WO2022148078A1

WO2022148078A1 - Method for gene editing fertilized animal egg by means of electrotransfection and use thereof

Info

Publication number: WO2022148078A1
Application number: PCT/CN2021/122721
Authority: WO
Inventors: 李寅青; 朱明�; 袁俊松; 臧璐
Original assignee: 清华大学
Priority date: 2021-01-05
Filing date: 2021-10-09
Publication date: 2022-07-14
Also published as: CN113881708A

Abstract

Provided are a method for gene editing a fertilized animal egg by means of electrotransfection and the use thereof. The method comprises: (1) selecting a fertilized animal egg before the S period to perform weakening treatment on the zona pellucida; and (2) mixing an exogenous substance with an animal fertilized egg, the zona pellucida of which has been subjected to weakening treatment, and then performing electroporation transfection treatment, wherein the exogenous substance comprises the Cas9 protein and sgRNA.

Description

A method for electrotransfection gene editing of animal fertilized eggs and its application

technical field

The present invention relates to the field of biotechnology, in particular, the present invention relates to a method and application of electrotransfection gene editing for animal fertilized eggs, and more specifically, the present invention relates to a method and construction for electrotransfection gene editing of animal fertilized eggs A method for mutating a fertilized egg cell, a method for constructing a homozygous HDR fertilized egg cell, a method for constructing a lethal gene single deletion fertilized egg cell, a method for constructing a mutant animal, and a method for weakening the zona pellucida of the animal zygote.

Background technique

Genetically engineered mice are of great significance in biological research. According to the 1.8 million experimental procedures reported in the 2018 UK Live Animal Science Procedures Annual Statistics, 60% of the procedures used mice as experimental animals; 1.72 million were created and bred Among the experimental procedures of genetically engineered animals, 87% of the procedures are for breeding genetically engineered mice. According to reports, China's demand for animal models to simulate human diseases has surged, and the market demand for genetically engineered mice is growing rapidly, and the market demand will exceed 1.59 billion US dollars in 2022.

There is a huge demand for genetically engineered mice, but the current mainstream technology for gene editing of mouse embryos is microinjection technology, which has low throughput, low efficiency and high cost. At the same time, the construction of multi-gene knockout mouse models has high cost, long cycle and low success rate, which severely limits the application of mouse models.

Embryonic gene editing technology based on electrotransfection has just appeared in recent years and is still in the research and exploration stage. Therefore, the existing embryonic gene editing technology based on electrotransfection still needs to be improved.

SUMMARY OF THE INVENTION

The present invention aims to solve one of the technical problems in the related art at least to a certain extent. To this end, an object of the present invention is to provide a means capable of effectively electrotransfecting a gene editing system into animal embryos and realizing efficient homologous recombination.

The present invention is accomplished based on the following findings of the inventors:

During the research process, the inventor found that the efficiency of the existing fertilized egg cell gene editing technology is unstable, and it is usually only tested on one or two single genes, and there is no stable realization of high-efficiency single genes at different gene loci. Editing, there is no efficient acquisition of homozygous mutant fertilized egg cells, and multi-gene editing cannot be achieved, which largely limits the application of the corresponding scarce mouse model. After in-depth analysis, the inventors of the present invention unexpectedly found that during electrotransfection of mouse embryos, the time point at which exogenous genes used for gene editing are introduced into mouse embryos is very important for the final electrotransfection efficiency, thus completing the The present invention proposes a method that can efficiently realize electrotransfection of foreign substances into fertilized egg cells, and further can stably achieve high-efficiency gene editing at different gene loci, and efficiently obtain recombinant fertilized egg cells, which is very important. To a large extent, the application of the corresponding scarce mouse model is promoted.

Therefore, the present invention proposes an efficient and stable electrotransfection gene editing system for animal fertilized egg cells (sometimes also referred to as "embryo" in this document). Gene editing knockout efficiency, increase the proportion of heterozygous HDR embryos, increase the proportion of homozygous HDR embryos, and realize multi-gene editing, thereby reducing the breeding cost of genetically engineered mice and laying a good foundation for efficient breeding of genetically engineered mice.

In the first aspect of the present invention, the present invention provides a method for electrotransfection gene editing of animal fertilized eggs. According to an embodiment of the present invention, the method includes: (1) performing a zona weakening treatment on the animal fertilized eggs before the S phase; (2) mixing exogenous substances with the zona pellucida weakened animal fertilized eggs, and performing Electroporation transfection treatment, wherein the foreign substances include Cas9 protein and sgRNA.

According to the embodiments of the present invention, the inventors have unexpectedly discovered through a large number of experiments that when animal fertilized eggs undergo electrotransfection gene editing, the weakening of the zona pellucida of animal fertilized eggs and the cell cycle stage they are in have an impact on the efficiency of electrotransfection gene editing It is very important, wherein, the zona pellucida weakening treatment is performed by contacting the fertilized egg cells of the animal with the benchtop solution for 4 to 10 seconds, and performing electrotransfection in the form of a mixture of Cas9 protein and sgRNA, which can effectively improve the efficiency of gene editing. efficiency.

When using fertilized egg cells from animals before S phase, electrotransfection with a mixture of Cas9 protein and sgRNA can effectively improve the efficiency of gene editing.

The inventors of the present invention found that, for animal embryos, especially mouse embryos, the zona pellucida weakening treatment, specifically, contacting the animal embryos with the benchtop solution, the processing time of this step is very important for the subsequent electrotransfection. The efficiency and the efficiency of obtaining homozygous HDR mutants are crucial. If the contact time is too short, the weakening of the zona pellucida will be insufficient, and if the time is too long, the weakening of the zona pellucida will be too high, which will affect the Embryo survival. In addition, the inventors have also found through a large number of experiments that completing electroporation transfection by 8 pulses (“electroporation transfection” and “electrotransfection” can be used interchangeably herein) can effectively improve the transfection efficiency and maintain The viability of embryos, especially the high-efficiency gene editing of multiple genes. According to the embodiments of the present invention, the electrotransfection efficiency of the animal fertilized eggs processed according to the above steps is obviously improved.

In a second aspect of the present invention, the present invention provides a method for constructing mutant fertilized egg cells. According to an embodiment of the present invention, the method includes: (1) performing a zona weakening treatment on the animal fertilized eggs before the S phase; (2) mixing exogenous substances with the zona pellucida weakened animal fertilized eggs, and performing Electroporation transfection treatment, wherein the exogenous substance includes Cas9 protein and at least one sgRNA, and the weight ratio of the Cas9 protein to the at least one sgRNA is 2-6:1 based on weight.

As mentioned above, according to the embodiments of the present invention, when the fertilized egg cells of animals before S phase are used, and electrotransfection is carried out in the form of a mixture of Cas9 protein and sgRNA, the efficiency of gene editing can be effectively improved, so that the construction can be further improved. Efficiency of mutant fertilized egg cells.

In the third aspect of the present invention, the present invention provides a method for constructing a mutant fertilized egg cell, the mutant fertilized egg cell is a homozygous HDR fertilized egg cell, according to an embodiment of the present invention, the method includes: (1) The fertilized eggs of animals before the S phase are treated with weakened zona pellucida; (2) after mixing the exogenous material with the fertilized eggs of animals with weakened zona pellucida, electroporation is performed to obtain transfected fertilized egg cells, wherein , the exogenous material includes Cas9 protein, at least one sgRNA and at least one ssODN corresponding to the sgRNA, wherein, based on the weight, the weight ratio of the Cas9 protein to the at least one sgRNA is 2 to 6: 1; and (3) selecting the homozygous HDR zygote from the transfected zygote. The proportion of homozygous HDR fertilized eggs can reach 20%.

As mentioned above, according to the embodiments of the present invention, when the fertilized egg cells of animals before S phase are used, and electrotransfection is carried out in the form of a mixture of Cas9 protein and sgRNA, the efficiency of gene editing can be effectively improved, so that the construction can be further improved. Efficiency of mutant fertilized egg cells. It was also unexpectedly found that the proportion of homozygous HDR fertilized egg cells could reach 20%.

In the fourth aspect of the present invention, the present invention provides a method for constructing a mutant fertilized egg cell, wherein the mutant fertilized egg cell is a lethal gene single deletion fertilized egg cell. According to an embodiment of the present invention, the method includes (1) weakening the zona pellucida on the fertilized eggs of animals before the S phase; (2) mixing the exogenous material with the fertilized eggs of animals subjected to the weakening zona pellucida treatment, and then performing Electroporation transfection treatment to obtain transfected fertilized egg cells, wherein the exogenous material comprises Cas9 protein, at least one sgRNA and at least one ssODN corresponding to the sgRNA, wherein, on a weight basis, the Cas9 The weight ratio of protein to the at least one sgRNA is 2-6:1; and (3) selecting the lethal gene single-deletion fertilized egg cells from the transfected fertilized egg cells, wherein the at least one sgRNA and the ssODN was determined based on lethal genes.

As mentioned above, according to the embodiments of the present invention, the efficiency of constructing mutant fertilized egg cells can be improved when the fertilized egg cells of animals before S phase are used, and electrotransfection is performed in the form of a mixture of Cas9 protein and sgRNA. In addition, according to the embodiments of the present invention, it was unexpectedly found that in the obtained transfected fertilized egg cells, the proportion of lethal genes with single deletions was as high as 54%, so that fertilized egg cells with single deletion lethal genes could be effectively obtained, Furthermore, the biological activity of the lethal gene can be studied in the state where the fertilized egg cell is alive.

In the fifth aspect of the present invention, the present invention provides a method for constructing a mutant animal, according to an embodiment of the present invention, the method comprises: (a) constructing a mutant fertilized egg cell according to the aforementioned method; and (b) The mutant fertilized egg cells are grown to obtain the mutant animal.

As mentioned above, on the basis of obtaining homozygous HDR fertilized oocytes or fertilized oocytes with single deletion of lethal gene, animals carrying these gene mutations can be further obtained. Thus, these animals can be used for genetic studies or drug screening.

In the sixth aspect of the present invention, the present invention proposes a method for constructing an animal model. According to an embodiment of the present invention, the method includes: (i) based on a predetermined disease type, determining sgRNAs associated with disease-related genes and optionally ssODN; (ii) using the sgRNA and Cas9 protein to construct an animal model according to the method described above.

Thus, according to the embodiments of the present invention, corresponding mutant animals can be constructed for known disease-related genes, so as to be used as animal models for disease research or drug screening.

In the seventh aspect of the present invention, the present invention proposes the use of the mutant animals or animal models constructed according to the aforementioned methods in screening drugs.

In the eighth aspect of the present invention, the present invention proposes a method for weakening the zona pellucida for animal fertilized eggs. According to an embodiment of the present invention, the method includes: weakening the zona pellucida for the animal fertilized eggs before S phase Treatment, the zona pellucida weakening treatment is carried out by contacting the fertilized egg cells of the animal with the table solution for 4-10 seconds.

The inventors of the present invention found that, for animal embryos, especially mouse embryos, the zona pellucida weakening treatment, specifically, contacting the animal embryos with the benchtop solution, the processing time of this step is very important for the subsequent electrotransfection. The efficiency and the efficiency of obtaining homozygous HDR mutants are crucial. If the contact time is too short, the weakening of the zona pellucida will be insufficient, and if the time is too long, the weakening of the zona pellucida will be too high, which will affect the Embryo survival. In addition, the inventors have also found through a large number of experiments that completing electroporation transfection by 8 pulses (“electroporation transfection” and “electrotransfection” can be used interchangeably herein) can effectively improve the transfection efficiency and maintain the transfection efficiency. The viability of embryos, especially the high-efficiency gene editing of multiple genes. According to the embodiments of the present invention, the electrotransfection efficiency of the animal fertilized eggs processed according to the above steps is obviously improved.

It should be noted that the solutions, features and advantages described in different aspects are mutually applicable unless otherwise specified, and are not repeated here.

Description of drawings

Figure 1 shows the results of next-generation sequencing after gene editing by electrotransfection of the mouse embryo Emx1 gene designed according to an embodiment of the present invention. Where there are sets of peaks, it indicates the existence of different genome sequences, indicating that gene editing has occurred.

Fig. 2 shows the results of first-generation sequencing of homozygous HDR mutants according to an embodiment of the present invention, wherein, in the region shown by the red rectangle, all bases are changed to the same mutation as ssODN, and no spurious peaks appear, and the edited target base Because of Emx1, the guide sequence of sgRNA is GAGTCTGAGCAGAAGAAGAA, and the corresponding ssODN sequence is GAGTCCGAGCAGAAGAAAAA. The total length of ssODN is 130nt, and the rest of the base sequence is the same as that of the mouse genome.

Detailed ways

The embodiments of the present invention will be described in detail below. The embodiments described below with reference to the accompanying drawings are exemplary, and are intended to be used to explain the present invention, but should not be construed as a limitation of the present invention. Among them, the reagents used in this paper are commercially available in the art unless otherwise specified.

Definition of Terms

Unless otherwise specified, the terms used in the present invention have the meanings known in the art, wherein,

The term "fertilized egg" or "fertilized egg cell" as used in the text refers to a zygotic cell that does not divide after the sperm and egg are fertilized and the chromosomes of the egg pronucleus and sperm pronucleus are fused together, in this context due to the collection of fertilization Egg cells are collected in the same way as embryos are collected, so fertilized egg cells at this stage are sometimes called "embryos".

The term "electrotransfection" as used herein, also sometimes referred to as "electroporation", is the transient increase in the permeability of the cell membrane through the action of a high-intensity electric field, thereby absorbing foreign molecules in the surrounding medium. In this paper, exogenous substances are introduced into the fertilized egg cells by this technology. The main exogenous substances include Cas9 protein and sgRNA, and ssODN can also be added according to the situation. Among them, Cas9 protein plays the role of molecular scissors, and sgRNA, also known as small guide RNA (sgRNA), plays a guiding role, which can guide Cas9 protein to the target gene to make it play the function of molecular scissors. Single-stranded oligodeoxyribonucleotide (ssODN) as a template for homologous recombination repair can promote homologous recombination repair to achieve gene sequence replacement. Those skilled in the art can use conventional electrotransfection equipment for electrotransfection treatment.

The term "gene editing" as used herein refers to the modification (including but not limited to insertion, deletion or substitution) of a specific target gene (also referred to as "target gene" or "target") in the genome of an organism, according to the present In the embodiment of the invention, under the guidance of sgRNA (recognition target gene), the nuclease Cas9 as "molecular scissors" is used to generate site-specific double-strand breaks (DSBs) at specific positions in the genome, and further induce the organism to pass non- Homologous end joining (NHEJ) or homologous recombination (HR) (also known as "HDR" (Homology directed repair, homology-mediated double-stranded DNA repair)) to repair DSBs to achieve specific modifications, wherein, in order to Improving the efficiency of homologous recombination-mediated double-stranded DNA repair (HDR) adds additional single-stranded oligodeoxyribonucleotides (ssODN) designed based on target gene sequences as templates for homologous recombination repair.

The term "lethal gene" as used herein refers to a gene that causes cell death when both alleles are mutated or knocked out in diploid cells. According to an embodiment of the present invention, a "lethal gene" that can be used includes, but is not limited to, at least one of Pkd1, FoxG1, Chd2, Virma, c-myc, p38α and dUTPase. It should be noted that during gene editing of cells, if both alleles of the diploid cell-killing gene are knocked out or mutated, it is very likely to cause cell death. Therefore, when performing functional studies, it is necessary to carry out Single knockout, that is, knocking out a lethal gene on one allele, can ensure that after the lethal gene is edited, the resulting recombinant cells, especially fertilized egg cells, can still survive.

As used herein, the term "zona pellucida attenuating treatment" refers to the removal of at least a portion of the zona pellucida compared to untreated embryos (or fertilized egg cells). According to the embodiment of the present invention, the zona pellucida is the glycoprotein layer around the plasma membrane of the oocyte, which may form a barrier and prevent the CRISPR/Cas9 components from entering the fertilized egg through electroporation, thereby affecting the efficiency of subsequent gene editing. Excessive treatment of the zona pellucida may affect the survival of fertilized egg cells. According to an embodiment of the present invention, the benchtop liquid that can be used can be used for zona weakening treatment.

As used herein, the terms "S phase" and "G1" phase refer to the position of the fertilized egg cell in the cell cycle. The cell cycle refers to the whole process that a cell undergoes from the completion of one division to the end of the next division, and is divided into two phases: interphase and division phase (M phase). Among them, the interphase is divided into three phases, namely the early DNA synthesis phase (G1 phase), the DNA synthesis phase (S phase) and the late DNA synthesis phase (G2 phase). G1 phase is a period from mitosis to DNA replication, also known as the pre-synthesis period, which mainly synthesizes RNA and ribosomes. This period is characterized by active material metabolism, rapid synthesis of RNA and protein, and a significant increase in cell volume. The S phase is the DNA synthesis phase. During this phase, in addition to DNA synthesis, histones are also synthesized. The enzymes required for DNA replication are synthesized during this period. The G2 phase is the late stage of DNA synthesis and is the preparation period for mitosis. During this period, DNA synthesis is terminated, and a large amount of RNA and proteins are synthesized, including tubulin and maturation-promoting factors. The term "before S phase" as used herein means that the fertilized egg cell is in S phase or G1 phase or even G0 phase (ie, the period in which division is stopped, which is rare for fertilized egg cells), wherein G1 phase is preferred. Those skilled in the art can distinguish the cycle stage in which the fertilized egg cells are by conventional means, such as observing morphological changes under a microscope or staining. In addition, according to many experiments conducted by the inventors of the present invention, it is found that for mice, before 10:00 on the next day in the same cage, preferably before 9:30, the fertilized eggs of the animals can be ensured to be in the S phase, usually in the G1 phase.

The term "benchtop solution" used in this article, Tyrode's solution, belongs to a kind of balanced salt solution, mainly composed of sodium chloride, phosphate, calcium chloride, glucose, etc., without HEPES. According to some embodiments of the present invention, 1000ml benchtop solution contains NaCl 8.0g, 10% KCl 2.0ml (0.2g), 10% MgSO ₄ .7H ₂ O 2.6ml (0.26g), 5% NaH ₂ PO ₄ .2H ₂ O 1.3ml (0.065g), _NaHCO3 1.0g, 1M _CaCl2 1.8ml (0.2g) and glucose 1.0g.

As used herein, the term "amount" refers to weight units unless otherwise specified.

As used herein, the term "mutated fertilized egg cell" means that the genome of the fertilized egg cell has at least one variation compared to the genome of the unmutated fertilized egg cell (or the wild-type genome), the variation being one or more bases The insertion, deletion and/or substitution of bases or even nucleotide fragments, so that the function of the corresponding gene can be regulated or changed, such as the up-regulation or down-regulation of gene expression, the knock-in of new genes, or the coding or non-coding of wild-type genes. Sequence changes, knockout of wild-type genes, etc. Sometimes "mutant cells" are also called "recombinant cells" and are used interchangeably.

As used herein, the term "homozygous" means that for diploidy, two homologous chromosomes have the same allele or mutation, eg, for a pair of homologous chromosomes, gene A is knocked out on one chromosome and the other chromosome Gene A is also knocked out, and the cell is "homozygous" for the gene A mutation.

The term "homozygous HDR" as used herein refers to the occurrence of "HDR" (Homology directed repair, homology-mediated double-stranded DNA repair) at a specific location on a pair of homologous chromosomes. As a result, the same functional change occurs in the gene corresponding to the specific position, such as up-regulation, down-regulation, amino acid mutation or functional loss.

The term "single deletion" as used herein refers to a specific gene for a pair of homologous chromosomes, the function of which is changed on one chromosome, such as loss of function or decreased expression compared to wild type, and the other chromosome The function of the gene did not change. As mentioned above, for lethal genes, if both alleles of the diploid cell lethal gene are knocked out or mutated, it is very likely to cause cell death. Therefore, when conducting functional studies, single knockout is required. Deletion, that is, knocking out the lethal gene on an allele, thus ensures that after the lethal gene is gene-edited, the resulting recombinant cells, especially fertilized egg cells, can still survive.

A method for electrotransfection gene editing of animal fertilized eggs

During the research process, the inventors found that the existing homology-directed repair (HDR) fertilized egg cells obtained by gene editing are relatively inefficient or the gene editing efficiency is unstable. Usually, only one or two single genes have been tested. High-efficiency single-gene editing is stably achieved at different gene loci, and homozygous mutant zygotes are not efficiently obtained, which largely limits the application of corresponding scarce mouse models. After in-depth analysis, the inventor of the present invention unexpectedly found that the processing timing of the exogenous gene used for gene editing in the electrotransfection of mouse embryos is very important for the final electrotransfection efficiency, thus completing the present invention. The method that can efficiently realize electrotransfection of foreign substances into fertilized egg cells can further realize high-efficiency gene editing at different gene loci, and efficiently obtain recombinant fertilized egg cells, which greatly promotes the corresponding Applications of scarce mouse models.

Therefore, the present invention proposes an efficient and stable electrotransfection gene editing system for animal fertilized egg cells (sometimes also referred to as "embryo" in this document). Gene editing efficiency, increase the proportion of recombinant fertilized egg cells, and realize multi-gene editing, thereby reducing the cost of breeding genetically engineered mice and laying a good foundation for the efficient breeding of genetically engineered mice.

In the first aspect of the present invention, the present invention provides a method for electrotransfection gene editing of animal fertilized eggs. According to an embodiment of the present invention, the method includes:

First, the zona pellucida was weakened on the fertilized eggs of animals before the S phase.

The inventors of the present invention found that in the process of introducing foreign substances by electrotransfection, the presence of the zona pellucida in animal fertilized egg cells would prevent the foreign substances from entering the fertilized egg cells. Therefore, it is necessary to weaken the zona pellucida to facilitate the entry of foreign substances into fertilized egg cells.

For animal embryos, especially mouse embryos, the zona pellucida weakening treatment is performed. According to the embodiment of the present invention, by contacting the animal embryos with the benchtop liquid, the treatment time of this step is as long as the efficiency of subsequent electrotransfection is up to Crucially, if the contact time is too short, the weakening of the zona pellucida will be insufficient, reducing the efficiency of gene editing. If the contact time is too long, the weakening of the zona pellucida will be too high, which will affect the survival of the embryo.

According to an embodiment of the present invention, the zona pellucida weakening treatment is performed by contacting the fertilized egg cells of the animal with the table solution for 0-40 seconds. Preferably, according to an embodiment of the present invention, the zona pellucida weakening treatment is performed by contacting the fertilized egg cells of the animal with the bench top liquid for 5 seconds. Therefore, it can be ensured that while the electrotransfection efficiency is improved, the viability of embryos or fertilized egg cells after electrotransfection is not affected.

According to an embodiment of the present invention, the animal is a mammal. According to an embodiment of the present invention, the animals include rodents, dogs, cats, rabbits, and monkeys. According to embodiments of the present invention, the animals include mice and rats.

As mentioned above, according to an embodiment of the present invention, the fertilized egg of the animal is in the G1 phase. According to an embodiment of the present invention, the electroporation transfection process is completed within 10 hours after fertilization.

According to an embodiment of the present invention, the animals are rodents, and optionally, the rodents include mice and rats. According to an embodiment of the present invention, the fertilized egg cell of the animal is before S phase.

According to the embodiment of the present invention, the inventor unexpectedly discovered through a large number of experiments that the time for electrotransfection treatment is very important. Effectively improve the efficiency of obtaining gene mutations, especially the efficiency of homozygous mutations of multiple genes. As mentioned earlier, in practice, the transfection process can be started before 10 o'clock the next day in the hermaphroditic cage, so that the electrotransfection process can be completed before 10 o'clock, for example, before 9 o'clock, before 8 o'clock, before 7 o'clock , before 6 o'clock, etc., which, preferably, is carried out between 9 o'clock and 9:30. The inventor believes that the possible reason is that it takes 10 hours for the mouse embryo to enter the S phase from fertilization. The actual time of mating and fertilization of mice can be defaulted, but it is generally considered that the mating time of mice is at 12:00 midnight. Therefore, the inventor believes that it is necessary to complete the process from embryo collection to electrotransfection before 10:00 a.m. the next day after the cage is closed. a series of operations. It should be noted that, according to the embodiment of the present invention, when using other means, such as injection method, the operation efficiency is usually low, and for more than 100 mouse embryos, it will be difficult to complete the entire transfection operation before 10 o’clock, and due to The duration of the operation is long, so it is difficult to ensure the uniformity and synchronization of the transfection process.

According to an embodiment of the present invention, the present invention also proposes a method for weakening the zona pellucida of an animal fertilized egg. According to an embodiment of the present invention, the method includes: weakening the zona pellucida on an animal fertilized egg before the S phase Treatment, the zona pellucida weakening treatment is carried out by contacting the fertilized egg cells of the animal with the table solution for 4-10 seconds.

The inventors of the present invention found that, for animal embryos, especially mouse embryos, the zona pellucida weakening treatment, specifically, contacting the animal embryos with the benchtop solution, the processing time of this step is very important for the subsequent electrotransfection. Efficiency is crucial. If the contact time is too short, the weakening of the zona pellucida will be insufficient, reducing the efficiency of gene editing. If the contact time is too long, the weakening of the zona pellucida will be too high, which will affect the survival of the embryo. In addition, the inventors have also found through a large number of experiments that completing electroporation transfection by 8 pulses (“electroporation transfection” and “electrotransfection” can be used interchangeably herein) can effectively improve the transfection efficiency and maintain The viability of embryos, especially the high-efficiency gene editing of multiple genes. According to the embodiments of the present invention, the electrotransfection efficiency of the animal fertilized eggs processed according to the above steps is obviously improved.

According to the embodiment of the present invention, in the weakening treatment in step (1), it is found that a homozygous HDR mutant can be obtained by adjusting the experimental time (the electrotransfection experiment is started at 9:00-9:30 in the morning). Figure 1 shows the results of next-generation sequencing after gene editing by electrical transfection of the designed mouse embryo Emx1 gene. Where there are sets of peaks, it indicates that there are different genome sequences, indicating that gene editing has occurred. The sequencing results are shown in Figure 2: in the area shown by the red rectangle, all the bases have changed to the same mutation as ssODN, and no spurious peaks appear. Fig. 2 shows the results of first-generation sequencing of homozygous HDR mutants according to an embodiment of the present invention, wherein, in the region shown by the gray rectangle, all bases are changed to the same mutation as ssODN, and no spurious peaks appear, and the edited target base Because of Emx1, the guide sequence of sgRNA is GAGTCTGAGCAGAAGAAGAA, and the corresponding ssODN sequence is GAGTCCGAGCAGAAGAAAAA. The total length of ssODN is 130nt, and the rest of the base sequence is the same as that of the mouse genome.

To further verify the effect of electrotransfection time on the proportion of homozygous HDR mutants, the inventors performed electrotransfection experiments on embryos obtained from the same batch of mice at several different time periods. Except for the different start and end times of electrotransfection, other conditions were the same. The results are shown in the table below.

Table 1: Effect of electrotransfection time on the proportion of homozygous HDR mutants

It can be seen that controlling the electrotransfection time is very important to increase the proportion of homozygous HDR mutants: if electrotransfection is completed before 10 o'clock, homozygous HDR mutants can be obtained, and the proportion of homozygous HDR mutants is relatively large. ; The electrotransfection experiment was started after 10 o'clock in the morning, and homozygous HDR mutants could hardly be obtained.

After that, the inventors tested embryo electrotransfection on Zswim3, Tyr and lethal gene Foxg1. Electrotransfection was completed before ten o'clock. The HDR ratios of the three genes are as follows. The results showed that the HDR ratio of Zswim3 gene was 23%, the HDR ratio of Tyr gene was 16%, and the HDR ratio of Foxg1 gene was 30.8%, which was significantly higher than the 5% in published articles.

Table 2: Proportion of homozygous HDR mutants at different gene editing sites

It should be noted that, according to the embodiment of the present invention, when using other means, such as injection method, the operation efficiency is usually low, and for more than 100 mouse embryos, it will be difficult to complete the entire transfection operation before 10 o’clock, and due to The duration of the operation is long, so it is difficult to ensure the uniformity and synchronization of the transfection process. For electrotransfection, hundreds of mouse embryos (fertilized egg cells) can easily be transfected with one or more electroporation treatments.

Next, after mixing the exogenous material with the zona pellucida weakened animal fertilized eggs, electroporation transfection is performed, wherein the exogenous material includes Cas9 protein and sgRNA.

According to an embodiment of the present invention, the amount of the Cas9 protein in the exogenous material is 2-6 times the amount of the sgRNA by weight. Preferably, according to the embodiment of the present invention, the amount of the Cas9 protein in the exogenous material is 4 times the amount of the sgRNA by weight. When using Cas9 technology for gene editing operations, the supply form and corresponding usage ratio of exogenous Cas9 and sgRNA are very important for the efficiency of transfection and subsequent gene editing, and those skilled in the art have been exploring. The inventors of the present invention found that when Cas9 is provided in the form of protein, and sgRNA is provided in the form of RNA molecules, and the dosage and weight ratio are 2-6:1, the gene editing efficiency will be significantly improved.

As mentioned above, those skilled in the art can understand that, in order to promote the occurrence of HDR, ssODNA molecules can be further provided. Thus, according to an embodiment of the present invention, the exogenous substance includes: at least one sgRNA, the at least one sgRNA targets different targets respectively; and at least one ssODN corresponding to the sgRNA, the ssODN The sequence of is determined based on a predetermined length flanking the target. Those skilled in the art can select the corresponding sgRNA and ssODNA according to the target gene, which will not be repeated here.

The inventors found that, using the technology of the present invention, it is possible to perform gene editing of multiple genes at the same time. According to embodiments of the present invention, simultaneous editing of up to 12 genes can be performed. According to an embodiment of the present invention, the exogenous substance includes 2 to 12 sgRNAs, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 sgRNAs. According to the embodiment of the present invention, based on 10 microliters of electrotransfection master mix, the dosage of each sgRNA is 1 microgram, and the dosage of the Cas9 protein is 2-6 times of the total amount of the at least one sgRNA, for example, 2, 3, 4, 5 or 6. According to the embodiment of the present invention, based on 10 microliters of electrotransfection master mix, the dosage of the Cas9 protein is not more than 20 micrograms, preferably not more than 16 micrograms. According to an embodiment of the present invention, the electroporation transfection treatment adopts 5-10 pulses, such as 5, 6, 7, 8, 9 or 10 pulses. According to an embodiment of the present invention, the electroporation transfection treatment uses 8 pulses. Thus, the efficiency of multi-gene editing by electrotransfection can be improved. The inventors also found through a large number of experiments that electroporation transfection (“electroporation transfection” and “electrotransfection” can be used interchangeably in this paper) through 8 pulses can effectively improve the transfection efficiency and maintain the embryo’s quality. Viability, especially to achieve high-efficiency gene editing of multiple genes.

According to the embodiment of the present invention, during multi-gene editing, the inventors treated the zona pellucida with a benchtop solution for 5 seconds, and kept the concentration of each sgRNA at 0.1 ug/ul, while the Cas9 protein concentration was changed to 50% of the total sgRNA concentration. 4 times; at the same time, the inventors further optimized the electrotransfection parameters and used 8 pulses. The table below shows that when the inventors electrotransfected 8 sgRNAs of different genes at the same time in the same embryo, the proportion of at least 6 gene editing at the same time was 100%, and the proportion of gene editing at 8 loci at the same time was 33%. This indicates that the optimized embryo electrotransfection gene editing technology can achieve high-efficiency multi-gene editing.

Table 3: Efficiency of multiple gene editing by electrotransfection of mouse embryos

To further confirm the efficiency of multiple gene editing, the inventors increased the number of embryos tested for editing efficiency. Four genes were randomly selected for next-generation sequencing, and the multi-gene editing efficiency was counted. As shown in the table below, after calculating the editing efficiency of 10 embryos, the inventors found that the efficiency of simultaneous gene editing at at least 6 sites in the same embryo is 80%, and the efficiency of gene editing at all 8 sites at the same time is high. at 30%.

Table 4: Efficiency of multiple gene editing by electrotransfection of mouse embryos

Thus, according to an embodiment of the present invention, the present invention proposes a method for electrotransfection gene editing of animal fertilized eggs, the advantages of which are at least one of the following:

(1) High throughput, according to an embodiment of the present invention, up to 400 embryos can be edited simultaneously per electrotransfection experiment;

(2) High efficiency, according to the embodiment of the present invention, the gene editing efficiency per site is higher than 90%;

(3) high proportion of homozygous HDR mutants, according to the embodiment of the present invention, the proportion of homozygous HDR mutants is higher than 16%;

(4) Multiple gene editing can be realized at the same time. According to the embodiment of the present invention, the efficiency statistics of the simultaneous editing of 8 genes have been carried out. up to 100%, while all 8 gene editing efficiencies were higher than 30%. As mentioned in the optimization of single-gene editing efficiency, the inventors optimized the treatment of the zona pellucida, and optimized the concentration of Cas9 and sgRNA.

(5) High acquisition efficiency of HDR mutant mice, according to the embodiment of the present invention, single site gene editing, the acquisition efficiency of HDR mutant mice is higher than 55.6%, and the acquisition efficiency of homozygous HDR mutant mice is higher than 30%. Among them, the efficiency of obtaining mutant mice with single deletion lethal gene is as high as 100%.

Construction method of mutant fertilized egg cell and its application

In a second aspect of the present invention, the present invention provides a method for constructing mutant fertilized egg cells. According to an embodiment of the present invention, the method includes: (1) performing a zona weakening treatment on the animal fertilized eggs before the S phase; (2) mixing exogenous substances with the zona pellucida weakened animal fertilized eggs, and performing Electroporation transfection treatment, wherein the exogenous material includes Cas9 protein and at least one sgRNA, and the weight ratio of the Cas9 protein to the at least one sgRNA is 2 to 6:1, preferably 4:1 based on weight .

As mentioned above, according to the embodiments of the present invention, when the fertilized egg cells of animals before S phase are used, and electrotransfection is carried out in the form of a mixture of Cas9 protein and sgRNA, the efficiency of gene editing can be effectively improved, so that the construction can be further improved. Efficiency of mutant fertilized egg cells. The foregoing features and descriptions of the relevant steps are also applicable to this method, and are not repeated here. As mentioned above, the method can efficiently construct mutant fertilized egg cells with gene mutation, such as gene knockout or gene homologous recombination repair (HDR) mutant fertilized egg cells.

Those skilled in the art can understand that the fertilized egg cells obtained by adopting the above method can be verified by conventional biological methods, such as sequencing and other methods, to verify whether a corresponding mutation occurs at a specific position.

As mentioned above, those skilled in the art can understand that additional exogenous substances can be added as needed, for example, for the construction of mutant fertilized egg cells with homologous recombination repair (HDR), it is necessary to add ssODN, and it is found outside the The proportion of homozygous HDR fertilized egg cells obtained by the method of the invention is significantly increased, which can be as high as 30%, which is nearly 10 times higher than that of the prior art.

Thus, in the third aspect of the present invention, the present invention proposes a method for constructing a mutant fertilized egg cell, the mutant fertilized egg cell is a homozygous HDR fertilized egg cell, according to an embodiment of the present invention, the method comprises: (1 ) to weaken the zona pellucida of animal fertilized eggs before the S phase; (2) after mixing the exogenous material with the fertilized eggs of animals with weakened zona pellucida, carry out electroporation transfection treatment to obtain transfected fertilized eggs Egg cell, wherein, the foreign material comprises Cas9 protein, at least one sgRNA and at least one ssODN corresponding to the sgRNA, wherein, based on weight, the ratio of the Cas9 protein to the weight of the at least one sgRNA is 2 -6:1; and (3) selecting the homozygous HDR zygote cells from the transfected zygote cells. According to an embodiment of the present invention, the weight ratio of the Cas9 protein to the at least one sgRNA is 4:1. In addition, according to an embodiment of the present invention, the exogenous substance includes: 1-2 kinds of sgRNAs; and 1-2 kinds of ssODNs corresponding to the sgRNAs. According to the embodiment of the present invention, by adopting this method, a high proportion of homozygous HDR fertilized egg cells can be obtained, and even homozygous HDR of two genes can be obtained. As mentioned above, according to the embodiments of the present invention, when the fertilized egg cells of animals before S phase are used, and electrotransfection is carried out in the form of a mixture of Cas9 protein and sgRNA, the efficiency of gene editing can be effectively improved, so that the construction can be further improved. Efficiency of mutant fertilized egg cells. It was also unexpectedly found that the proportion of HDR fertilized egg cells homozygous for one sgRNA could reach 20%.

As mentioned above, according to the embodiments of the present invention, when the fertilized egg cells of animals before S phase are used, and electrotransfection is carried out in the form of a mixture of Cas9 protein and sgRNA, the efficiency of gene editing can be effectively improved, so that the construction can be further improved. Efficiency of mutant fertilized egg cells. In addition, according to the embodiment of the present invention, it was unexpectedly found that in the obtained transfected fertilized egg cells, the proportion of lethal genes with single deletion was as high as 54%, and in these fertilized egg cells, the location where HDR occurred was actually protected Not knocked out or loss of function. Thus, a fertilized egg cell having a single deletion lethal gene can be efficiently obtained, and further, the biological activity of the lethal gene can be studied while the fertilized egg cell is alive.

After the fertilized egg cells are obtained, those skilled in the art can obtain mutant animals by conventional means, these animals carry the mutant genes in the corresponding fertilized egg cells.

Thus, in the fifth aspect of the present invention, the present invention provides a method for constructing a mutant animal, according to an embodiment of the present invention, the method comprises: (a) constructing a mutant fertilized egg cell according to the aforementioned method; and (b) growing the mutant fertilized egg cells to obtain the mutant animal.

Thus, according to the embodiments of the present invention, corresponding mutant animals can be constructed for known disease-related genes, so as to be used as animal models for disease research or drug screening. These corresponding associated genes may include, but are not limited to: DHODH, RBM10, SETBP1, GPSM2, FLVCR2, MLL2, WDR35, WDR62, PIGV, SDCCAG8, MASP1, ACAD9, ANGPTL3, FADD, TGM6, CEP152, DHDDS, TECR, ARHGAP31, AARS2 , IMPAD1, BANF1, KIF1A, FAM20A, AP4S1, AP4B1, AP4E1, ZBTB24, NCSTN, VPS35, CCDC8, AKT1, PSMC3IP/HOP2, ADK, KAT6B, MEGF10, WDR19, PRRT2, POLR3A, POLR3B, IDH1, CSF1R, GATAD1, EZH2 , KIF22, KIF22, PLA2G5, PRRT2, DLX5, EZH2, KLHL3, CUL3, NDUFB3, AGK, RIPK4, SLC6A3, BRAT1, CRADD, TUBGCP6, FLVCR1, SNIP1, HARS, SLCO2A1, THRA, ACTB, ACTG1, AGK, DDOST, EFTUD2 , GPR179, KIF11, RAD51, RTN2, SRCAP, ACO2, ARID1B, CTC1, DNAJB6, KLHL3, MAFB, MCM4, SMARCB1, SMARCA4, SMARCA2, SMARCE1, ARID1A, ARID1B, XRCC2, TRPV3, C5orf42, CHST8, CIZ1, DST, EXOSC3 , GUCY2C, LZTFL1, MFF, FARS2, NDUFS8, MTFMT, NDUFB3, PDE4D, PDE4D, PIGL, ROGDI, ADCY5, CEP135, CYP4V2, DNAJC6, DYNC1H1, KIAA1530(UVSSA), NNT, PLCB4, GNAI3, SF3B4, SRP72, ABCC9, AGK, AKT3, PIK3R2and PIK3CA, MTO1, NSUN2, SERAC1, CARD14, CD27, FAN1, LARS, PIGO, RAB33B, TGFB2, CCDC78, FAM38A, IFITM5, IFITM5, LRBA, MLL, PFN1, POC1A, SLCO2A1, TCTN3, TFG, COL14A1 , GRM1, GTDC2, NMNAT1, NMNAT1, NMNAT1, PMCA3, SLC52A2and SLC52A3, SORL1, TSPEAR, AAGAB, ABCD4, ALG13 , DPAGT1, PGM1, ATP1A3, CLIC2, FARS2, HEATR2, HYDIN, PLCG2, RMND1, ROGDI, SLCO2A1, TMEM231, TMEM38B, CD59, CYP26C1, DYNC1H1, HOXC13, IGSF1, KCNT1, KCNT1, NIN, PNPT1, SKI, SLC29A3, ZNF141 , ACTG2, AGK, ANO3, CCDC114, DGAT1, DGKE, DHTKD1, EPS8L3, EXPH5, GNAL, HERC2, INPPL1, KCND3, KCND3, LRIT3, PACS1, PDGFRB, PLA2G4A, SLC5A7, TECPR2, UBE3B, UQCRC2, WDR45, SLC26A3, HSD17B4 , VCP, BAG3, NOTCH2, RMRP, PTH1R, MCT8, DNAJC5, SLC29A3, SMAD4, TK2, KAT6B, KAT6B, PIGA, DYNC1H1, LOXHD1, PLDN, CAV1, MPL, ABCC9, DNMT1, KIF7, RSPH9, GPSM2, GRN, PIK3CA , PIK3CA, AKT3, MTOR, TCF4, TTN, ASAH1, DPAGT1, GATA1, REEP1, FUS, HDAC8, ATP1A3, ATP1A3, MVK, MYBPC1, KCNJ13, LHCGR, AFG3L2, ELOVL4, SMAD4, HSD17B4, AIFM1, C12orf65, RP1L1, SNAP29 , ST3GAL3, HPSE2, AP4B1, CYP24A1, SPR, ALG8, C10orf2(Twinkle), GCDH, OFD1, FA2H, SPG11, VPS13A, BOLA3, C19orf12, SLC40A1, ATP13A2, CD45, KCNJ11, ASPM, GLB1, IL-10R1, KCTD7, PKHD1, SACS, CACNA1S, CASK, EFHC1, KCNQ2, CAPN3, CLN6, DES, GM3, MPV17, UPF3B, APOE, RYR1, DNAJC5, AIFM1, TREM2, C5orf42, EVC2, SEC8, RBP4, SLC52A2, SUCLA2, WDR35, CSF1R, CYP1B1, MYOC, LTBP2, DNAJC6, DPAGT1, DPAGT1, GBE1, KCTD7, RP1, STAT1, USH1C, LMNA, TGM6, TRAPPC9, OFD1, PRKCG, TRPV4, DFNA9, ABCA4, RDS/PRPH2, ELOVL and CRB1, CUL7, SNRNP200, SOD1, VCP, CDHR1, DDX11, PIK3CA, SLX4/FANCP, UBQLN2, BSCL2, FGD1, GATA4, KIF7, VCP, CCDC88C, DES and FLNC, ABCD4, GARS.

The mutant fertilized egg cells constructed by the present invention can be replanted into the female mouse after normal culture in vitro to the two-cell stage, and the corresponding mutant mice can be obtained through the normal development cycle of the embryo. As mentioned above, the mutant fertilized egg cells of Emx1, Zswim3, Tyr and lethal gene Foxg1 constructed by the present invention can be replanted into female mice at the two-cell stage to generate mutant mouse models. The genotype identification results of gene mutant mice obtained by replanting mutant fertilized egg cells are as follows. It is worth noting that the fertilized egg cells mutated by the lethal gene Foxg1 cannot normally develop into mice, so the mutant mice with single deletion of the lethal gene can help us to study the biological function of the lethal gene in mice. Foxg1 mutant fertilized eggs, replanted into postnatal mice are all mutants with single deletion lethal gene, and the efficiency is as high as 100%. Therefore, the present invention can effectively construct a mouse animal model with a single deletion lethal gene.

Table 5: Types of Mutant Mutants Born After Mutant Fertilized Oocyte Reimplantation

Note: KI mutants are mutants containing HDR mutation types.

According to the embodiment of the present invention, the method for constructing an animal model has the advantage of high acquisition efficiency of HDR mutant mice. According to the embodiments of the present invention, in single-site gene editing, the acquisition efficiency of HDR mutant mice is higher than 55.6%, and the acquisition efficiency of homozygous HDR mutant mice is higher than 30%; wherein, the mutant mice with single deletion lethal gene are obtained Efficiency up to 100%.

Those skilled in the art can use techniques known in the art for drug screening, which will not be repeated here.

The present invention will be described below through specific examples, unless otherwise specified, the treatment means and reagents used in the specific examples are conventional or commercially available.

Example 1

1. In vitro preparation of gene editing system

Purification of Cas9 protein

The plasmid required to express Cas9 protein is pET28a(-)his(+)HA-NLS-SpCas9.

Day 1: Plasmid Transformation

The PET28a-spCas9 plasmid containing the T7 promoter was transformed into Rosetta DE3 according to the experimental procedure provided by competent cells. Briefly, approximately 200 ng of plasmid DNA was added to 50 μl of freshly thawed competent cells and incubated on ice for 30 min. Heat shock cells by incubating at 42 °C for 60 s, then place cells on ice for 3 min. 500 μl of LB (Luria Broth) medium was added to the cells and incubated at 37° C. for 1 h in a shaking incubator. Competent cells were then spread evenly onto LB agar plates containing 50 μg/ml kanamycin and incubated overnight at 37°C.

Day 2: Bacterial expansion and protein-induced expression

Pick a colony from the agar plate and inoculate 10 ml of LB medium containing 50 μg/ml kanamycin. The pre-culture was incubated overnight at 37°C in a shaking incubator (250 rpm). Inoculate 10 ml of pre-culture into 1 L of pre-warmed LB medium containing 50 μg/ml kanamycin in a 2 L tape flask, expand the bacteria at 37 °C in a shaking incubator (220 rpm) while measuring 600 nm by (OD 600 ) to monitor cell growth. When the OD increased to 0.6-0.8, the temperature was lowered to 16°C. Protein expression was induced by adding 2 ml of 100 mM isopropyl-[beta]-D-1-thiogalactopyranoside (IPTG final concentration 200 [mu]M) to each flask. Continue to incubate overnight at 16°C with shaking for 12-16 hours.

Day 3: Ni-column affinity purification of Cas9 protein

Cells were harvested by centrifugation at 4000 rpm for 10 minutes in a centrifuge containing a swinging bucket rotor. Pour off the supernatant and use about 40 ml of pre-cooled lysis buffer (20 mM Tris-Cl, pH 8.0, 500 mM NaCl, 10% glycerol, 1 mM TCEP, 1 mM phenylmethylsulfonyl fluoride PMSF) for each liter of bacteria collected. Resuspend the cell pellet. The resuspended cell pellet can either be used directly for further purification or can be snap-frozen in liquid nitrogen and stored at -80°C for several months without loss of Cas9 enzymatic activity.

The resuspended bacteria were disrupted with ultrasonic waves until the bacterial liquid became clear and transparent, and the ultrasonic disruption procedure was performed (ultrasonic for 1 s, stop for 3 s, 50% power, and the total duration was 10 min). Afterwards, the bacterial lysate was transferred to a 50ml Beckman centrifuge tube, and the supernatant and the pellet were separated by centrifugation at 4°C for 30min using a No. 25.5 rotor at 15000rpm. The supernatant containing Cas9 protein was transferred to a nickel column and incubated at 4°C for 1 hour. Before incubation, nickel column material (2 ml) was washed and equilibrated with 20 ml of double-distilled water and 10 ml of bacterial lysis buffer in turn. After the incubation, collect the nickel column flow-through, and wash the nickel column with 50 ml of washing solution (20 mM Tris-Cl, pH 8.0, 250 mM NaCl, 20 mM imidazole, pH 8.0, 5% glycerol) until the washing solution flowing out of the nickel column is no longer Discolors Bradford stain. Afterwards, the protein on the nickel column was eluted with 50 ml of elution buffer (20 mM Tris-Cl, pH 8.0, 250 mM NaCl, 250 mM imidazole, pH 8.0, 10% glycerol, 1 mM TCEP) until the elution buffer eluted from the nickel column. No longer discolors Bradford stain. The eluted protein solution was transferred to a dialysis membrane with a pore size of 100KDa, and the dialysis membrane loaded with Cas9 protein was placed in 1 L of dialysate (20mM HEPES-KOH, pH 7.0, 125mM KCl, 10% (v/v) glycerol, 1 mM dithiothreitol (DTT)) overnight at 4°C (replace with new dialysate after 3 hours of dialysis).

Day 4: Cation Exchange Columns and Molecular Sieves

The dialysis sample is recovered from the dialysis membrane. Usually, a noticeable precipitation occurs after dialysis. The precipitate was removed by centrifugation at 4000 rpm for 5 minutes at 4°C. 5 ml of HiTrap SP were washed alternately with cation exchange (IEX) buffer A (20 mM HEPES-KOH, pH 7.0, 100 mM KCl, 10% glycerol) and buffer B (20 mM HEPES-KOH, pH 7.0, 1 M KCl, 10% glycerol) HP column (GE Healthcare). After washing, equilibrate the column with buffer A until the curve of salt concentration and UV280 absorbance becomes a straight line, then the UV280 absorbance is automatically zeroed. The Cas9 protein was then loaded onto the column using a loading pump at a flow rate of about 5 ml/min. After loading, wash the column with 10 ml of IEX buffer A, and then gradually increase the volume ratio of buffer B in buffer A (from 0% to 50%), and then increase the salt concentration gradient elution binding in Cation exchange on the protein. Cas9 typically elutes in two peaks with different absorbances at 260 and 280 nm (A260/A280). The first peak starts to elute at about 15% IEX buffer B with a maximum at ~20%, the second peak at ~25-40% with a maximum at ~30% , collect eluted protein with collection tubes, 2ml per tube. Fractions of the eluted solution were analyzed for the presence of Cas9 using SDS-PAGE, and the eluates containing Cas9 protein were pooled together.

The cation exchange eluate containing Cas9 protein was concentrated to 1 ml using a 100,000 MWCO centrifugal concentrator tube at 4000 rpm. The concentrate was recovered into a 1.5 ml Eppendorf tube and centrifuged at 12,000 rpm for 10 minutes at 4°C to remove precipitated material. Meanwhile, a Superdex 200 10/300 gel filtration column (GE Healthcare, 24 ml column volume) was equilibrated with molecular sieve buffer (20 mM HEPES-KOH, pH 7.0, 250 mM KCl, 10% glycerol, 1 mM TCEP). The concentrated Cas9 was injected into the column using a 1 ml sample loop. Elute with 25ml molecular sieve buffer at a flow rate of 0.5ml/min, and collect the eluate with a collection tube, 500ul per tube. Cas9 typically elutes in a volume of about 12 ml. The eluates in the collection tubes were analyzed for Cas9 content using SDS-PAGE, and Cas9-containing proteins were pooled together.

Day 4: Protein concentration and storage

Use a 100,000MWCO centrifugal concentrator tube to concentrate the Cas9 solution (add 10% glycerol) to the concentration required for the next experiment (usually ~5mg/ml). After the concentration is complete, add 10% glycerol to the protein solution for long-term protein storage. Concentrations were determined on the assumption that 1 mg/ml had an absorbance of 0.76 at 280 nm (based on a calculated extinction coefficient of 120, 450 M-1 cm-1). To avoid unnecessary freeze-thaw cycles leading to decreased enzymatic activity, the concentrated protein samples were divided into 10-20 μl aliquots and snap frozen in liquid nitrogen. Frozen Cas9 can be stored at -80°C for several months without loss of activity. Before use, thaw aliquots and dilute to desired concentration with storage buffer. Cas9 is typically diluted to 2 μM for endonuclease activity assays. If used for multiple experiments, Cas9 can be stored on ice or at 4°C for at least 2 days without loss of activity. However, it is recommended to periodically check the stored samples for any precipitated material and to check the protein quality by SDS-PAGE.

In vitro transcription of sgRNA

A. Design forward primer, T7 promoter sequence, guide sequence, and sgRNA scalffold

The first 20 bases of the 5' end together constitute the sgRNA IVT F primer.

What is required is the sequence of the T7 promoter: 5'TAATACGACTCACTATA G 3'. T7 RNA polymerase begins transcription at the underlined G in the T7 promoter sequence, without which transcription hardly occurs. If there is no base G at the 5' end of the guide sequence (the position next to the 3' end of the T7 promoter), you can add one base G, two bases G (the G at the 3' end of the T7 promoter and the 5' of the guide sequence) G) at the end can improve in vitro transcription efficiency and increase sgRNA production (NEB official website).

B. Design the reverse primer. Poly T is added to the 3' end sequence of the sgRNA backbone as a transcription termination signal, and the sequence obtained after reverse complementation is the sgRNA scal R primer sequence: AAAAAAACACCGACTCGGTGCC.

PCR method to construct DNA template required for in vitro transcription. The PCR reaction system is as follows:

Table 6: PCR system required for constructing in vitro transcription templates

成分Element	用量(单位：μL)Dosage (unit: μL)
pX330质粒(10ng/μL)pX330 plasmid (10ng/μL)	1.01.0
sgRNA IVT F primer(10μM)sgRNA IVT F primer (10μM)	1.01.0
sgRNA scal R primer(10μM)sgRNA scal R primer (10μM)	1.01.0
2×vazyme phanta master mix2×vazyme phanta master mix	10.010.0
ddH2OddH2O	6.06.0

total capacity

20.0

The PCR program was as follows: 95°C, 3 min; {98°C, 20sec; 60°C, 15sec; 72°C, 15sec} 35 cycles; 72°C, 1 min; 4°C, ∞.

Agarose gel electrophoresis and gel recovery.

In vitro transcription was performed with the NEB T7 transcription kit. Prepare the in vitro transcription system according to the following table in the RNA clean bench.

Table 7: NEB T7 RNA polymerase in vitro transcription system

成分Element	用量(单位：μL)Dosage (unit: μL)
无核酶水Nuclease-free water	18-x18-x
NTP缓冲液混合物(6.7mM)NTP buffer mix (6.7mM)	1010
模板DNAtemplate DNA	xx
T7 RNA聚合酶T7 RNA polymerase	22
总体积total capacity	3030

Note: The actual amount of template DNA is 1 μg, and the specific amount x μL is calculated from the concentration of the DNA template recovered from the gel in step 5.

After the preparation of the above system is completed, fully blow, suck and mix, put it into a PCR machine, and place it at 37°C for 16 hours, and then purify the product. If the purification operation is not performed in a short time, the product should be placed in a -20°C refrigerator to prevent RNA degradation.

In vitro transcript purification. The following operations should be performed in an RNA clean bench as much as possible to prevent RNA degradation caused by RNase contamination.

(1) DNA digestion. Add 2 μL of DNase1 and 18 μL of ultrapure water to each sample, mix by blowing and suction, and put it into the PCR machine: 37°C, 15min.

(2) Add 50 μL of Elution Solution to each sample, the total volume is 100 μL at this time, and mix by pipetting.

(3) Add 350 μL of Binding Solution to each sample, and mix with a pipette gently.

(4) Add 250 μL of 100% ethanol solution to each sample (NEB’s T7 in vitro transcription kit does not contain 100% absolute ethanol, which needs to be purchased separately from the laboratory), and mix by gently blowing with a pipette.

(5) Put the Filter Catridge with the filter element into the Collection and Elution Tube. Add the above RNA mixture to the adsorption tube.

(6) Centrifuge at 12000 rpm for 1 min to make the liquid pass through the filter element. During this process, the RNA product will be combined with the filter element of the adsorption tube, and the remaining substances will enter the receiving tube with the liquid.

(7) Discard the waste liquid in the receiving tube, and add 500 μL of washing solution (Wash Solution) to the adsorption tube. Centrifuge at 12000rpm for 1min to make the cleaning solution pass through the filter element. During this process, impurities will be eluted from the filter element of the adsorption tube and enter the receiving tube with the cleaning solution.

(8) Repeat step (7).

(9) Centrifuge at 12000 rpm for 2 min, and further volatilize alcohol through this step.

(10) Transfer the adsorption tube with the filter element to a new receiving tube, and leave it open in the RNA ultra-clean bench for 5-10 minutes to completely evaporate the alcohol. At the same time, an appropriate amount of ultrapure water was preheated at 55°C with a metal bath.

(11) After the alcohol has completely evaporated, add 50-100 μL of preheated ultrapure water dropwise to the filter element of the adsorption tube, place it on the RNA ultra-clean bench, and let it stand for 2 minutes to fully dissolve the RNA product into the ultrapure water.

(12) Centrifuge at 12,000 rpm for 1 min, make the RNA product enter the receiving tube with ultrapure water, discard the adsorption tube, and measure the RNA concentration with nanodrop. Label and store in -20°C refrigerator.

Design and synthesis of exogenous template ssODN

According to the designed guide sequence, determine its target sequence on the genome, and introduce 2 synonymous mutations (the position of the mutated base is as close to the guide sequence as possible) to identify whether homologous repair occurs, and at the same time prevent the gene function from causing damage influences. The upstream and downstream of the target sequence were respectively extended by 50-55nt, resulting in a ssODN sequence of about 130nt. The sequence information was handed over to Sangon Bioengineering Co., Ltd. for synthesis and purification.

Acquisition and culture of mouse embryos

superovulation in female mice

(1) Select C57BL/6N female mice.

(2) According to the order date and body weight of the female mice, select the corresponding date to inject the first injection of PMSG (pregnant horse serum gonadotropin) into the female mice. Each female mouse was injected intraperitoneally with 0.2 mL (10 U) of PMSG. In this experiment, female mice were usually injected with PMSG at 3:30-4:30 pm.

(3) After 46-48 hours, each female mouse was intraperitoneally injected with 0.2 mL (10 U) of hCG (chorionic gonadotropin). The time of hCG injection to female mice in this experiment was usually 2:30-3:30 pm.

(4) After the female mice were injected with hCG, the female mice and the male mice were caged in a ratio of 1:1. When the cages are closed, change to a new rat cage, put the male rat into the rat cage first, and then put the female rat into the rat cage.

(5) Check whether the female mice have vaginal plugs in the next morning. The female mice without vaginal plugs are euthanized, and the female mice with vaginal plugs are taken back to the laboratory for embryo collection.

Acquisition of mouse embryos

(1) The female rat was killed by cervical dislocation, the abdominal cavity was opened, the fallopian tube, uterus and the enlarged ampulla were found, the mucosa attached to the fallopian tube was peeled off with scissors, and a small amount of tissue in the ampulla and its vicinity was cut off (try not to remove the uterus Cut, you can cut a small amount of fallopian tubes), and put them in pre-warmed DPBS.

(2) Use blunt forceps to transfer the fallopian tube to another tube of pre-warmed DPBS.

(3) Add pre-warmed M2 medium dropwise to a 3.5mm petri dish, 20 μL per droplet, and transfer the fallopian tubes to the M2 droplets with blunt forceps, placing one fallopian tube in each droplet.

(4) Holding a pair of pointed tweezers in both hands, under the asana microscope, remove the excess part outside the ampulla, tear the ampulla with pointed tweezers, and release the embryo. Add 10μL of 300ng/μL hyaluronidase to 20μL M2 droplet, after the cumulus cells are digested from the embryo, transfer the embryo to a new M2 droplet with a mouth pipette, transfer 3-4 times to completely remove Hyaluronidase and impurities.

Culture of mouse embryos

(1) Drop 40μL of KSOM droplets onto a 3.5mm embryo culture dish, 3 droplets can be added to each culture dish, and the distance between the droplets is appropriate. Add 3 mL of mineral oil to ensure that the droplets can be completely covered. If the droplets are not covered completely, the KSOM droplets will volatilize, and the concentration of each component will change, which will affect the survival of embryos. Petri dishes can be prepared a day in advance and placed in an incubator to equilibrate overnight.

(2) The embryos were transferred into KSOM droplets equilibrated in an incubator in advance and covered with mineral oil for culture.

(3) The conditions of the incubator are: 5% CO2 concentration, 95% oxygen concentration (oxygen purity ≥ 99%) concentration, saturated humidity, and constant temperature incubation at 37°C.

Electrotransfection of multigene non-homologous repair (NHEJ)-based mouse zygotes

Take the example of editing 8 genes at the same time.

The table below shows the names of the 8 genes edited at the same time and the corresponding sgRNA sequences.

Table 8: Names and corresponding sgRNA sequences of the 8 genes edited simultaneously

1. Prepare electrotransfection master mix A.

Table 9: Recipe of Electrotransfection Master Mix A

电转预混体系AElectro-to-premix system A	用量Dosage
5×RNP缓冲液5×RNP buffer	2μL2μL
Cas9蛋白Cas9 protein	16μg16μg
多个sgRNAMultiple sgRNAs	(每个1μg，总共8ug)(1μg each, 8ug total)
TE缓冲液TE buffer	补齐至10μLMake up to 10 μL
总体积total capacity	10μL10μL

Note: See Table 4 and Table 5 for the recipe of TE buffer 5×RNP buffer.

Table 10: TE Buffer Recipe

TE缓冲液成分TE buffer composition	用量Dosage
1M Tris-HCl(pH 7.4)1M Tris-HCl (pH 7.4)	10mL10mL
0.5M EDTA0.5M EDTA	2mL2mL
去核酸酶水(nuclease-free water)Nuclease-free water	988mL988mL
总体积total capacity	1L1L

Table 11: RNP buffer solution formulation

RNP缓冲液成分RNP buffer composition	用量(mL)Dosage (mL)
1M HEPES，pH 7.51M HEPES, pH 7.5	1.01.0
3M氯化钾3M Potassium Chloride	2.52.5
1M氯化镁1M magnesium chloride	0.050.05
100％甘油100% Glycerin	5.05.0
5mM TCEP5mM TCEP	0.50.5
去核酸酶水(nuclease-free water)Nuclease-free water	0.950.95
总体积total capacity	1010

2. Put the electrotransfection master mix A into the PCR machine, 37°C for 10 min; the purpose of this step is to combine Cas9 protein and sgRNA in vitro.

3. Put the embryos into the pre-warmed M2 droplet and wash twice.

4. Transfer the embryos to the benchtop solution and process for 5 sec.

5. Transfer the embryos to pre-warmed OptiMem I droplets and wash twice.

6. Add 10 μL of premix to 10 μL OptiMem I, and mix by pipetting; add 15 μL to the electrotransfection dish, add the embryos to the remaining 5 μL droplets, and gently pipette and mix well with a pipette. Transfer to the electrotransfection dish, and then add the remaining liquid to the electrotransfection dish.

7. Adjust the parameters of the electrotransfection instrument according to Table 12. After confirming that it is correct, click "start". The moment of electric shock can be observed from the stereoscope, and bubbles are generated in the electrotransfection dish. After the electric shock is completed, transfer the embryos to the KSOM. , put it into the incubator to continue culturing.

Table 12: Electrotransfection parameter settings

电转染条件Electrotransfection conditions	电转染参数Electrotransfection parameters
电压(Voltage)Voltage	30V30V
脉冲次数(Pulses)Pulses (Pulses)	88
脉冲长度(Pulses length)Pulses length	3ms3ms
脉冲间隔(Pulse interval)Pulse interval	100ms100ms

Next-Generation Sequencing Detects Gene Editing Efficiency

1. Use the primer-BLAST on the NCBI website to design a pair of TIDE primers around 300bp upstream and downstream of the editing site, named TIDE F primer and TIDE R primer respectively. The primer sequences were handed over to a biological company for synthesis.

2. Observe the development of embryos. Usually, about 96 hours after the fertilized eggs are taken out, they can develop into blastocysts. According to the number of blastocysts or groups to be detected, QuickExtract is divided into PCR tubes. The dosage of QuickExtract can be 10 μL.

3. Use an oral pipette to transfer the embryos that have developed to the blastocyst stage into M2 droplets for 1-2 washes, and then add them to PCR tubes containing QuickExtract. Make a mark.

4. After shaking with a vortex shaker for 15-30 sec, put the sample into the PCR machine and run the following program: 65°C, 15min; 68°C, 15min; 98°C, 10min. The embryo genome can be obtained. Genomic DNA concentration was determined with nanodrop.

5. Amplify the fragments near the editing site by PCR method for next-generation sequencing. Specific steps are as follows:

(1) Prepare a PCR system.

Table 13: PCR systems used to detect gene editing results

成分Element	用量(单位：μL)Dosage (unit: μL)
基因组DNA(20ng/μL)Genomic DNA (20ng/μL)	2.02.0
TIDE F primer(10μM)TIDE F primer (10μM)	1.01.0
TIDE R primer(10μM)TIDE R primer (10μM)	1.01.0
2×vazyme phanta master mix2×vazyme phanta master mix	10.010.0
ddH2OddH2O	6.06.0
总体积total capacity	20.020.0

(2) After mixing the above samples, put them into the PCR machine. The PCR program was as follows: 95°C, 3 min, {98°C, 20sec; Tm°C, 15sec; 72°C, tsec} 34 cycles, 72°C, 1 min; 4°C, ∞. [Note: Tm is the annealing temperature, which can be set according to the annealing temperature marked on the side walls of the primers synthesized by the company; t is the extension time. When the phanta of vazyme company uses the genome as the template, the amplification speed can be calculated by 1kb/60sec ]

(3) Submit the PCR product to a sequencing company for next-generation sequencing.

(4) Combined with the results of next-generation sequencing, the online platform TIDE (https://tide.deskgen.com/) was used to calculate the editing efficiency.

Next-Generation Sequencing Detects Gene Editing Efficiency

1. For the impure and mutant samples in the first-generation sequencing results, the second-generation sequencing method is used to accurately identify the type of edited gene. The specific method is as follows: use the primer-BLAST on the NCBI website to separate 100bp upstream and downstream of the editing site. A pair of TIDE primers were designed at nearby positions, named TIDE F1 and TIDE R1 respectively, and the primer binding sequences for next-generation sequencing PCR amplification were added to the 5' ends of the primers. The sequences are as follows. Synthesize.

TIDE F1 added sequence: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3';

TIDE R1 added sequence: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'.

2. Use TIDE F primer and TIDE R primer to carry out the first round of amplification to the embryo genome according to the reaction system in Table 13, and use the first round product as the substrate for the second round of PCR amplification, according to the reaction in the following table The system was subjected to PCR amplification.

Table 14: Second-round PCR system for gene editing result detection by next-generation sequencing

成分Element	用量(单位：μL)Dosage (unit: μL)
2X PCR mix2X PCR mix	55

TIDE F1(10μM)TIDE F1(10μM)	0.050.05
TIDE R1(10μM)TIDE R1(10μM)	0.050.05
barcode i5 F(10uM)barcode i5 F(10uM)	0.50.5
barcode i7 R(10uM)barcode i7 R(10uM)	0.50.5
第一轮PCR产物First round PCR product	11
H2OH2O	2.92.9

The sequences of barcode i5 F and barcode i7 R are as follows, NNNNNNNN is the sequence barcode used to label the next-generation sequencing samples, and N is a random base:

barcode i5 F:

5’-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTC-3’

barcode i7 R:

5'-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG-3'.

3. After the PCR reaction is completed, the sample is added to a 1% agarose gel for electrophoresis, and the electrophoresis condition is 130V for 20min. After the electricity is completed, the PCR target band (calculated according to the band generated by the PCR primers designed by NCBI) is Size, usually about 300bp), cut it out, use the gel recovery kit of Novizan to recover and purify the PCR product, and send the purified product to the next-generation sequencing company for sequencing.

4. The returned sequencing results are analyzed using the software CRISPResso to determine the type of genomic mutation. For the specific analysis process, please refer to the software instructions.

Experimental conclusion: In this example, simultaneous editing of eight sites can be achieved.

Example 2

In this example, unless otherwise specified, the method of Example 1 was followed.

1. Optimization of transparent belt processing time

The inventors tested the time to treat the zona pellucida in an acidic benchtop solution. It was found that the zona pellucida treatment scheme was placed in the acidic benchtop solution for 5s, and the total transfer time was 10s. Under this condition, the inventors edited the Emx1 gene by electrotransfection, and the percentage of blastocysts obtained by electrotransfection after the Emx1 gene was edited was the highest, reaching 96%. The results are shown in Table 15.

Table 15: Effects of zona pellucida treatment on blastocyst development rate and editing efficiency in mouse embryos

2. The proportion of foreign genes is optimized

The gene editing efficiency of Cas9/sgRNA mixture with different concentration ratios will be different. The inventors have tested this and found that high concentration of Cas9/sgRNA can achieve higher editing efficiency, but considering the possible off-target caused by high concentration of Cas9/sgRNA The inventors reduced the Cas9/sgRNA concentration and achieved 100% gene editing efficiency when the Cas9/sgRNA concentrations were 0.4ug/µl and 0.1ug/µl respectively; when the concentration was further reduced, the gene editing efficiency was significantly reduce. The results are shown in Table 16.

Table 16: Results of gene editing efficiency of Cas9/sgRNA mixture with different concentration ratios

When performing multi-gene editing, the inventors also tested the multi-gene editing efficiency of different concentration ratios of Cas9/sgRNA. According to the concentration of Cas9/sgRNA obtained by single gene editing, the inventors started the test from the total Cas9/sgRNA concentration of 0.4ug/microliter and 0.1ug/microliter respectively, and increased the concentration of Cas9 and sgRNA respectively. The inventors edited 5 genes as a test, and finally found that the multi-gene editing efficiency was the highest when the sgRNA concentration corresponding to each gene was 0.1ug/microliter and the Cas9 concentration was four times the total sgRNA concentration.

Table 17: 5 Gene Editing Efficiency Results

3. Optimization of transfection timing

When optimizing HDR efficiency, the inventors found that the proportion of heterozygous HDR was high, but homozygous HDR embryos could not be obtained. The inventors optimized the concentration of Cas9/sgRNA/ssODN, the length of ssODN, the parameters of electrotransfection, etc., but no homozygous HDR embryos were obtained. Guessing that it may be the cause of the cell cycle, the inventors tested the time of electrotransfection and found that electrotransfection before S phase can significantly increase the proportion of homozygous HDR. The results are shown in the table below.

Table 18: Effect of electrotransfection time on the proportion of homozygous HDR mutants

4. Optimization of electrotransfection parameters

Before optimizing the electrotransfection parameters, the inventors have optimized the Cas9/sgRNA concentration and found that the sgRNA concentration corresponding to each gene is 0.1ug/μl, and the multi-gene editing efficiency is higher when the Cas9 concentration is four times the total sgRNA concentration. Highest. On this basis, the inventors further optimized the parameters of electrotransfection. The inventor first increased the voltage and found that the embryo blastocyst development rate was significantly reduced under the high voltage condition. Therefore, the inventors kept the voltage unchanged, optimized the number of pulses, and found that the highest multi-gene editing efficiency could be obtained at 8 pulses. The parameter results are shown in the table below.

Table 19: Electrotransfection parameters

电转染仪Electrotransfection	BTX Gemini2电转染仪BTX Gemini2 Electrotransfection Instrument
电转染条件Electrotransfection conditions	电转染参数Electrotransfection parameters
电压(Voltage)Voltage	30V30V
脉冲次数(Pulses)Pulses (Pulses)	88
脉冲长度(Pulses length)Pulses length	3ms3ms
脉冲间隔(Pulse interval)Pulse interval	100ms100ms

5. Identification of mutation types in mice born after reimplantation of edited embryos

The invention establishes a mature and efficient embryo electric transfection gene editing technology, and also establishes a method for efficiently obtaining and obtaining gene mutant mice. We replanted the mutant fertilized egg cells obtained by this technology into the female mice, and let the mutant fertilized egg cells go through the normal embryonic development cycle until the mouse was born. About 2 weeks after the mice were born, the toes of the mice were clipped and placed in 20ul QuickExtract, and the mouse genome was extracted and the mutation type of the newborn mice was identified using the steps described in Example 1.

The identification results of mutation types of mutant mice born after the reimplantation of Emx1, Zswim3, Tyr and lethal gene Foxg1 mutant fertilized egg cells constructed by the present invention are as follows. It is identified that all the mice obtained by the present invention have undergone gene editing at the corresponding sites, and the editing efficiency is 100%. In addition, using the Foxg1 mutant fertilized egg obtained by the present invention, the replanted mice after birth are all mutants of single deletion lethal gene, and the efficiency is as high as 100%. Therefore, the present invention can greatly improve the efficiency of obtaining mutants of single deletion lethal gene, and effectively promote the biological function research of lethal gene in animals. Except for lethal genes, the other gene-edited mutant zygotes developed into mice with a higher proportion of homozygous HDR mutations, all higher than 30%.

Table 20: Types of Mutant Mutants Born After Mutant Fertilized Oocyte Reimplantation

Note: KI mutants are mutants containing HDR mutants.

To sum up, the method of this embodiment can realize gene editing by electrotransfection of mouse embryos, and its advantage lies in at least one of the following:

(1) High-throughput, 400 embryos can be edited simultaneously per electrotransfection experiment.

(2) High efficiency, the single-site gene editing efficiency is higher than 90%.

(3) The proportion of homozygous HDR mutants was high, and the proportion of homozygous HDR mutants was higher than 14%.

(4) Multi-gene editing can be realized at the same time. The efficiency of editing 8 genes at the same time has been calculated. The efficiency of gene editing at least 6 loci in the same embryo is 100%, and the efficiency of all 8 genes at the same time is higher than 30%.

(5) The acquisition efficiency of high HDR mutant mice, single-site gene editing, the acquisition efficiency of HDR mutant mice is higher than 55.6%, and the acquisition efficiency of homozygous HDR mutant mice is higher than 30%. Among them, the efficiency of obtaining mutant mice with single deletion lethal gene is as high as 100%.

In the description of the present invention, "a plurality" or "at least one" means two or more, unless otherwise expressly and specifically defined.

In the description of this specification, description with reference to the terms "one embodiment," "some embodiments," "example," "specific example," or "some examples", etc., mean specific features described in connection with the embodiment or example , structure, material or feature is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, those skilled in the art may combine and combine the different embodiments or examples described in this specification, as well as the features of the different embodiments or examples, without conflicting each other.

Although the embodiments of the present invention have been shown and described above, it should be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present invention. Embodiments are subject to variations, modifications, substitutions and variations.

Claims

A method for electrotransfection gene editing of animal fertilized eggs, characterized in that it comprises:

(1) Select animal fertilized eggs before S stage to weaken the zona pellucida;

(2) After mixing the exogenous substance with the zygote weakened by the zona pellucida, electroporation transfection is performed, wherein the exogenous substance includes Cas9 protein and sgRNA.
The method of claim 1, wherein the animal is a mammal.
The method of claim 1, wherein the animals comprise rodents, dogs, cats, rabbits, and monkeys.
The method of claim 3, wherein the animals comprise mice and rats.
The method of claim 1, wherein the fertilized egg of the animal is in the G1 phase.
The method of claim 1, wherein the electroporation transfection process is completed within 10 hours after fertilization.
The method according to claim 1, wherein the zona pellucida weakening treatment is performed by contacting the fertilized egg cells of the animal with a table solution for 0 to 40 seconds.
8. The method of claim 7, wherein the zona pellucida weakening treatment is performed by contacting the fertilized egg cells of the animal with a bench top solution for 5 seconds.
The method according to claim 1, wherein the amount of the Cas9 protein in the exogenous material is 2-6 times the amount of the sgRNA by weight.
The method according to claim 1, wherein the amount of the Cas9 protein in the exogenous material is 4 times the amount of the sgRNA by weight.
The method of claim 1, wherein the exogenous substance comprises:

at least one sgRNA, the at least one sgRNA is directed against different targets; and

At least one ssODN corresponding to the sgRNA, the sequence of the ssODN is determined based on a predetermined length on both sides of the target.
The method of claim 11, wherein the exogenous substance comprises 2-12 sgRNAs.
The method according to claim 11, wherein, based on 10 microliters of electrotransfection premix, the dosage of each sgRNA is 1 microgram, and the dosage of the Cas9 protein is 2-2 to the total amount of the at least one sgRNA. 6 times.
The method according to claim 13, characterized in that, based on 10 microliters of electrotransfection premix, the dosage of the Cas9 protein is not more than 20 micrograms, preferably not more than 16 micrograms.
The method according to claim 1, wherein the electroporation transfection treatment adopts 5-10 pulses.
The method according to claim 1, wherein the electroporation transfection treatment adopts 8 pulses.
A method for constructing mutant fertilized egg cells, comprising:

(1) To weaken the zona pellucida of animal fertilized eggs before S phase;

(2) After mixing the exogenous material with the zygote of the animal weakened by the zona pellucida treatment, electroporation transfection is carried out, wherein the exogenous material includes Cas9 protein and at least one sgRNA, and the Cas9 protein is based on weight. The weight ratio to the at least one sgRNA is 2-6:1.
The method of claim 17, wherein the weight ratio of the Cas9 protein to the at least one sgRNA is 4:1.
A method for constructing a mutant fertilized egg cell, wherein the mutant fertilized egg cell is a homozygous HDR fertilized egg cell, wherein the method comprises:

(1) The zona pellucida weakening treatment is performed on the fertilized eggs of animals before the S phase;

(2) after mixing the exogenous material with the animal fertilized egg weakened by the zona pellucida, electroporation transfection is performed to obtain the transfected fertilized egg cell, wherein the exogenous material includes Cas9 protein, at least one sgRNA and at least one ssODN corresponding to said sgRNA, wherein, on a weight basis, the weight ratio of said Cas9 protein to said at least one sgRNA is 2-6:1; and

(3) selecting the homozygous HDR fertilized ovum from the transfected fertilized ovum,

Optionally, the weight ratio of the Cas9 protein to the at least one sgRNA is 4:1;

Optionally, the exogenous material includes:

1-2 sgRNAs; and

1-2 kinds of ssODN corresponding to the sgRNA.
A method for constructing a mutant fertilized egg cell, wherein the mutant fertilized egg cell is a single-deletion fertilized egg cell of a lethal gene, wherein the method comprises the following steps:

(1) To weaken the zona pellucida of animal fertilized eggs before S phase;

(2) after mixing the exogenous material with the animal fertilized egg weakened by the zona pellucida, electroporation transfection is performed to obtain the transfected fertilized egg cell, wherein the exogenous material includes Cas9 protein, at least one sgRNA and at least one ssODN corresponding to said sgRNA, wherein, on a weight basis, the weight ratio of said Cas9 protein to said at least one sgRNA is 2-6:1; and

(3) selecting the lethal gene single deletion fertilized ovum from the transfected fertilized ovum,

wherein, the at least one sgRNA and the ssODN are determined based on lethal genes;

Optionally, the weight ratio of the Cas9 protein to the at least one sgRNA is 4:1;

Optionally, the exogenous material includes:

1-2 sgRNAs; and

1-2 kinds of ssODN corresponding to the sgRNA.
A method for constructing a mutant animal, comprising:

(a) constructing mutant fertilized egg cells according to the method of any one of claims 17 to 20; and

(b) growing the mutant fertilized egg cells to obtain the mutant animal.
A method of constructing an animal model, characterized in that,

(i) identifying sgRNAs and optional ssODNs associated with disease-associated genes based on a predetermined disease type;

(ii) using the sgRNA and the Cas9 protein to construct an animal model according to the method of claim 21 .
Use of a mutant animal or an animal model for screening drugs, the mutant animal is constructed according to the method of claim 21 , and the animal model is constructed according to the method of claim 22 .
A method for weakening the zona pellucida of animal fertilized eggs, characterized in that it comprises:

The zygote of the animal before the S phase is subjected to the weakening treatment of the zona pellucida, and the weakening treatment of the zona pellucida is carried out by contacting the fertilized egg cells of the animal with the table solution for 0 to 40 seconds.
The method according to claim 24, wherein the zygote of the animal in the G1 stage is subjected to a zona weakening treatment by contacting the fertilized egg cells of the animal with a table solution for 5 seconds .