CN112342214A

CN112342214A - sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and screening method thereof

Info

Publication number: CN112342214A
Application number: CN202011253224.5A
Authority: CN
Inventors: 张世勇; 陈校辉; 王明华; 钟立强; 段永强; 徐思琪; 边文冀
Original assignee: Freshwater Fisheries Research Institute of Jiangsu Province
Current assignee: Freshwater Fisheries Research Institute of Jiangsu Province
Priority date: 2020-11-11
Filing date: 2020-11-11
Publication date: 2021-02-09
Anticipated expiration: 2040-11-11
Also published as: CN112342214B

Abstract

The invention provides a sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and a screening method thereof, wherein a CRISPR sequence is designed, a PCR amplification product containing a target gene is prepared and connected with a vector, then the sgRNA is prepared by an in vitro transcription method, the sgRNA, a plasmid containing the target gene and a Cas9 protein are subjected to microinjection into a zebra fish fertilized egg, and the zebra fish fertilized egg is used as a reactor to screen the sgRNA sequence for targeted knockout of channel catfish zbtb38 gene. The method takes the zebra fish fertilized eggs as a reactor to screen out the sgRNA sequence of the edited ictalurus punctatus zbtb38 gene for the first time, has strong specificity and high knockout efficiency, has simple and quick knockout process, and provides animal materials for the subsequent analysis of the function of the ictalurus punctatus zbtb38 gene.

Description

sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and screening method thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to the technical field of preparation of channel catfish mutants, and particularly relates to a sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and a screening method thereof.

Background

The CRISPR/Cas system is an acquired immune defense system present in bacteria and archaea, which leaves foreign gene fragments as "memory antibodies" in the self genome to recognize re-invading viruses when bacteria are infected with viruses. The CRISPR/Cas system consists of CRISPR (clustered regulated short palindromic repeats) elements consisting of multiple identical repeats (repeats) alternating with different spacers (spacers) and genes encoding a range of Cas proteins. CRISPR/Cas9 is the most widely used type of CRISPR/Cas system, the Cas protein is composed of a single Cas9 protein, and the main function of Cas9 protein depends on: (1) cas9 needs crRNA and trans-activating RNA (tracrRNA) to guide the target sequence together in bacteria, and two RNA molecules have been properly modified in the existing genetic engineering, and the sequence is integrated into a single-stranded guide RNA (sgRNA); (2) cas9 specifically recognizes a base pair of 3-7 bp at the 3' end of the target DNA, namely a PAM (promoter adjacent motif) region. Now, because the gRNA is convenient to design and synthesize, and the system has high efficiency on the knockout efficiency of the target gene, the CRISPR/Cas9 system is widely applied to genetic modification of cells and animal models.

ZBTB38, also known as CIBZ, ZNF921 or PPP1R171, belongs to a ZBTB protein family (zinc finger and BTB domain-containing protein family) member, contains a BTB domain of about 1 amino acid at the N-terminus and a plurality of zinc finger domains at the C-terminus. The zinc finger structure at the C end of the protein family has the function of recognizing a fixed cis-acting element or combining with a DNA methylation site, and the BTB structural domain at the N end generally mediates the formation of homologous or heterologous protein-protein dimers or multimers, so that the chromatin structure is changed, and the function of gene transcription regulation is achieved. Some members of the ZBTB protein family have been shown to play important roles in a variety of biological processes including spermatogenesis, sex determination, nerve and organ development, tumorigenesis, and the like. In earlier researches, a plurality of sex-linked SNP sites exist on the channel catfish zbtb38 gene, and the channel catfish is supposed to play a certain role in the process of determining the sex of the channel catfish. How to effectively edit the channel catfish zbtb38 gene by using CRISPR/Cas9 is a technical problem to be solved.

Disclosure of Invention

The purpose of the invention is as follows: in order to overcome the defects in the prior art, the invention provides an sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and a screening method thereof.

The technical scheme is as follows: in order to achieve the purpose, the invention provides a screening method of a sgRNA sequence for targeted knockout of channel catfish zbtb38 gene, which comprises the steps of designing a CRISPR sequence, wherein the CRISPR sequence is shown as a sequence SEQ NO. 1-SEQ NO. 8; preparing a PCR amplification product containing a target gene fragment by using the CRISPR sequence, wherein the target gene fragment is shown as a sequence SEQ NO. 9; connecting the PCR amplification product containing the target gene fragment with a vector, transforming, screening positive transformants, cloning and shaking bacteria, and extracting a plasmid containing a target gene; preparing sgRNA by adopting an in vitro transcription method according to the designed CRISPR sequence; and (3) microinjecting the sgRNA, the plasmid containing the target gene and the Cas9 protein into a fertilized egg of the zebra fish, and screening and editing the sgRNA sequence of the channel catfish zbtb38 gene by using the fertilized egg of the zebra fish as a reactor.

Preferably, the CRISPR sequence is located 393bp before exon zbtb38 of the gene.

Preferably, the sequence of the sgRNA includes one or more of the sequences shown in SEQ NO. 21-SEQ NO. 28.

Preferably, the sgRNA is prepared by an in vitro transcription method, and the used forward primer sequence comprises one or more of sequences shown as SEQ NO. 12-SEQ NO. 19.

Preferably, the plasmid containing the target gene is extracted by cloning and shaking the bacteria, and the primer sequence used by the plasmid comprises one or more of the sequences shown in SEQ NO.10 and SEQ NO. 11.

Preferably, the plasmid containing the target gene is extracted by cloning and shaking the strain, and the used vector is pGEM-T Easy vector.

Preferably, the microinjection uses the sgRNA at a final concentration of 100ng/μ L in the injection solution and the Cas9 protein at a final concentration of 250ng/μ L.

As another aspect of the invention, the invention provides a sequence for targeted knockout of channel catfish zbtb38 gene, which comprises CRISPR sequence shown as sequence SEQ No. 7; the primer comprises one or more than one of the sequences shown in SEQ NO. 10-SEQ NO. 20; the sgRNA sequence comprises one or more sequences shown in SEQ NO. 21-SEQ NO. 28.

The invention has the following beneficial effects:

according to the invention, the sgRNA sequence for effectively editing the zbtb38 gene is screened out from the channel catfish, the sgRNA prepared according to the screened CRISPR sequence has strong specificity and high knockout efficiency, the knockout process is simple and quick, and animal materials can be provided for the subsequent analysis of the channel catfish zbtb38 gene function.

Drawings

FIG. 1 is a diagram showing the result of electrophoresis of amplified target genomic DNA fragments;

fig. 2 is a graph showing the electrophoresis results of the sgRNA in vitro transcription template after purification;

FIG. 3 is a diagram of mass electrophoretic identification results of sgRNAs prepared by in vitro synthesis;

FIG. 4 is a diagram showing the electrophoresis results of PCR amplification products identified by the gene knockout efficiency of zbtb 38;

fig. 5 is a typical peak of CRISPR2 for mutation detection;

fig. 6 is a typical peak of CRISPR7 for mutation detection.

Detailed Description

The present invention will be further described with reference to the accompanying drawings.

Example 1: CRISPR sequence design

1. Designing a targeting site

The genomic sequence of channel catfish zbtb38 is obtained from NCBI database, 8 CRISPR sequences are designed on the region before 393bp of exon in the experiment, and active CRISPR screening is carried out. The CRISPR design of the zbtb38 gene adopts an artificial method, and the candidate off-target prediction is realized by comparing a CRISPR sequence with a channel catfish genome sequence in GenBank through BLAST.

Table 1 CRISPR sequences designed based on the zbtb38 gene

2. PCR amplification of target genomic DNA fragments

1) The target genome sequence is shown as SEQ NO. 9:

ATGATGGTGGTCCATTCCAGCTGCAATGGGATGATGGACAACTTGCACCCCCACACTGTTCTTTCTCGACTCAGCGAACAACGATCACTTGGCCTGTTCTGTGATGTTACCATTGTTGTGGAGGACATCAAATTCCGTGCTCACAGAAATGTCTTGGCTGCGACTAGCGGATATTTCCGCAACGCTTTCACAGCCTCTGAGACTTGTGGTTCCAGCCAGGTGCTGGAAATTCCAGATCTCAAGTCAGAGGTGTTTGCCAGCATCCTTAATTTCATTTACTCCTCCAAAGTGGATTTAGCAAGTAAAGGGGACAACAAGTCCTTAATAGCTGCAGGGAAAAGGTTAGGGATCCCCTTTCTTGAGAAACTTCTTGAGATTGAAAGGCAAGACTCT。

2) primer design for PCR amplification

TABLE 2 amplification primers for the zbtb38 gene fragment

Sequence name	Sequence of	Use of	Numbering
				zbtb38-F1	CAATGGGATGATGGACAACT	Forward outer primer	SEQ NO.10
zbtb38-R1	AGTCTTGCCTTTCAATCTCA	Reverse outer primer	SEQ NO.11

3) PCR reaction system and conditions

The PCR reaction system (40. mu.L) was: 2 XMastermix (Novozan) 20. mu.L, 16. mu.L of ultrapure water, 1. mu.L of forward and reverse (zbtb38-F1, zbtb38-R1) primers (5. mu.M), and 2. mu.L of channel catfish target genomic DNA template.

The conditions of the PCR reaction were: 96 deg.C for 3min, 35 × (96 deg.C for 30s,60 deg.C for 30s,72 deg.C for 30s), 72 deg.C for 10min, and 4 deg.C.

The electrophoresis result of the amplified DNA fragment containing the target gene is shown in FIG. 1. Lane 2 from left to right is DNA Marker: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp and 5000bp are sequentially arranged from bottom to top; lane 1 is the PCR lateral amplification product.

4) PCR product recovery

The PCR product was recovered using a PCR clean up (Axygen) kit without nuclease contamination. Mixing 38 mu L of PCR outside amplification product with 114 mu L of Buffer PCR-A without nuclease pollution, placing the mixture on a recovery column, centrifuging for 1min, discarding waste liquid, adding Buffer W2, 12,000g, centrifuging for 1min, discarding waste liquid, repeating the step, discarding waste liquid, 12,000g, air-throwing and centrifuging for 1min, finally adding DEPC water (Nagjingguoshuyu biology company) with no nuclease pollution as a recovery solvent, wherein the recovery volume is 30 mu L.

5) Ligation of PCR amplification products of target genes

The recovered PCR amplification product was ligated into pGEM-T Easy vector (5. mu.L total volume reaction) consisting of:

the reaction time is as follows: incubating at room temperature for 60min

6) Transformation of

mu.L of the ligation product was transformed with 50. mu.L of E.coli DH 5. alpha. competent cells (pfu. gtoreq.108). Then, the plate was plated on LB plate containing ampicillin (50. mu.g/mL) and cultured overnight at 37 ℃ in an inverted state.

7) Recombinant screening of target Gene fragments

(1) And (3) rapidly preparing a PCR template: the plates were plated and 8 clones were randomly picked each with a 10. mu.L sterile tip. The samples were placed in PCR 8 tubes containing 20. mu.L of liquid LB, and mixed by hand quickly to serve as a template for PCR.

(2) PCR verification system reaction composition

A first reaction system:

and (2) reaction system II:

(3) and (3) PCR reaction conditions:

95 ℃ for 3min, 35 × (95 ℃ for 30s,56 ℃ for 30s,72 ℃ for 40s), 72 ℃ for 10min, and 4 ℃ for storage.

(4) Sequencing of transformants

After the above PCR verification, the positive transformants were sequenced by a commercial company, and 3 correct clones were obtained by sequencing primer T7, one of the clones was selected and shaken and extracted to obtain a plasmid (concentration 224 ng/. mu.L, OD value: 1.93).

Example 2: sgRNA in vitro transcription

1. Preparation of sgRNA template (PCR method)

The forward primer sequences are shown in Table 2 below:

TABLE 3 Forward primer sequences

Note: the underlined sequence indicates the T7 promoter.

Reverse primer R-Common: AAAAAAAGCACCGACTCGGTGCCAC, SEQ No. 20.

PCR reaction (80. mu.L): 2 XMastermix (Novozan) 40. mu.L, 35. mu.L of ultrapure water, 2. mu.L of forward (zbtb38-sgRNA (1 to 8) -F and R-Common, respectively) primer (5. mu.M) and 1. mu.L of pYSY-sgRNA plasmid (Nanjing Yashunity Bio, 10 ng/. mu.L).

And (3) PCR reaction conditions: 95 ℃ for 3min, 35 × (95 ℃ for 30s,56 ℃ for 30s,72 ℃ for 30s), 72 ℃ for 10min, and 4 ℃ for storage.

2. Purification of sgRNA in vitro transcription template

The PCR product was recovered using a PCR clean up (Axygen) kit without nuclease contamination. The recovery solvent was ultrapure water without nuclease contamination, and the recovery volume was 14. mu.L each. mu.L of each sample was subjected to agarose gel electrophoresis (1%) and the recovery quality was checked. The electrophoresis result of the purified sgRNA in vitro transcription template is shown in fig. 2. Lane 9 from left to right is DNA Marker: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp and 5000bp are sequentially arranged from bottom to top; lanes 1-8 are in vitro transcription templates of the sgRNAs purified from zbtb 38-sgRNAs 1-8.

3. In vitro transcription of sgRNA

1) In vitro transcription process

The obtained purified sgRNA in vitro transcription template is subjected to in vitro transcription with T7 RNA polymerase. Using an RNA in vitro Transcription kit (MAXiScript SP6/T7, Ambion, USA), 10 × Transcription Buffer 2 μ L, 10mM ATP 1 μ L, 10mM CTP 1 μ L, 10mM GTP 1 μ L, 10mM UTP 1 μ L, T7 RNA polymerase mix 2 μ L, and template DNA 12 μ L were added in this order according to the kit instructions, gently mixed, centrifuged, and then subjected to 37 ℃ water bath for 1 h.

Add 1. mu.L of DNase I (Ambion, USA) and wash in water at 37 ℃ for 15min to remove the template. Then 80. mu.L DEPC water was added to expand the volume to 100. mu.L, while 10. mu.L nuclease-free 3M sodium acetate (pH 5.2) and 3 times the volume of absolute ethanol (domestic analytical grade) were added, and the mixture was precipitated overnight at-80 ℃. Centrifuging at 4 deg.C for 20min at 12,000g, removing supernatant, adding 75% ethanol without nuclease, centrifuging at 4 deg.C for 20min at 12,000g, removing supernatant, air drying precipitate in fume hood, resuspending with 12 μ L of ultrapure water without nuclease, and storing in refrigerator at-80 deg.C.

2) Electrophoretic identification of sgRNA quality

mu.L of each sample was subjected to agarose gel electrophoresis (1%) to determine the integrity, and the results were as follows: the quality electrophoresis identification result of sgRNA prepared by in vitro synthesis is shown in figure 3. Lane 9 from left to right in the figure is a DNA Marker: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp and 5000bp are sequentially arranged from bottom to top; lanes 1 to 8 are zbtb38-sgRNA1 to 8 in this order.

Table 4 sgRNA concentration measurement results

(Nano Drop)sgRNA	Concentration (ng/. mu.L)	OD(260/280)
			zbtb38-sgRNAI	810	1.92
zbtb38-sgRNA2	843	1.81
			zbtb38-sgRNA3	875	1.81
zbtb38-sgRNA4	902	1.89
			zbtb38-sgRNA5	813	1.85
zbtb38-sgRNA6	784	1.95
			zbtb38-sgRNA7	896	1.95
zbtb38-sgRNA8	841	1.98

TABLE 5 sgRNA sequences

Example 3: microinjection of zebra fish fertilized eggs

1. Collecting fertilized eggs of zebra fish by a conventional method. The sgRNA is divided into odd groups (1, 3, 5 and 7) and even groups (2, 4, 6 and 8) (the final concentration is about 100 ng/mu L), and respectively mixed with a plasmid (the final concentration is about 50 ng/mu L) containing a channel catfish zbtb38 target gene fragment and Cas9 protein (the final concentration is 200 ng/mu L), and then injected into zebrafish fertilized eggs in a micro-injection amount of 1nL per embryo.

2. Extracting zebra fish embryo DNA: when the zebra fish embryos are injected to 24hpf, 16 embryos in odd and even groups are respectively taken to prepare genome DNA templates (32 embryo samples in total), and the genome DNA templates are prepared by using a zebra fish genotype identification kit, wherein the specific reaction conditions are as follows: 30min at 65 deg.C, 5min at 95 deg.C, 1min at 16 deg.C, and 4 deg.C.

3. PCR amplification reaction System (30. mu.L)

And (3) PCR system: 2 XMASTERMIx (Vazyme) 15. mu.L, 11. mu.L of ultrapure water, 1. mu.L of forward and reverse (zbtb38-F1 and zbtb38-R1) primers (5. mu.M), and 2. mu.L of genomic DNA template prepared from 3.4.1.

The PCR reaction conditions are as follows: 95 deg.C for 3min, 30 × (95 deg.C for 30s,60 deg.C for 30s,72 deg.C for 30s), 72 deg.C for 10min, and 4 deg.C.

4. Electrophoresis results of PCR products

mu.L of each was subjected to agarose gel electrophoresis (1%) to verify the integrity. An electrophoresis result image of the PCR amplification product identified by the gene knockout efficiency of channel catfish zbtb38 is shown in figure 4. Lane 9 is DNA Marker: from bottom to top, the gene sequence is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp and 5000 bp. The first action is the electrophoresis result of the PCR amplification product of the sgRNA activity identification of the channel catfish zbtb38 gene even group; electrophoresis results of PCR amplification products of odd group sgRNA activity identification of channel catfish zbtb38 gene of the second behavior.

After the size of the PCR product is confirmed by electrophoresis, positive amplification products (8 selected) are sent to a commercial company for sequencing, and sequencing primers zbtb38-R1 have the following sequencing results:

even (2, 4, 6, 8) sgRNA groups: feeding back 8 sequencing results, wherein no obvious Indel mutation occurs, and a typical peak diagram is shown as CRISPR2 in a frame of FIG. 5); sgRNA odd groups (1, 3, 5, 7) group: 8 zbtb38-R1 sequencing results are fed back, 4 sequencing results in obvious Indel mutation nearby CRISPR7, and typical peaks are shown in FIG. 6.

After all sequencing results corresponding to sgRNA7, for which the editing activity was verified, were compared with the wild-type sequence (https:// tide. desktop. com /), the relative activity values were obtained, and the final activity rate was 3.562% by averaging. By combining the experimental results, the sgRNA7 synthesized by in vitro transcription by taking the zebra fish embryo as a reactor can effectively edit the channel catfish zbtb38 gene, and the activity is 3.562%. Concentrations suggested for use of the genome editing tool are: the working concentration of sgRNA (final concentration in the injection) was 100 ng/. mu. L, Cas9 protein at a final concentration of 250 ng/. mu.L.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Sequence listing

<110> research institute for fresh water and aquatic products in Jiangsu province

<120> sgRNA sequence for targeted knockout of channel catfish zbtb38 gene and screening method thereof

<141> 2020-10-16

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 1

caatggtaac atcacagaac agg 23

<210> 2

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 2

tttgatgtcc tccacaacaa tgg 23

<210> 3

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 3

ccaagacatt tctgtgagca cgg 23

<210> 4

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 4

cagaggctgt gaaagcgttg cgg 23

<210> 5

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 5

ttgtggttcc agccaggtgc tgg 23

<210> 6

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 6

aacacctctg acttgagatc tgg 23

<210> 7

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 7

gtaaatgaaa ttaaggatgc tgg 23

<210> 8

<211> 23

<212> DNA/RNA

<213> Artificial Sequence

<400> 8

acttgctaaa tccactttgg agg 23

<210> 9

<211> 393

<212> DNA/RNA

<213> Artificial Sequence

<400> 9

atgatggtgg tccattccag ctgcaatggg atgatggaca acttgcaccc ccacactgtt 60

ctttctcgac tcagcgaaca acgatcactt ggcctgttct gtgatgttac cattgttgtg 120

gaggacatca aattccgtgc tcacagaaat gtcttggctg cgactagcgg atatttccgc 180

aacgctttca cagcctctga gacttgtggt tccagccagg tgctggaaat tccagatctc 240

aagtcagagg tgtttgccag catccttaat ttcatttact cctccaaagt ggatttagca 300

agtaaagggg acaacaagtc cttaatagct gcagggaaaa ggttagggat cccctttctt 360

gagaaacttc ttgagattga aaggcaagac tct 393

<210> 10

<211> 20

<212> DNA/RNA

<213> Artificial Sequence

<400> 10

caatgggatg atggacaact 20

<210> 11

<211> 20

<212> DNA/RNA

<213> Artificial Sequence

<400> 11

agtcttgcct ttcaatctca 20

<210> 12

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 12

taatacgact cactataggc aatggtaaca tcacagaacg ttttagagct agaaatagc 59

<210> 13

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 13

taatacgact cactataggt ttgatgtcct ccacaacaag ttttagagct agaaatagc 59

<210> 14

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 14

taatacgact cactataggc caagacattt ctgtgagcag ttttagagct agaaatagc 59

<210> 15

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 15

taatacgact cactataggc agaggctgtg aaagcgttgg ttttagagct agaaatagc 59

<210> 16

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 16

taatacgact cactataggc agaggctgtg aaagcgttgg ttttagagct agaaatagc 59

<210> 17

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 17

taatacgact cactatagga acacctctga cttgagatcg ttttagagct agaaatagc 59

<210> 18

<211> 57

<212> DNA/RNA

<213> Artificial Sequence

<400> 18

taatacgact cactatagta aatgaaatta aggatgcgtt ttagagctag aaatagc 57

<210> 19

<211> 59

<212> DNA/RNA

<213> Artificial Sequence

<400> 19

taatacgact cactatagga cttgctaaat ccactttggg ttttagagct agaaatagc 59

<210> 20

<211> 25

<212> DNA/RNA

<213> Artificial Sequence

<400> 20

aaaaaaagca ccgactcggt gccac 25

<210> 21

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 21

gcaaugguaa caucacagaa cguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 22

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 22

guuugauguc cuccacaaca aguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 23

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 23

gccaagacau uucugugagc aguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 24

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 24

gcagaggcug ugaaagcguu gguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 25

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 25

guugugguuc cagccaggug cguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 26

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 26

gaacaccucu gacuugagau cguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

<210> 27

<211> 102

<212> DNA/RNA

<213> Artificial Sequence

<400> 27

uaaaugaaau uaaggaugcg uuuuagagcu agaaauagca aguuaaaaua aggcuagucc 60

guuaucaacu ugaaaaagug gcaccgaguc ggugcuuuuu uu 102

<210> 28

<211> 104

<212> DNA/RNA

<213> Artificial Sequence

<400> 28

gacuugcuaa auccacuuug gguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugcuuu uuuu 104

Claims

1. A screening method of sgRNA sequences for targeted knockout of channel catfish zbtb38 genes is characterized in that: comprises the steps of (a) preparing a mixture of a plurality of raw materials,

designing a CRISPR sequence which is shown as a sequence SEQ NO. 1-SEQ NO. 8;

preparing a PCR amplification product containing a target gene fragment by using the CRISPR sequence, wherein the target gene fragment is shown as a sequence SEQ NO. 9;

connecting the PCR amplification product containing the target gene fragment with a vector, transforming, screening positive transformants, cloning and shaking bacteria, and extracting a plasmid containing a target gene;

preparing sgRNA by an in vitro transcription method according to the designed CRISPR sequence;

and (3) microinjecting the sgRNA, the plasmid containing the target gene and the Cas9 protein into a fertilized egg of the zebra fish, and screening and editing the sgRNA sequence of the channel catfish zbtb38 gene by using the fertilized egg of the zebra fish as a reactor.

2. The method for screening sgRNA sequences for targeted knockout of ictalurus punctatus zbtb38 gene according to claim 1, wherein the method comprises: the CRISPR sequence is located 393bp before the exon of the zbtb38 gene.

3. The method for screening sgRNA sequences for targeted knockout of the channel catfish zbtb38 gene according to claim 1 or 2, wherein the method comprises: the sequence of the sgRNA comprises one or more of the sequences shown in SEQ NO. 21-SEQ NO. 28.

4. The method for screening sgRNA sequences for targeted knockout of ictalurus punctatus zbtb38 gene according to claim 1, wherein the method comprises: the sgRNA is prepared by an in vitro transcription method, and the used forward primer sequence comprises one or more of sequences SEQ NO. 12-SEQ NO. 19.

5. The method for screening sgRNA sequences for targeted knockout of the channel catfish zbtb38 gene according to any one of claims 1 to 2 and 4, wherein the method comprises the steps of: the plasmid containing the target gene is extracted by cloning and shaking the bacteria, and the used primer sequence comprises one or more than one of the sequences shown in SEQ NO.10 and SEQ NO. 11.

6. The method for screening sgRNA sequences for targeted knockout of ictalurus punctatus zbtb38 gene according to claim 5, wherein the method comprises: the plasmid containing the target gene is extracted by cloning and shaking the bacteria, and the used vector is pGEM-T Easy vector.

7. The method for screening sgRNA sequences for targeted knockout of ictalurus punctatus zbtb38 gene according to claim 1, wherein the method comprises: the microinjection is performed, wherein the final concentration of the sgRNA in the injection solution is 100 ng/mu L, and the final concentration of the Cas9 protein is 250 ng/mu L.

8. A sequence for targeted knockout of the channel catfish zbtb38 gene, characterized in that: comprises the steps of (a) preparing a mixture of a plurality of raw materials,

the CRISPR sequence is shown as a sequence SEQ NO. 7;

the primer comprises one or more than one of the sequences shown in SEQ NO. 10-SEQ NO. 20; and the number of the first and second groups,

the sgRNA sequence comprises one or more sequences shown in SEQ NO. 21-SEQ NO. 28.