CN112831498A - Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN - Google Patents
Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN Download PDFInfo
- Publication number
- CN112831498A CN112831498A CN202110165135.3A CN202110165135A CN112831498A CN 112831498 A CN112831498 A CN 112831498A CN 202110165135 A CN202110165135 A CN 202110165135A CN 112831498 A CN112831498 A CN 112831498A
- Authority
- CN
- China
- Prior art keywords
- ssodn
- sequence
- site
- oyster
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for site-directed mutagenesis or insertion of an oyster genome mediated by ssODN, which comprises the following steps: synthesizing exogenous donor template-single-stranded oligonucleotide; in vitro transcription synthesis of a CRISPR/Cas9 system comprising Cas9 mRNA and a target gene sgRNA; then, the ssODN, Cas9 mRNA, target gene sgRNA and non-homologous repair inhibitor KU5778 were mixed to obtain a mixture, and the mixture was introduced into fertilized eggs of oysters by microinjection. The invention utilizes the ssODN-mediated CRISPR/Cas9 gene editing technology, takes oysters as research objects to design ssODN sequences in a targeted manner, determines the length of the sequences, and finally successfully realizes the site-specific mutagenesis or insertion of the oyster genome through microinjection. The invention provides powerful technical support for developing oyster gene function research and genetic improvement in the future.
Description
Technical Field
The invention belongs to the technical field of marine organism gene editing, and particularly relates to a method for site-specific mutagenesis and insertion of an oyster genome mediated by ssODN.
Background
The CRISPR/Cas9 gene editing technology has the advantages of simple operation, wide target selection, low cost, high efficiency and the like, and is paid attention by the majority of researchers and is rapidly developed since birth. At present, the method has become one of the most spotlighted and promising technologies in the research fields of life science, medicine and the like. The Nobel prize awarding CRISPR/Cas9 gene editing technology in 2020 proves the great influence of the technology once again. At the basic research level, the CRISPR/Cas9 technology greatly facilitates the gene function research of model species, especially non-model species. At present, researchers have successfully realized gene editing in various animals and plants such as pigs, sheep, monkeys, sorghum, oysters, palaemon carinicauda and the like by utilizing the CRISPR/Cas9 technology.
The CRISPR/Cas9 system consists of sgrnas and Cas9 protein (or Cas9 mRNA), and sgrnas recognize specific genomic sequences through base complementary pairing, and guide the generation of genomic double strand breaks at the binding target of Cas9 protein, accompanied by the repair of cellular DNA damage. In general, there are two ways eukaryotic DNA repair, homologous recombination repair (HDR) and non-homologous end joining (NHEJ). Under the condition that no template exists, the cell can be repaired in an NHEJ mode, and gene inactivation is caused by random insertion or deletion mutation, so that gene knockout is realized; when a DNA template which is homologous with the damaged DNA exists, the cell can introduce a target modifying gene at a breaking position through an HDR mode, and the site-specific knock-in or site-specific mutation of the gene is realized. The NHEJ mechanism does not rely on exogenous templates, and HDR repair is far less efficient than NHEJ repair in most animal cells, which limits the application of HDR repair. Therefore, precise site-directed gene modification remains a great problem.
Oysters are a worldwide distributed group, one of the shellfish which is currently the most studied and most concerned. Because the fertilized eggs of oysters are limited, the gene editing conditions are much worse than those of the conventional successful research objects, the CRISPR/Cas9 gene editing technology of the oysters has important breakthrough at present, the target gene can be knocked out by utilizing the CRISPR/Cas9 technology, and an important technical basis is provided for the gene function research of the oysters.
However, at present, precise modification of oyster gene editing has not been effectively advanced. The establishment of the oyster gene precise modification technology has very important significance for the gene function research and the molecular breeding.
Disclosure of Invention
The invention aims to provide a method for accurately modifying genes of oysters, which realizes the site-specific mutagenesis or insertion of the genomes of the oysters by using a single-stranded oligonucleotide (ssODN) mediated combination CRISPR/Cas9 gene editing technology.
The specific technical scheme of the invention is as follows:
a method of ssODN-mediated site-directed mutagenesis or insertion of an oyster genome, comprising: synthesizing exogenous donor template-single stranded oligonucleotides (ssodns); in vitro transcription synthesis of a CRISPR/Cas9 system comprising Cas9 mRNA and a target gene sgRNA; then, the ssODN, Cas9 mRNA, target gene sgRNA and non-homologous repair inhibitor KU5778 were mixed to obtain a mixture, and the mixture was introduced into fertilized eggs of oysters by microinjection.
Further, the length of the single-stranded oligonucleotide (ssODN) is more than or equal to 120 bp.
Furthermore, the sequence of the ssODN is designed by a sgRNA target sequence in a genome and left and right flanking sequences thereof, the sgRNA target sequence is positioned in the middle position, the left and right flanking sequences are not less than 40bp, and the sequences can be reverse complementary or forward sequences.
Further, in the ssODN sequence, base mutation design or insertion sequence design is performed at the sgRNA target sequence.
Furthermore, in the ssODN sequence, a base mutation design is performed on a corresponding PAM sequence region.
Further, Cas9 mRNA and the target gene sgRNA were synthesized by in vitro transcription, mixed with exogenous donor template ssODN and non-homologous repair inhibitor KU5778, wherein the final concentration of Cas9 mRNA and target gene sgRNA was 500ng/μ L, the final concentration of ssODN was 2 μ M, and the final concentration of non-homologous repair inhibitor KU5778 was 10 μ M.
Further, the mixture is injected into fertilized eggs of oyster by microinjection, and the volume of the mixture injected into each fertilized egg is 0.08-0.12nL, preferably 0.1 nL.
In addition, after the injected fertilized eggs of the oysters are hatched to D-shaped larvae, site-directed mutant or inserted mutant can be obtained, and the method can be used for verifying the effectiveness of the method.
The invention has the advantages and beneficial effects that:
the invention utilizes the ssODN-mediated CRISPR/Cas9 gene editing technology, takes oysters as research objects to design ssODN sequences in a targeted manner, determines the length of the sequences, and finally successfully realizes the site-specific mutagenesis or insertion of the oyster genome through microinjection. The invention provides powerful technical support for developing oyster gene function research and genetic improvement in the future.
Drawings
FIG. 1 shows the SgRNA target sequence of the fourth exon of the Paramyosin gene and the ssODN sequence mediating point mutation in example 1.
FIG. 2 shows the SgRNA target sequence of the fourth exon of the Paramyosin gene and the ssODN sequence mediating site-directed insertion in example 1.
FIG. 3 is a graph showing the results of point mutation, site-specific insertion and wild-type sequencing of crassostrea gigas in example 2.
Detailed Description
The invention will be further explained and illustrated by means of specific embodiments and with reference to the drawings.
The technical solutions of the present invention, if not specifically mentioned, are conventional in the art, and the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
this example illustrates the oyster Paramyyosin gene, which is subjected to site-directed mutagenesis and/or insertion, as described in further detail below.
A ssODN-mediated method for site-directed mutagenesis or insertion of the crassostrea gigas Paramyosin genome, comprising the steps of:
1) obtaining fertilized eggs of crassostrea gigas
Selecting parent oysters of crassostrea gigas with mature gonads, collecting sperms and ova by adopting an anatomical method, carrying out artificial insemination, and using the obtained fertilized ova for gene editing fixed-point modification.
2) sgRNA for constructing crassostrea gigas target gene Paramyosin
Aiming at the fourth exon of the crassostrea gigas target Gene Paramyosin (Gene ID: LOC105329634), the sgRNA target point is designed on lineGGAGGACGCCCTCAATGATC TGG (GG is T7 transcriptional gene)Plus), wherein the PAM sequence is TGG.
Synthesizing sgRNA through in vitro transcription, which comprises the following specific steps: designing a forward primer Sg-Para-F, wherein the primer sequence is 5'-GATCACTAATACGACTCACTATAGGAGGACGCCCTCAATGATCGTTTTAGAGCTAGAAAT-3' (containing a T7 promoter sequence), taking a DR274 plasmid (Addgene plasmid 42250) as a template, and carrying out PCR amplification by using the forward primer Sg-Para-F and a universal primer Sg-R (5'-AAAAGCACCGACTCGGTGCC-3'). The PCR reaction conditions are as follows: 30 seconds at 98 ℃; 35 cycles comprising 98 ℃ for 5 seconds, 60 ℃ for 10 seconds, 72 ℃ for 5 seconds; 5 minutes at 72 ℃. PCR amplification was performed using high fidelity enzyme (Thermo, F530S), and the PCR product was purified by conventional methods. The sgRNA was transcribed using a T7 in vitro transcription kit (Thermo, AM1354) using the purified PCR product as a template, and purified using a conventional phenol chloroform method.
3) Site-directed mutagenesis donor template ssODN sequence design
And designing a ssODN sequence by taking the fourth exon of the target gene Paramyosin as a target sequence and taking the left flank sequence length of 45bp and the right flank sequence length of 54bp at the position of the sgRNA target sequence. The PAM sequence TGG was changed to TAG, and two point mutations were designed for the sgRNA target sequence (see FIG. 1).
The length of the whole ssODN is 120bp, which is the reverse complementary sequence of the genome DNA sequence, and the specific sequence of the ssODN120 is: 5'-TAGCAGGCGACACTTACCGTCCCTTGGATTTTGTCATGTACTCGAGTTGGTCAGCTAGATCATTGAGAGCATCCTGGTGACGTTTGCGCATGCTGGCCTCTGTTGACTCGTAAGATGCAT-3' are provided.
4) Site-directed insertion donor template ssODN sequence design
And designing a 6bp enzyme cutting site sequence AAGCTT to be inserted at the first four basic groups of the PAM sequence by taking the fourth exon of the target gene Paramyosin as a target sequence, wherein the lengths of the left flanking sequence and the right flanking sequence of the insertion site are respectively 60 bp. The PAM sequence TGG was changed to TAG (see fig. 2).
The length of the whole ssODN is 126bp, which is the forward sequence of the genomic DNA sequence, and the specific sequence of the ssODN126 is: 5'-AATGCATCTTACGAGTCAACAGAGGCCAGCATGCGCAAACGTCACCAGGACGCCCTCAATAAGCTTGATCTAGCTGACCAACTCGAGTACATGACAAAATCCAAGGGACGGTAAGTGTCGCCTGCT-3' are provided.
The ssODN synthesis was performed by DNA synthesis.
5) Synthesis of Cas9 mRNA
The pT3TS-nCas9n plasmid was digested with the endonuclease XbaI (NEB), and purified using the MinElute PCR Purification Kit (Qiagen); carrying out in vitro transcription by using the linearized plasmid as a template and using T3 RNA Polymerase Kit (Ambion) to generate a capped Cas9 mRNA; cas9 mRNA was purified using the phenol chloroform method.
6) Fertilized egg of crassostrea gigas by microinjection
Cas9 mRNA, sgRNA, ssODN and a non-homologous repair inhibitor KU5778 are mixed to obtain an injection mixture, and the final concentrations are 500 ng/mu L, 2 mu M and 10 mu M respectively; the ssODN is the site-directed mutagenesis sequence designed in the step 3) and the site-directed insertion sequence designed in the step 4).
Namely, the fertilized egg experimental group comprises a site-directed mutation sequence group and a site-directed insertion sequence group, and a contrast wild group is provided, and 100 fertilized eggs are injected into each group.
Placing the fertilized eggs of the crassostrea gigas prepared in the step 1) in the center of a disposable plastic culture dish with the diameter of 60mm, dripping 1-2 drops of seawater, and adjusting the fertilized eggs to the visual field by using an inverted microscope. And adjusting the pressure of the suction needle to be negative pressure by using a pneumatic manual microinjection instrument, sucking and fixing a fertilized egg, and injecting the injection mixture of which the volume is equal to or more than 0.1nL into the fertilized egg of the crassostrea gigas by using a quantitative microinjection system. After injection, the injected eggs are discharged by adjusting the internal pressure of the holding needle to be positive pressure, the position of the holding needle is changed, and other fertilized eggs are held by the internal pressure of the holding needle, so that the injection is carried out one by one. The ssODN sequence was not included in the control injection mixture.
Culturing the injected embryo in sterile seawater at 23-24 deg.C.
Comparative example:
in this comparative experiment, the sequence design of the site-directed mutated donor template ssODN in step 3) was different from that in example 1, and the other steps were the same as in example.
(1) And designing an ssODN sequence by taking the fourth exon of the target gene Paramyosin as a target sequence and taking the left flank sequence length of 19bp and the right flank sequence length of 20bp at the position of the sgRNA target sequence. The PAM sequence TGG is changed into TAG, and two point mutations (same as the 120bp design position) are designed on the sgRNA target sequence.
The ssODN60 has a specific sequence:
5'-CATGTACTCGAGTTGGTCAGCTAGATCATTGAGAGCATCCTGGTGACGTTTGCGCATGCT-3', the ssODN length is: 60 bp.
(2) And designing a 6bp enzyme cutting site sequence AAGCTT to be inserted at the first four basic groups of the PAM sequence by taking the fourth exon of the target gene Paramyosin as a target sequence, wherein the lengths of the left flanking sequence and the right flanking sequence of the insertion site are respectively 30 bp. The PAM sequence TGG was changed to TAG.
The ssODN66 has a specific sequence:
5'-ATGCGCAAACGTCACCAGGACGCCCTCAATAAGCTTGATCTAGCTGACCAACTCGAGTACATGACA-3', the ssODN length is: 66 bp.
In both comparative experiments, no site-directed mutation or site-directed insertion was detected. And (3) carrying out enzyme digestion on the PCR product of the point mutation experiment by using FOKI endonuclease, and carrying out enzyme digestion on the PCR product of the insertion experiment by using HindIII endonuclease. No expected restriction fragment appeared, the PCR product was further subjected to routine TA cloning, and 20 single clones were randomly picked, purified and sequenced, and no site-directed mutation or site-directed insertion was detected.
Example 2
The detection of the point mutation or insertion of the target gene in example 1 was verified
And (3) collecting oyster D-shaped larvae 24 hours after microinjection of fertilized eggs of oysters with site-directed mutagenesis sequences and site-directed insertion sequences and comparison of wild ostrea gigas, and extracting the genomic DNA of the oyster larvae by using a conventional method. Designing a primer to perform PCR amplification on the genome segment containing the target site, wherein the PCR reaction conditions are as follows: 3 minutes at 94 ℃; 45 cycles comprising 94 ℃ for 30 seconds, 60 ℃ for 30 seconds, 72 ℃ for 30 seconds; 5 minutes at 72 ℃. And (3) carrying out enzyme digestion on the PCR product of the point mutation experiment by using FOKI endonuclease, and carrying out enzyme digestion on the PCR product of the insertion experiment by using HindIII endonuclease. And selecting PCR products with successful enzyme digestion for routine TA cloning, randomly selecting 15 monoclonals, and sending the monoclonals to a sequencing company for purification and sequencing.
And (5) result verification:
the target site is subjected to point mutation or insertion, and as shown in FIG. 3, the expected homologous recombination repair result is detected to obtain point mutation or insertion of foreign sequence, and as can be seen from FIG. 3, the point mutation experimental group is sequenced to be identical with the mutant sequence in step 3) designed in example 1 by ` T `, ` A `, and the point insertion group is identical with the point insertion sequence in step 4) designed in example 1 by ` AAGCTT `.
The above results show that the method for performing site-directed mutagenesis or insertion on oyster genome mediated by ssODN provided by the present invention can generate site-directed modification-site mutagenesis or insertion, i.e., the method provided by the present invention can realize site-directed target gene modification.
Sequence listing
<110> China oceanic university
<120> a method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggaggacgcc ctcaatgatc tgg 23
<210> 2
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gatcactaat acgactcact ataggaggac gccctcaatg atcgttttag agctagaa 58
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aaaagcaccg actcggtgcc 20
<210> 4
<211> 120
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tagcaggcga cacttaccgt cccttggatt ttgtcatgta ctcgagttgg tcagctagat 60
cattgagagc atcctggtga cgtttgcgca tgctggcctc tgttgactcg taagatgcat 120
<210> 5
<211> 126
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aatgcatctt acgagtcaac agaggccagc atgcgcaaac gtcaccagga cgccctcaat 60
aagcttgatc tagctgacca actcgagtac atgacaaaat ccaagggacg gtaagtgtcg 120
cctgct 126
<210> 6
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
catgtactcg agttggtcag ctagatcatt gagagcatcc tggtgacgtt tgcgcatgct 60
<210> 7
<211> 66
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atgcgcaaac gtcaccagga cgccctcaat aagcttgatc tagctgacca actcgagtac 60
atgaca 66
Claims (9)
1. A method of ssODN-mediated site-directed mutagenesis or insertion of the oyster genome, comprising: synthesizing an exogenous donor template-single-stranded oligonucleotide ssODN; in vitro transcription synthesis of a CRISPR/Cas9 system comprising Cas9 mRNA and a target gene sgRNA; and then mixing the ssODN, the Cas9 mRNA, the target gene sgRNA and the non-homologous repair inhibitor KU5778 to obtain a mixture, and introducing the mixture into the fertilized eggs of the oysters by using a microinjection method.
2. The method of claim 1, wherein the single stranded oligonucleotide ssODN is 120bp or more in length.
3. The method of claim 1, wherein the ssODN sequence is designed as a sgRNA target sequence in the genome and its left and right flanking sequences, the sgRNA target sequence being located at a central position, and the left and right flanking sequences being greater than or equal to 40 bp.
4. The method of claim 1, wherein in the ssODN sequence, base site-directed mutation design or site-directed insertion base sequence design is performed at a sgRNA target sequence.
5. The method of claim 1, wherein in the ssODN sequence, corresponding regions of the PAM sequence are base mutated.
6. The method of claim 1, wherein the Cas9 mRNA and the target gene sgRNA are present at a final concentration of 500ng/μ L, the ssODN is present at a final concentration of 2 μ M, and the non-homologous repair inhibitor KU5778 is present at a final concentration of 10 μ M.
7. The method according to claim 1, wherein the mixture is injected into fertilized eggs of oyster by microinjection, and the volume of the mixture injected into each fertilized egg is 0.08 to 0.12 nL.
8. The method according to claim 7, wherein the mixture is injected into oyster zygotes by microinjection, and the volume of the mixture injected into each zygote is 0.1 nL.
9. The method according to claim 1, further comprising a verification step of obtaining site-directed mutagenesis or a mutant with an inserted base sequence by hatching fertilized oyster eggs after injection to D-larvae and then performing gene sequence detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110165135.3A CN112831498A (en) | 2021-02-06 | 2021-02-06 | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110165135.3A CN112831498A (en) | 2021-02-06 | 2021-02-06 | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112831498A true CN112831498A (en) | 2021-05-25 |
Family
ID=75932527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110165135.3A Pending CN112831498A (en) | 2021-02-06 | 2021-02-06 | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112831498A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703174A (en) * | 2022-04-12 | 2022-07-05 | 中国科学院海洋研究所 | CRISPR/Cas9 gene knockout method for rapidly obtaining genotype and phenotype mutation and application |
| CN114703231A (en) * | 2022-04-12 | 2022-07-05 | 中国科学院海洋研究所 | Electroporation gene editing method and application of crassostrea gigas beta-tubulin gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385451A (en) * | 2018-11-07 | 2019-02-26 | 中国海洋大学 | One seed oyster CRISPR/Cas9 gene editing method |
-
2021
- 2021-02-06 CN CN202110165135.3A patent/CN112831498A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385451A (en) * | 2018-11-07 | 2019-02-26 | 中国海洋大学 | One seed oyster CRISPR/Cas9 gene editing method |
Non-Patent Citations (2)
| Title |
|---|
| 刘保池: "《细胞治疗临床研究》", 30 November 2019, 复旦大学出版社 * |
| 李国玲等: "提高CRISPR/Cas9 介导的动物基因组精确插入效率研究进展", 《遗传》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114703174A (en) * | 2022-04-12 | 2022-07-05 | 中国科学院海洋研究所 | CRISPR/Cas9 gene knockout method for rapidly obtaining genotype and phenotype mutation and application |
| CN114703231A (en) * | 2022-04-12 | 2022-07-05 | 中国科学院海洋研究所 | Electroporation gene editing method and application of crassostrea gigas beta-tubulin gene |
| CN114703174B (en) * | 2022-04-12 | 2023-10-24 | 中国科学院海洋研究所 | CRISPR/Cas9 gene knockout method for rapidly obtaining genotype and phenotype mutation and application thereof |
| CN114703231B (en) * | 2022-04-12 | 2023-10-24 | 中国科学院海洋研究所 | Electroporation gene editing method and application of crassostrea gigas beta-tubulin gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230189769A1 (en) | Process for using crispr to transfect primordial germ cells in avians | |
| CN108441520B (en) | Gene conditional knockout method constructed by using CRISPR/Cas9 system | |
| JP6354100B2 (en) | Method for introducing Cas9 mRNA into a fertilized egg of a mammal by electroporation | |
| Wang et al. | Delivery of Cas9 protein into mouse zygotes through a series of electroporation dramatically increases the efficiency of model creation | |
| Sakurai et al. | A single blastocyst assay optimized for detecting CRISPR/Cas9 system-induced indel mutations in mice | |
| CN110551759B (en) | Composition and method for improving recombination efficiency of transgenic cells | |
| JP6958917B2 (en) | How to make gene knock-in cells | |
| CN111778252B (en) | SgRNA for targeted knockout of SST gene, CRISPR/Cas9 system and application thereof | |
| CN112831498A (en) | Method for site-directed mutagenesis or insertion of oyster genome mediated by ssODN | |
| CN110643636B (en) | Megalobrama amblycephala MSTNa & b gene knockout method and application | |
| Yuan et al. | A transgenic core facility’s experience in genome editing revolution | |
| WO2022148078A1 (en) | Method for gene editing fertilized animal egg by means of electrotransfection and use thereof | |
| CN110684769B (en) | Ostrea gigas EF-1 alpha promoter, recombinant vector and application thereof | |
| CN113897399A (en) | Scn1lab gene knockout zebra fish epilepsy model and application thereof | |
| CN113234756A (en) | Construction method of LAMA3 gene knockout animal model based on CRISPR/Cas9 technology | |
| CN114480497B (en) | Construction and application method of ep400 gene knockout zebra fish heart failure model | |
| CN115261360A (en) | Method for constructing gata6 gene knockout zebra fish model | |
| CN111549070B (en) | Method for editing X chromosome multicopy gene to realize animal sex control | |
| CN113897362A (en) | Scn1lab gene knockout zebra fish epilepsy model and construction method and application thereof | |
| WO2021186163A1 (en) | Optimised methods for cleavage of target sequences | |
| CN111793653B (en) | Construction method of dpy19l1l gene deletion type zebra fish | |
| CN110643605B (en) | gRNA of megalobrama amblycephala MSTNa & b gene knockout and template thereof | |
| CN115044620B (en) | Construction method and application of microsatellite repetitive sequence knockout mutant | |
| CN114891791B (en) | sgRNA of specific targeting canine Rosa26 gene and application thereof | |
| CN114231561A (en) | Method for knocking down animal mRNA based on CRISPR-Cas13d and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |