simultaneously. High efficiency, easy operation, high specificity and the like, and it is noted that the Cas 13-mediated RNA editing technology can be highly distinctive in gene function studies (Kim, 2018).
In the specific implementation of the invention, a nuclear localization sequence (nuclear localization sequence) is respectively added into a wild type CasRx sequence, then an SP6 promoter sequence is added into the upstream of the whole sequence, mRNA with a capped (capped) and a poly A tail is obtained by using an in vitro transcription kit, and the extracted RNA is purified and frozen at-80 ℃ for later use; designing primers of exogenous fluorescent protein (GFP, BFP) DNA to synthesize DNA, synthesizing mRNA through in vitro transcription, purifying the extracted RNA, and freezing at-80 ℃ for later use; different sgRNAs are synthesized into a fixed sequence with a T7 promoter at the upstream and different downstream sequences partially complementary with the upstream through DNA, double-stranded DNA is obtained through PCR amplification, the double-stranded DNA is obtained by using an in vitro transcription kit, and the purified and extracted RNA is frozen at-80 ℃ for later use.
CRISPR/CasRx is a novel class of RNA editing tools, and CasRx is the most efficient version reported to date. Although the efficiency of CRISPR/CasRx in cells is good, no report on gene knockdown of zebrafish embryos exists at present.
The invention has the advantages that:
(1) the price is low, and only one short primer sequence (less than 50 bp) needs to be replaced to target the RNA of one target gene;
compared with the traditional zebra fish embryo Morpholino knock-down technology, the invention has the advantages of convenient design and lower cost, adopts a primer pairing amplification method in the design of the guide RNA, adopts a fixed forward primer, matches a specific targeted reverse sequence, can amplify the template DNA of the guide RNA, provides purification and transcription, and can quickly obtain the targeted specific guide RNA.
(2) The components are simple and are all RNA, the toxicity is low, and the operation is simple;
the component only needs fixed CasRx mRNA and specific targeted guide RNA, has simple components, proper dosage and less toxicity, and can reduce the toxic interference of samples.
(3) Multiple gRNAs can realize simultaneous knockdown of multiple genes;
the guide RNA sequence is short, the cost is low, the synthesis is convenient, the toxicity is low, a plurality of gRNAs can be added simultaneously, and the simultaneous knock-down of multiple genes is realized.
(4) The efficiency is high, and the aging is long;
the CasRx-mediated RNA targeted cleavage has very high sequence specificity, because CasRx mRNA adopts WPRE and poly A-tailed bistable measures, and the CasRx mRNA has long and stable existence time of an embryo and is enough to ensure the continuous cleavage effect of target RNA in the process of embryo development.
(5) The efficiency analysis method is simple and easy to implement.
The research provides a simple and convenient analysis method of the cutting efficiency of the target RNA, and the cutting efficiency of the target RNA sequence can be quickly analyzed by adopting a real-timePCR method and providing a proper internal reference.
Drawings
FIG. 1 is a schematic diagram of the use of the CasRx mediated RNA editing system in zebrafish embryos.
FIG. 2 validation of the efficiency of CasRx mediated RNA editing to cleave exogenous mRNA in zebrafish embryos; wherein A, B: representation and efficiency statistics of CasRx cleavage of EGFP mRNA in zebrafish embryos; C. d: representation and efficiency statistics of CasRx cleavage of BFP mRNA in zebrafish embryos.
FIG. 3 validation of the efficiency of CasRx mediated RNA editing to cleave endogenous mRNA in zebrafish embryos; wherein A: a 24h tabular chart; b: graph of qPCR analysis.
Detailed Description
"target site" in this application refers to any segment of the RNA sequence to be knocked down in the target nucleotide. An RNA sequence in the vicinity of the target site that is capable of accommodating recognition of the exogenous sequence at the target site. In particular embodiments, the target RNA sequence is a single-stranded RNA sequence, including, but not limited to, RNA sequences in cells, RNA sequences of viruses, and the like.
By "exogenous RNA sequence" is meant in this application exogenous fluorescent protein-capped tailed RNA.
Example 1 preparation of wild-type CasRx sequence, mRNA of exogenous fluorescent proteins (EGFP, BFP) and sgRNA
Respectively adding a nuclear localization sequence (CCGCCACC) into a wild type CasRx sequence, then adding an SP6 promoter sequence (CATACGATTTAGGTGACACTATAGAA) into the upstream of the whole sequence, obtaining mRNA with a capped mRNA and a polyA tail by using an in vitro transcription kit, and purifying the extracted RNA for freezing at-80 ℃ for later use; designing primers of exogenous fluorescent protein (GFP, BFP) DNA to synthesize DNA, synthesizing mRNA through in vitro transcription, purifying the extracted RNA, and freezing at-80 ℃ for later use; different sgRNAs are synthesized into a fixed sequence with a T7 promoter at the upstream and different downstream sequences partially complementary with the upstream through DNA, double-stranded DNA is obtained through PCR amplification, the double-stranded DNA is obtained by using an in vitro transcription kit, and the purified and extracted RNA is frozen at-80 ℃ for later use.
Sequence 1: CasRx template sequence > PSKII-SP6-kozak-NLS-CasRx-NLS-HA-WPRE-PSKII
GTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGCATACGATTTAGGTGACACTATAGAA (SP 6 promoter sequence) CCGCCACC (nuclear localization sequence)atgagccccaagaagaagagaaaggtggaggccagc atcgaaaaaaaaaagtccttcgccaagggcatgggcgtgaagtccacactcgtgtccggctccaaagtgtacatga caaccttcgccgaaggcagcgacgccaggctggaaaagatcgtggagggcgacagcatcaggagcgtgaatgaggg cgaggccttcagcgctgaaatggccgataaaaacgccggctataagatcggcaacgccaaattcagccatcctaag ggctacgccgtggtggctaacaaccctctgtatacaggacccgtccagcaggatatgctcggcctgaaggaaactc tggaaaagaggtacttcggcgagagcgctgatggcaatgacaatatttgtatccaggtgatccataacatcctgga cattgaaaaaatcctcgccgaatacattaccaacgccgcctacgccgtcaacaatatctccggcctggataaggac attattggattcggcaagttctccacagtgtatacctacgacgaattcaaagaccccgagcaccatagggccgctt tcaacaataacgataagctcatcaacgccatcaaggcccagtatgacgagttcgacaacttcctcgataaccccag actcggctatttcggccaggcctttttcagcaaggagggcagaaattacatcatcaattacggcaacgaatgctat gacattctggccctcctgagcggactgaggcactgggtggtccataacaacgaagaagagtccaggatctccagga cctggctctacaacctcgataagaacctcgacaacgaatacatctccaccctcaactacctctacgacaggatcac caatgagctgaccaactccttctccaagaactccgccgccaacgtgaactatattgccgaaactctgggaatcaac cctgccgaattcgccgaacaatatttcagattcagcattatgaaagagcagaaaaacctcggattcaatatcacca agctcagggaagtgatgctggacaggaaggatatgtccgagatcaggaaaaatcataaggtgttcgactccatcag gaccaaggtctacaccatgatggactttgtgatttataggtattacatcgaagaggatgccaaggtggctgccgcc aataagtccctccccgataatgagaagtccctgagcgagaaggatatctttgtgattaacctgaggggctccttca acgacgaccagaaggatgccctctactacgatgaagctaatagaatttggagaaagctcgaaaatatcatgcacaa catcaaggaatttaggggaaacaagacaagagagtataagaagaaggacgcccctagactgcccagaatcctgccc gctggccgtgatgtttccgccttcagcaaactcatgtatgccctgaccatgttcctggatggcaaggagatcaacg acctcctgaccaccctgattaataaattcgataacatccagagcttcctgaaggtgatgcctctcatcggagtcaa cgctaagttcgtggaggaatacgcctttttcaaagactccgccaagatcgccgatgagctgaggctgatcaagtcc ttcgctagaatgggagaacctattgccgatgccaggagggccatgtatatcgacgccatccgtattttaggaacca acctgtcctatgatgagctcaaggccctcgccgacaccttttccctggacgagaacggaaacaagctcaagaaagg caagcacggcatgagaaatttcattattaataacgtgatcagcaataaaaggttccactacctgatcagatacggt gatcctgcccacctccatgagatcgccaaaaacgaggccgtggtgaagttcgtgctcggcaggatcgctgacatcc agaaaaaacagggccagaacggcaagaaccagatcgacaggtactacgaaacttgtatcggaaaggataagggcaa gagcgtgagcgaaaaggtggacgctctcacaaagatcatcaccggaatgaactacgaccaattcgacaagaaaagg agcgtcattgaggacaccggcagggaaaacgccgagagggagaagtttaaaaagatcatcagcctgtacctcaccg tgatctaccacatcctcaagaatattgtcaatatcaacgccaggtacgtcatcggattccattgcgtcgagcgtga tgctcaactgtacaaggagaaaggctacgacatcaatctcaagaaactggaagagaagggattcagctccgtcacc aagctctgcgctggcattgatgaaactgcccccgataagagaaaggacgtggaaaaggagatggctgaaagagcca aggagagcattgacagcctcgagagcgccaaccccaagctgtatgccaattacatcaaatacagcgacgagaagaa agccgaggagttcaccaggcagattaacagggagaaggccaaaaccgccctgaacgcctacctgaggaacaccaag tggaatgtgatcatcagggaggacctcctgagaattgacaacaagacatgtaccctgttcagaaacaaggccgtcc acctggaagtggccaggtatgtccacgcctatatcaacgacattgccgaggtcaattcctacttccaactgtacca ttacatcatgcagagaattatcatgaatgagaggtacgagaaaagcagcggaaaggtgtccgagtacttcgacgct gtgaatgacgagaagaagtacaacgataggctcctgaaactgctgtgtgtgcctttcggctactgtatccccaggt ttaagaacctgagcatcgaggccctgttcgataggaacgaggccgccaagttcgacaaggagaaaaagaaggtgtc cggcaattccggatccggacctaagaaaaagaggaaggtggcggccgcttacccatacgatgttccagattacgctaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAAT
Sequence 2: EGFP template sequence SP6-kozak-EGFP
CATACGATTTAGGTGACACTATAGAA (SP 6 promoter sequence) CCGCCACC (nuclear localization sequence) GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
And (3) sequence: BFP template sequence > SP6-kozak-EGFP > SP6-vertebrate kozak-tagBFP-stop
CATACGATTTAGGTGACACTATAGAA (SP 6 promoter sequence) CCGCCACC (nuclear localization sequence) atgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtggacaaccatcacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctctccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacccagggcatccccgacttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggccctgtgatgcagaagaaaacactcggctgggaggccttcaccgagacgctgtaccccgctgacggcggcctggaaggcagaaacgacatggccctgaagctcgtgggcgggagccatctgatcgcaaacatcaagaccacatatagatccaagaaacccgctaagaacctcaagatgcctggcgtctactatgtggactacagactggaaagaatcaaggaggccaacaacgagacctacgtcgagcagcacgaggtggcagtggccagatactgcgacctccctagcaaactggggcacaagcttaatTAA
And (3) sequence 4: DNA template sequence primer synthetic sequence for sgRNA synthesis
sg-scaffold-F | GAAATTAATACGACTCACTATAGGcactagtgcgaatttgcactagtctaaaac |
sg-R | (22-26bp specific targeting sequence insertion) gttttagactagtgcaaa |
Example 2 cleavage of exogenous EGFPMRNA sequences in Zebra Fish embryos
Respectively adding a nuclear localization sequence (nucleous localization sequence) into a wild CasRx sequence, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a capped (capped) and a polyA tail by using an in vitro transcription kit, obtaining an exogenous EGFP mRNA sequence by using an exogenous EGFP DNA sequence and an in vitro transcription kit, synthesizing upstream of sgRNA by using DNA (deoxyribonucleic acid) to obtain a T7 promoter sequence and a downstream sequence partially complementary to the upstream, performing PCR (polymerase chain reaction) amplification to obtain double-stranded DNA, and obtaining the double-stranded DNA by using an in vitro transcription kit; then freezing and storing at-80 ℃ for later use. Taking out and injecting single-cell embryos in a determined proportion in a mixing manner during microinjection, and taking a fluorescence image and freezing the embryos by using a confocal microscope for 12 h to be subjected to qPCR analysis.
DNA template sequence primer synthesis sequence for EGFP sgRNA synthesis
Example 3 cleavage of exogenous BFP mRNA sequence in Zebra fish embryos
Respectively adding a nuclear localization sequence (nuclear localization sequence) into a wild CasRx sequence, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a capped (capped) and a polyA tail by using an in vitro transcription kit, obtaining an exogenous BFP mRNA sequence by using an exogenous BFP DNA sequence and an exogenous BFP mRNA sequence by using an in vitro transcription kit, synthesizing upstream of sgRNA by using DNA (deoxyribonucleic acid) to obtain a T7 promoter sequence and a downstream sequence partially complementary to the upstream, performing PCR (polymerase chain reaction) amplification to obtain double-stranded DNA, and obtaining the double-stranded DNA by using an in vitro transcription kit; then freezing and storing at-80 ℃ for later use. Taking out and injecting single-cell embryos in a determined proportion in a mixing manner during microinjection, and taking a fluorescence image and freezing the embryos by using a confocal microscope for 12 h to be subjected to qPCR analysis.
DNA template sequence primer synthetic sequence for BFP sgRNA synthesis
Example 4 cleavage of endogenous Actb mRNA sequence in Zebra fish embryos
Respectively adding a nuclear localization sequence (nuclear localization sequence) into a wild type CasRx sequence, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a capped (capped) and a polyA tail by using an in vitro transcription kit, synthesizing an upstream T7 promoter sequence and a downstream sequence which is partially complementary with the upstream by using sgRNA through DNA, obtaining double-stranded DNA through PCR amplification, and obtaining the double-stranded DNA by using the in vitro transcription kit; then freezing and storing at-80 ℃ for later use. And taking out and injecting the single-cell embryos in a determined ratio in a mixing manner during microinjection, and taking a phenotype image and freezing the embryos by inverting a microscope for 24h to be subjected to qPCR analysis.
DNA template sequence primer synthetic sequence for Actb sgRNA synthesis
sg-scaffold-F | GAAATTAATACGACTCACTATAGGcactagtgcgaatttgcactagtctaaaac |
Actb-sg-R | ccagacatcagggagtgatggtgttttagactagtgcaaa |
Example 5 cleavage of endogenous Neurog1 mRNA sequence in Zebra fish embryos
Respectively adding a nuclear localization sequence (nuclear localization sequence) into wild type CasRx, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a capped (capped) and a poly A tail by using an in vitro transcription kit, synthesizing the upstream of sgRNA by using DNA to obtain a T7 promoter sequence and a downstream sequence which is partially complementary with the upstream, obtaining double-stranded DNA by PCR amplification, and obtaining the double-stranded DNA by using the in vitro transcription kit; then freezing and storing at-80 ℃ for later use. And taking out and injecting the single-cell embryos in a determined ratio in a mixing manner during microinjection, and taking a phenotype image and freezing the embryos by inverting a microscope for 24h to be subjected to qPCR analysis.
DNA template sequence primer synthesis sequence for Neurog1 sgRNA synthesis
sg-scaffold-F | GAAATTAATACGACTCACTATAGGcactagtgcgaatttgcactagtctaaaac |
Neurog1-sg-R | AACCTCAAGCTGTGACTACTCCgttttagactagtgcaaa |
For convenience, this example used microinjection to introduce the mRNA compositions of the present invention into fertilized zebrafish eggs, the final mRNA concentration of each fluorescent protein in the compositions was 600ng/ul, the final concentration of sgRNA was 100ng/ul, and about ~ 1nl per embryo was injected at 200 ng/ul. injection for CasRx mRNA.
Example 6 preparation of transgenic Zebra Fish lines
Collecting the zebra fish embryo at the unicellular stage, injecting according to the scheme, and culturing the zebra fish embryo into adult fish.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fuzhou university
<120> a technology for realizing precise site-specific RNA shearing in fish embryo
<130>13
<160>13
<170>PatentIn version 3.3
<210>1
<211>8
<212>DNA
<213> Artificial sequence
<400>1
ccgccacc 8
<210>2
<211>26
<212>DNA
<213> Artificial sequence
<400>2
catacgattt aggtgacact atagaa 26
<210>3
<211>3767
<212>DNA
<213> Artificial sequence
<400>3
gtaaaacgac ggccagtgaa ttgtaatacg actcactata gggcgaattg gcatacgatt 60
taggtgacac tatagaaccg ccaccatgag ccccaagaag aagagaaagg tggaggccag 120
catcgaaaaa aaaaagtcct tcgccaaggg catgggcgtg aagtccacac tcgtgtccgg 180
ctccaaagtg tacatgacaa ccttcgccga aggcagcgac gccaggctgg aaaagatcgt 240
ggagggcgac agcatcagga gcgtgaatga gggcgaggcc ttcagcgctg aaatggccga 300
taaaaacgcc ggctataaga tcggcaacgc caaattcagc catcctaagg gctacgccgt 360
ggtggctaac aaccctctgt atacaggacc cgtccagcag gatatgctcg gcctgaagga 420
aactctggaa aagaggtact tcggcgagag cgctgatggc aatgacaata tttgtatcca 480
ggtgatccat aacatcctgg acattgaaaa aatcctcgcc gaatacatta ccaacgccgc 540
ctacgccgtc aacaatatct ccggcctgga taaggacatt attggattcg gcaagttctc 600
cacagtgtat acctacgacg aattcaaaga ccccgagcac catagggccg ctttcaacaa 660
taacgataag ctcatcaacg ccatcaaggc ccagtatgac gagttcgaca acttcctcga 720
taaccccaga ctcggctatt tcggccaggc ctttttcagc aaggagggca gaaattacat 780
catcaattac ggcaacgaat gctatgacat tctggccctc ctgagcggac tgaggcactg 840
ggtggtccat aacaacgaag aagagtccag gatctccagg acctggctct acaacctcga 900
taagaacctc gacaacgaat acatctccac cctcaactac ctctacgaca ggatcaccaa 960
tgagctgacc aactccttct ccaagaactc cgccgccaac gtgaactata ttgccgaaac 1020
tctgggaatc aaccctgccg aattcgccga acaatatttc agattcagca ttatgaaaga 1080
gcagaaaaac ctcggattca atatcaccaa gctcagggaa gtgatgctgg acaggaagga 1140
tatgtccgag atcaggaaaa atcataaggt gttcgactcc atcaggacca aggtctacac 1200
catgatggac tttgtgattt ataggtatta catcgaagag gatgccaagg tggctgccgc 1260
caataagtcc ctccccgata atgagaagtc cctgagcgag aaggatatct ttgtgattaa 1320
cctgaggggc tccttcaacg acgaccagaa ggatgccctc tactacgatg aagctaatag 1380
aatttggaga aagctcgaaa atatcatgca caacatcaag gaatttaggg gaaacaagac 1440
aagagagtat aagaagaagg acgcccctag actgcccaga atcctgcccg ctggccgtga 1500
tgtttccgcc ttcagcaaac tcatgtatgc cctgaccatg ttcctggatg gcaaggagat 1560
caacgacctc ctgaccaccc tgattaataa attcgataac atccagagct tcctgaaggt 1620
gatgcctctc atcggagtca acgctaagtt cgtggaggaa tacgcctttt tcaaagactc 1680
cgccaagatc gccgatgagc tgaggctgat caagtccttc gctagaatgg gagaacctat 1740
tgccgatgcc aggagggcca tgtatatcga cgccatccgt attttaggaa ccaacctgtc 1800
ctatgatgag ctcaaggccc tcgccgacac cttttccctg gacgagaacg gaaacaagct 1860
caagaaaggc aagcacggca tgagaaattt cattattaat aacgtgatca gcaataaaag 1920
gttccactac ctgatcagat acggtgatcc tgcccacctc catgagatcg ccaaaaacga 1980
ggccgtggtg aagttcgtgc tcggcaggat cgctgacatc cagaaaaaac agggccagaa 2040
cggcaagaac cagatcgaca ggtactacga aacttgtatc ggaaaggata agggcaagag 2100
cgtgagcgaa aaggtggacg ctctcacaaa gatcatcacc ggaatgaact acgaccaatt 2160
cgacaagaaa aggagcgtca ttgaggacac cggcagggaa aacgccgaga gggagaagtt 2220
taaaaagatc atcagcctgt acctcaccgt gatctaccac atcctcaaga atattgtcaa 2280
tatcaacgcc aggtacgtca tcggattcca ttgcgtcgag cgtgatgctc aactgtacaa 2340
ggagaaaggc tacgacatca atctcaagaa actggaagag aagggattca gctccgtcac 2400
caagctctgc gctggcattg atgaaactgc ccccgataag agaaaggacg tggaaaagga 2460
gatggctgaa agagccaagg agagcattga cagcctcgag agcgccaacc ccaagctgta 2520
tgccaattac atcaaataca gcgacgagaa gaaagccgag gagttcacca ggcagattaa 2580
cagggagaag gccaaaaccg ccctgaacgc ctacctgagg aacaccaagt ggaatgtgat 2640
catcagggag gacctcctga gaattgacaa caagacatgt accctgttca gaaacaaggc 2700
cgtccacctg gaagtggcca ggtatgtcca cgcctatatc aacgacattg ccgaggtcaa 2760
ttcctacttc caactgtacc attacatcat gcagagaatt atcatgaatg agaggtacga 2820
gaaaagcagc ggaaaggtgt ccgagtactt cgacgctgtg aatgacgaga agaagtacaa 2880
cgataggctc ctgaaactgc tgtgtgtgcc tttcggctac tgtatcccca ggtttaagaa 2940
cctgagcatc gaggccctgt tcgataggaa cgaggccgcc aagttcgaca aggagaaaaa 3000
gaaggtgtcc ggcaattccg gatccggacc taagaaaaag aggaaggtgg cggccgctta 3060
cccatacgat gttccagatt acgctaatca acctctggat tacaaaattt gtgaaagatt 3120
gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc 3180
tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg 3240
gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac 3300
tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc 3360
cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc 3420
ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa 3480
atcatcgtcc tttccttggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc 3540
cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc 3600
ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg 3660
ggccgcctcc ccgccagctt ttgttccctt tagtgagggt taatttcgag cttggcgtaa 3720
tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaat 3767
<210>4
<211>751
<212>DNA
<213> Artificial sequence
<400>4
catacgattt aggtgacact atagaaccgc caccgtgagc aagggcgagg agctgttcac 60
cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt 120
gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac 180
caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca 240
gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc 300
cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg 360
cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga 420
cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa 480
cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca 540
caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg 600
cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa 660
agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat 720
cactctcggc atggacgagc tgtacaagta a 751
<210>5
<211>735
<212>DNA
<213> Artificial sequence
<400>5
catacgattt aggtgacact atagaaccgc cacatgagcg agctgattaa ggagaacatg 60
cacatgaagc tgtacatgga gggcaccgtg gacaaccatc acttcaagtg cacatccgag 120
ggcgaaggca agccctacga gggcacccag accatgagaa tcaaggtggt cgagggcggc 180
cctctcccct tcgccttcga catcctggct actagcttcc tctacggcag caagaccttc 240
atcaaccaca cccagggcat ccccgacttc ttcaagcagt ccttccctga gggcttcaca 300
tgggagagag tcaccacata cgaagacggg ggcgtgctga ccgctaccca ggacaccagc 360
ctccaggacg gctgcctcat ctacaacgtc aagatcagag gggtgaactt cacatccaac 420
ggccctgtga tgcagaagaa aacactcggc tgggaggcct tcaccgagac gctgtacccc 480
gctgacggcg gcctggaagg cagaaacgac atggccctga agctcgtggg cgggagccat 540
ctgatcgcaa acatcaagac cacatataga tccaagaaac ccgctaagaa cctcaagatg 600
cctggcgtct actatgtgga ctacagactg gaaagaatca aggaggccaa caacgagacc 660
tacgtcgagc agcacgaggt ggcagtggcc agatactgcg acctccctag caaactgggg 720
cacaagctta attaa 735
<210>6
<211>54
<212>DNA
<213> Artificial sequence
<400>6
gaaattaata cgactcacta taggcactag tgcgaatttg cactagtcta aaac 54
<210>7
<211>18
<212>DNA
<213> Artificial sequence
<400>7
gttttagact agtgcaaa 18
<210>8
<211>40
<212>DNA
<213> Artificial sequence
<400>8
tgaagttcat ctgcaccacc gggttttaga ctagtgcaaa 40
<210>9
<211>40
<212>DNA
<213> Artificial sequence
<400>9
cttcaaggac gacggcaact acgttttaga ctagtgcaaa 40
<210>10
<211>40
<212>DNA
<213> Artificial sequence
<400>10
caccgtggac aaccatcact tcgttttaga ctagtgcaaa 40
<210>11
<211>40
<212>DNA
<213> Artificial sequence
<400>11
cttcacatgg gagagagtca ccgttttaga ctagtgcaaa 40
<210>12
<211>40
<212>DNA
<213> Artificial sequence
<400>12
ccagacatca gggagtgatg gtgttttaga ctagtgcaaa 40
<210>13
<211>40
<212>DNA
<213> Artificial sequence
<400>13
aacctcaagc tgtgactact ccgttttaga ctagtgcaaa 40
Claims (3)
1. A technology for realizing precise site-specific RNA shearing in fish embryos is characterized in that: and (3) realizing the precise fixed point RNA knockdown in the fish embryo by utilizing a CRISPR/CasRx mediated RNA editing technology and according to the fact that the guide RNA acts on the specific RNA in the zebra fish embryo at the precise fixed point.
2. The technique for achieving pinpoint RNA excision in fish embryos of claim 1, comprising the following steps:
A. designing and preparing a wild CasRx sequence, exogenous fluorescent protein mRNA, corresponding guide RNA and guide RNA of an endogenous gene;
B. determining the dosage of each component of RNA during microinjection;
C. cleavage of exogenous mRNA in zebrafish embryos;
D. cleavage of endogenous mRNA in zebrafish embryos;
E. endogenous multiple genes were knocked down simultaneously.
3. The technology for realizing the precise site-specific RNA cleavage in a fish embryo as claimed in claim 1, which specifically comprises the following steps:
(1) design and preparation of wild type CasRx sequence, exogenous fluorescent protein mRNA, corresponding guide RNA, guide RNA of endogenous gene: respectively adding a nuclear localization sequence into a CasRx sequence, then adding an SP6 promoter sequence into the upstream of the whole sequence, obtaining mRNA with a cap and a polyA tail by using an in vitro transcription kit, and purifying and storing the extracted RNA at-80 ℃ for later use; designing a primer of exogenous fluorescent protein DNA to synthesize DNA, synthesizing mRNA through in vitro transcription, and freezing and storing the purified and extracted RNA at-80 ℃ for later use; different sgRNAs are synthesized into a fixed sequence with a T7 promoter at the upstream and different downstream sequences partially complementary with the upstream through DNA, double-stranded DNA is obtained through PCR amplification, the double-stranded DNA is obtained by using an in vitro transcription kit, and the purified and extracted RNA is frozen at-80 ℃ for later use;
(2) determining the dosage of each component of RNA in the mixed solution during microinjection;
a. dosage of each component of RNA during microinjection of exogenous genes: the final mRNA concentration of each fluorescent protein in the mixed solution is 600 ng/ul; the final concentration of sgRNA is 100 ng/ul; the final concentration of CasRx mRNA was 200 ng/ul; 1nl per embryo;
b. dose of RNA components at microinjection for endogenous genes: the final concentration of sgRNA in the mixed solution is 100 ng/ul; the final concentration of CasRxmRNA is 200 ng/ul; 1nl per embryo;
(3) cleavage of exogenous mRNA in zebrafish embryos: after injecting corresponding experimental group and control group components in the zebra fish embryo unicellular stage, taking a plurality of fluorescence images of microinjected control group and each experimental group embryo by confocal shooting at 12 h, then respectively taking 30 embryos of the control group and each experimental group, subpackaging the control group and each experimental group into 2 tubes of EP tubes, adding 200ul Trizol into the EP tubes, freezing at-80 ℃, and then extracting RNA; carrying out reverse transcription on the RNA by using a reverse transcription kit, and carrying out real-time fluorescence quantitative PCR on the obtained DNA; correspondingly analyzing a fluorescence image shot by confocal and a quantitative PCR image by LightCycler 96 SW 1.1 and GraphPad Prism 5 by using corresponding software LAS AF Lite, GraphPad Prism 5 and ImageJ;
(4) Cleavage of endogenous mRNA in zebrafish embryos: after injecting corresponding experimental group and control group components in the zebra fish embryo single cell period, respectively carrying out phenotype photographing on microinjected and untreated WT by using a fluorescence inverted microscope at 24h and carrying out deformity statistics at 24h, subpackaging 30 malformed embryos of the control group and each experimental group into 3 tubes of EP tubes after 24h, adding 200ul Trizol into the EP tubes, freezing at-80 ℃, and then extracting RNA; carrying out reverse transcription on the RNA by using a reverse transcription kit, and carrying out real-time fluorescence quantitative PCR on the obtained DNA; carrying out corresponding analysis on a quantitative PCR diagram by using corresponding software LightCycler 96 SW 1.1 and GraphPad Prism 5;
(5) Endogenous multiple genes were knocked down simultaneously: preparing a mixed solution with the final concentration of CasRx mRNA of 200 ng/ul, the final concentration of A gene-oriented sgRNA of 100ng/ul, the final concentration of B gene-oriented sgRNA of 100ng/ul and the final concentration of C gene-oriented sgRNA of 100ng/ul, injecting the components into zebrafish embryos at the same time, and observing the development condition of the zebrafish embryos.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910994671.7A CN110669795A (en) | 2019-10-18 | 2019-10-18 | Technology for realizing precise fixed-point RNA shearing in fish embryo |
PCT/CN2020/100974 WO2021073173A1 (en) | 2019-10-18 | 2020-07-09 | Technique for precise site-specific rna shearing in fish embryo |
ZA2021/10568A ZA202110568B (en) | 2019-10-18 | 2021-12-17 | Technique for precise site-specific rna shearing in fish embryo |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910994671.7A CN110669795A (en) | 2019-10-18 | 2019-10-18 | Technology for realizing precise fixed-point RNA shearing in fish embryo |
Publications (1)
Publication Number | Publication Date |
---|---|
CN110669795A true CN110669795A (en) | 2020-01-10 |
Family
ID=69083066
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910994671.7A Pending CN110669795A (en) | 2019-10-18 | 2019-10-18 | Technology for realizing precise fixed-point RNA shearing in fish embryo |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN110669795A (en) |
WO (1) | WO2021073173A1 (en) |
ZA (1) | ZA202110568B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021073173A1 (en) * | 2019-10-18 | 2021-04-22 | 福州大学 | Technique for precise site-specific rna shearing in fish embryo |
CN114231561A (en) * | 2021-12-22 | 2022-03-25 | 重庆医科大学 | Method for knocking down animal mRNA based on CRISPR-Cas13d and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106636197A (en) * | 2016-09-22 | 2017-05-10 | 南京市妇幼保健院 | Method for directional knockdown of multi-copy gene in zebrafish genome |
CN107058320A (en) * | 2017-04-12 | 2017-08-18 | 南开大学 | The preparation and its application of IL7R gene delection zebra fish mutant |
CN108949830A (en) * | 2018-08-03 | 2018-12-07 | 福州大学 | A method of realizing genome editor, pinpoint gene knock-in in fish |
US20190062724A1 (en) * | 2017-08-22 | 2019-02-28 | Salk Institute For Biological Studies | Rna targeting methods and compositions |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2017335890B2 (en) * | 2016-09-30 | 2024-05-09 | The Regents Of The University Of California | RNA-guided nucleic acid modifying enzymes and methods of use thereof |
WO2019051278A1 (en) * | 2017-09-07 | 2019-03-14 | The Board Of Trustees Of The Leland Stanford Junior University | Nuclease systems for genetic engineering |
CN110257420A (en) * | 2019-06-14 | 2019-09-20 | 中国科学院武汉植物园 | Plant gene silencing carrier and its construction method and application based on CasRx |
CN110669795A (en) * | 2019-10-18 | 2020-01-10 | 福州大学 | Technology for realizing precise fixed-point RNA shearing in fish embryo |
-
2019
- 2019-10-18 CN CN201910994671.7A patent/CN110669795A/en active Pending
-
2020
- 2020-07-09 WO PCT/CN2020/100974 patent/WO2021073173A1/en active Application Filing
-
2021
- 2021-12-17 ZA ZA2021/10568A patent/ZA202110568B/en unknown
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106636197A (en) * | 2016-09-22 | 2017-05-10 | 南京市妇幼保健院 | Method for directional knockdown of multi-copy gene in zebrafish genome |
CN107058320A (en) * | 2017-04-12 | 2017-08-18 | 南开大学 | The preparation and its application of IL7R gene delection zebra fish mutant |
US20190062724A1 (en) * | 2017-08-22 | 2019-02-28 | Salk Institute For Biological Studies | Rna targeting methods and compositions |
US20190207890A1 (en) * | 2017-08-22 | 2019-07-04 | Salk Institute For Biological Studies | Rna targeting methods and compositions |
CN108949830A (en) * | 2018-08-03 | 2018-12-07 | 福州大学 | A method of realizing genome editor, pinpoint gene knock-in in fish |
Non-Patent Citations (3)
Title |
---|
GOPAL KUSHAWAH 等: "CRISPR-Cas13d Induces efficient mRNA Knockdown in Animal Embryos", 《DEVELOPMENT CELL》 * |
SILVANA KONERMANN 等: "Transcriptome Engineering with RNA-Targeting", 《CELL》 * |
刘贵生 等: "与众不同的核酸酶Cas13a:编辑RNA的新CRISPR平台及其进展", 《湖北农业科学》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021073173A1 (en) * | 2019-10-18 | 2021-04-22 | 福州大学 | Technique for precise site-specific rna shearing in fish embryo |
CN114231561A (en) * | 2021-12-22 | 2022-03-25 | 重庆医科大学 | Method for knocking down animal mRNA based on CRISPR-Cas13d and application thereof |
Also Published As
Publication number | Publication date |
---|---|
ZA202110568B (en) | 2022-04-28 |
WO2021073173A1 (en) | 2021-04-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107760715B (en) | Transgenic vector and construction method and application thereof | |
CN108642055B (en) | sgRNA capable of effectively editing pig miR-17-92 gene cluster | |
US20200172935A1 (en) | Modified cpf1 mrna, modified guide rna, and uses thereof | |
RU2012125961A (en) | PLANTS OF SOY, RESISTANT TO HERBICIDES, AND WAYS OF IDENTIFICATION | |
RU2012125962A (en) | ELITE EVENT OF EE-GM3 AND METHODS AND KITS FOR IDENTIFICATION OF SUCH EVENT IN BIOLOGICAL SAMPLES | |
CN109266680B (en) | Method for preparing CKO/KI animal model by using Cas9 technology | |
US20220033811A1 (en) | Method and kit for preparing complementary dna | |
JP6952315B2 (en) | Genome editing method | |
CN110684777B (en) | Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings | |
US20230056763A1 (en) | Methods of targeted sequencing | |
CN110305896B (en) | Construction method of zebra fish kidney progenitor cell marker transgenic line | |
CN110669795A (en) | Technology for realizing precise fixed-point RNA shearing in fish embryo | |
US10633696B2 (en) | Method for analyzing 3′ end sequence of messenger RNA | |
CN111471699B (en) | Method for regulating CPEB3 gene expression | |
CN112831498A (en) | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN | |
CN109402269B (en) | Application of reagent for detecting miRNA-217-5p in preparation of duck intestinal stress detection reagent | |
CN112342214A (en) | sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and screening method thereof | |
CN110894511A (en) | Method for breeding ppm1g gene mutant zebra fish by gene editing | |
CN114480497B (en) | Construction and application method of ep400 gene knockout zebra fish heart failure model | |
CA3236802A1 (en) | Serine recombinases | |
CN116083492A (en) | Preparation method of csde1 gene deletion zebra fish mutant and construction method of zebra fish hematopoietic stem cell development defect model | |
CN112342215B (en) | sgRNA sequence of targeted knockout channel catfish mstna gene and screening method thereof | |
CN115029352A (en) | Method for breeding adgrg1 gene-deleted zebra fish through gene knockout | |
Wang et al. | Generating mouse models using zygote electroporation of nucleases (ZEN) technology with high efficiency and throughput | |
CN111893119A (en) | Method for obtaining SCD1 gene editing goat embryo by CRISPR/Cas9 system and microinjection |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |