CN117363649A

CN117363649A - Gene integration method and application

Info

Publication number: CN117363649A
Application number: CN202210802463.4A
Authority: CN
Inventors: 刘真; 孙强; 陈红玉; 刘星辰; 陆宗阳
Original assignee: Center for Excellence in Brain Science and Intelligence Technology Chinese Academy of Sciences
Current assignee: Center for Excellence in Brain Science and Intelligence Technology Chinese Academy of Sciences
Priority date: 2022-07-07
Filing date: 2022-07-07
Publication date: 2024-01-09

Abstract

The invention provides a high-efficiency gene integration method based on MMEJ inhibition and application thereof. In particular, the invention provides the use of a Polq inhibitor for the preparation of a composition or formulation for down-regulating MMEJ, promoting HDR, promoting gene editing of CRISPR/Cas 9. The present inventors achieved a significant improvement in targeting knock-in efficiency with linearized DNA fragments and single stranded oligonucleotides (ssODN) as homologous templates in mouse embryos and offspring, and this approach did not add additional off-target effects. In addition, the inventors found that this CasRX-assisted targeted integration (CATI) approach also significantly improved CRISPR/Cas 9-mediated HDR efficiency in monkey embryos. CATI is a promising approach for animal model construction and gene therapy development in the biomedical field.

Description

Gene integration method and application

Technical Field

The invention relates to the fields of biology and medicine, in particular to a high-efficiency gene integration method based on MMEJ inhibition and application thereof.

Background

Genome editing using the CRISPR/Cas9 system relies on repair of DNA Double Strand Breaks (DSBs) induced by the sgRNA-guided Cas9 endonuclease (barrengou and Doudna,2016; komor et al, 2017). Homology-mediated repair (HDR) of DNA double strand breaks enables precise integration of the genome of the donor DNA, introducing genomic changes, including sequence substitutions, insertions and deletions (Barrangou and Doudna,2016; komor et al, 2017). Thus, HDR has been widely used to generate genetically modified animal models and germ cell gene correction by synthon injection of CRISPR/Cas9 reagent and exogenous DNA donor with homology arms (midi et al, 2017; wang et al, 2013; yang et al, 2013;Yin et al,2014). However, the overall efficiency of precise DNA integration by HDR is quite low due to competition for other repair pathways such as non-homologous end joining (NHEJ) (Stinson et al 2020), micro-homologous mediated end joining (MMEJ) (McVey and Lee, 2008) and Single Strand Annealing (SSA) (Scully et al 2019). Thus, blocking other repair pathways has become a common strategy for improving HDR.

Inhibition of the NHEJ repair pathway has previously been used to increase HDR efficiency (Chu et al 2015;Maruyama et al, 2015), but this strategy was found ineffective in several studies (Fu et al 2021b; song et al 2016). Recent studies have shown that MMEJ is an important DSB repair pathway, possibly working in concert with other repair pathways, or acting alone in some specific types of DNA damage (Truong et al, 2013). Furthermore, both MMEJ and HDR require DNA end excision, possibly directly competing with each other (Ceccaldi et al, 2015; mateos-Gomez et al, 2017).

Disclosure of Invention

The object of the present invention is to provide a highly efficient gene integration method based on MMEJ suppression in rodent and primate embryos.

In a first aspect of the invention there is provided the use of a Polq (micro homology mediated end linked mmoej key factor polymerase Q) inhibitor for the preparation of a composition or formulation for:

(a) During gene editing, MMEJ is down-regulated;

(b) During gene editing, HDR (homology-mediated repair) is facilitated;

(c) In the process of gene editing, the integration efficiency of exogenous genes is improved;

(d) In the gene editing process, promoting gene editing of CRISPR/Cas 9; and/or

(e) Promoting cellular gene therapy and/or gene correction.

In another preferred embodiment, the gene editing is CRISPR/Cas9 based gene editing.

In another preferred embodiment, the gene editing comprises gene editing of embryonic cells.

In another preferred embodiment, the gene editing comprises gene editing of embryonic cells at 2-cell stage and/or 4-cell stage and/or 8-cell stage.

In another preferred embodiment, the composition comprises a pharmaceutical composition.

In another preferred embodiment, the formulation comprises an experimental reagent.

In another preferred embodiment, the gene editing that promotes CRISPR/Cas9 is selected from the group consisting of:

(P1) increasing gene editing efficiency of CRISPR/Cas 9;

(P2) improving HDR efficiency;

(P3) increased efficiency of ssODN (single stranded oligonucleotide) -mediated nucleotide substitution;

(P4) does not increase off-target effects; and/or

(P5) no additional mutations were introduced.

In another preferred embodiment, the "off-target rate" refers to T _off /(T _on +T _off ) Ratio of T _on For the editing rate of the targeted site (i.e. under the guidance of gRNAEditing rate of occurrence of predetermined target point position), T _off Is the editing rate of the non-targeted point (i.e., the off-target editing efficiency of the base editor in the non-targeted position).

In another preferred embodiment, the "facilitating gene editing of CRISPR/Cas 9" comprises: while improving CRISPR/Cas9 target editing efficiency, no or substantially no off-target editing rate increase results.

In another preferred embodiment, the "facilitating gene editing of CRISPR/Cas 9" comprises: the gene editing efficiency is improved.

In another preferred embodiment, the CRISPR/Cas9 gene editor is selected from the group consisting of: spCas9 derived from Streptococcus pyogenes and its extended PAM recognition sequence mutants (SpCas 9-VQR, -VRQR, -VRER, -NG and SpRY), and its high fidelity mutants SpCas9-HF and eSpCas9; saCas9 from Staphylococcus aureus and mutants thereof SaCas9-KKH; cas12a, including AsCpf1, lbCpf1 and FnCpf1.

In another preferred embodiment, the CRISPR/Cas9 gene editor comprises different mutants.

In another preferred embodiment, the gene editing comprises in vivo gene editing, in vitro gene editing, or a combination thereof.

In another preferred embodiment, the sample for which the gene is compiled is selected from the group consisting of: cells, tissues, organs, or combinations thereof.

In another preferred embodiment, the sample is from an animal.

In another preferred embodiment, the sample is from a human or non-human mammal.

In another preferred embodiment, the cells include primary cells and passaged cells.

In another preferred embodiment, the cells include somatic cells, germ cells, gametes, stem cells.

In another preferred embodiment, the stem cell comprises: totipotent stem cells, pluripotent stem cells, and monopotent stem cells.

In another preferred embodiment, the stem cells are induced pluripotent stem cells (ipscs).

In another preferred embodiment, the cell comprises: suspension cells, adherent cells.

In another preferred embodiment, the Polq inhibitor is selected from the group consisting of: a small molecule, an antibody, a polypeptide, an oligonucleotide, an aptamer, a gene editing agent, or a combination thereof.

In another preferred embodiment, the Polq inhibitor is selected from the group consisting of: shRNA, interference RNA, siRNA, microRNA, or a combination thereof.

In another preferred embodiment, the Polq inhibitor is the RNA editor CasRX that down-regulates expression of Polq.

In a second aspect of the invention, there is provided a method of CRISPR/Cas9 gene editing, the method comprising:

gene editing is performed on cells in the presence of a Polq inhibitor, thereby promoting gene editing within the cells.

In another preferred embodiment, the method comprises an in vivo and/or in vitro method.

In another preferred embodiment, the Polq inhibitor is contacted with the cells subjected to gene editing before, during and/or after the gene editing is performed.

In another preferred embodiment, the in vitro gene editing is performed in an in vitro reaction system.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

In another preferred embodiment, the formulation comprises a pharmaceutical composition.

In a third aspect of the invention, there is provided a method of CRISPR/Cas9 gene editing in vitro, the method comprising:

gene editing is performed on cells to be edited in vitro in the presence of a Polq inhibitor, thereby facilitating gene editing within the cells.

In another preferred embodiment, the cell is selected from the group consisting of: embryonic cells, stem cells, or a combination thereof.

In another preferred embodiment, the embryonic cells are embryonic cells at the 2-cell stage and/or 4-cell stage and/or 8-cell stage.

In a fourth aspect of the invention, there is provided a reagent product (or reagent combination) comprising:

(i) A first agent which is a Polq inhibitor; and

(ii) And a second reagent, wherein the second reagent is a reagent for CRISPR/Cas9 gene editing.

In another preferred embodiment, the second agent comprises one or more agents selected from the group consisting of:

(c1) A CRISPR/Cas9 editor, a coding sequence of a CRISPR/Cas9 editor, or a vector expressing a CRISPR/Cas9 editor, or a combination;

(c2) A gRNA, crRNA, or a vector for producing the gRNA or crRNA;

In another preferred embodiment, the gene editing is directed against a pathogenic gene, a tumor-associated gene (e.g., an oncogene), an immune-associated gene (e.g., a gene associated with autoimmunity, or a gene associated with immunotherapy), a vision-associated gene, an auditory-associated gene, a tumor-associated gene, a brain development-associated gene, a reproductive-associated gene, a liver disease-associated gene, a kidney disease, a pancreatic disease-associated gene, a bone disease-associated gene, a neurological disease-associated gene, a glial disease-associated gene, a muscle disease-associated gene, a blood disease-associated gene, an organ development-associated gene, a lesion repair, a metabolic-associated gene, a viral infection-associated gene, a genetic disease, an aging-associated gene.

In another preferred embodiment, the gene is selected from the group consisting of: ACTB, MECP2, STXBP1, DMD, SCN1A, etc., or combinations thereof.

In a fifth aspect of the invention, there is provided a kit comprising:

(i) A first container, and a first reagent in the first container, the first reagent being a Polq inhibitor; and

(ii) A second container, and a second reagent within the second container, the second reagent being a reagent that performs CRISPR/Cas9 gene editing.

In another preferred embodiment, the kit further comprises instructions.

In another preferred embodiment, the description describes the method for promoting gene editing according to the present invention.

In another preferred example, the gene editing is gene editing for somatic cells and stem cells.

In a sixth aspect of the present invention, there is provided a reaction system for improving gene editing efficiency, comprising:

(i) A DNA target sequence to be edited;

(ii) CRISPR/Cas9 gene editor;

(iii) A Polq inhibitor;

(iv) A gRNA, crRNA, or a vector for producing the gRNA or crRNA; and

(v) Exogenous gene expression cassettes to be integrated.

In a seventh aspect of the invention, there is provided a method of screening for potential agonists for CRISPR/Cas9 gene editing of embryonic cells comprising the steps of:

(a) Providing a compound to be tested;

(b) Culturing cells in the test group in the presence of the test compound and determining the Polq expression level or activity E1, and culturing cells in the control group in the absence of the test compound and determining the Polq expression level or activity E0, wherein the control group and the test group are identical under the same conditions except for the test compound;

wherein if the expression level or activity E1 is significantly lower than the expression level or activity E0, the compound is suggested to be a potential agonist of the CRISPR/Cas9 gene editor.

In another preferred embodiment, the method further comprises:

(c) The CRISPR/Cas9 gene editor was further tested for potential agonists, in cell or animal models, for the presence or absence of an promoting effect on CRISPR/Cas9 gene editing.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. Is limited to a space and will not be described in detail herein.

Drawings

Figure 1 shows DSB repair pattern analysis in CRISPR/Cas9 edited embryos.

(A) Schematic analysis of DSB repair patterns in CRISPR/Cas9 mediated embryo gene editing.

(B) The editing efficiency of the tested sgrnas was summarized. Blue represents the editing efficiency of insertions and deletions. Green represents the overall editing efficiency.

(C) Displaying a pattern of repair of sgrnas. Its repair is mediated primarily by MMEJ. The targeting sequence and the wild-type sequence are shown at the top of the table. The microhomologous sequences are underlined. PAM (NGG) is marked in bold. Deletions and insertions are indicated in red.

(D) sgRNA editing efficiency versus NHEJ/MMEJ ratio. Red and blue circles indicate NHEJ/MMEJ ratios greater or less than 1. Each circle represents one sgRNA.

(E) RNA-seq (left) and RT-PCR (right) show the expression of three genes representative of lesion repair. Orange indicates Cas9/sgRNA (scramble) group, control group; gray represents Cas9/sgRNA group; blue represents Cas9/sgRNA/donor DNA set.

(F) RT-PCR analysis shows that CasRX can significantly knock down the expression of Rad52, ku70 and Polq genes in embryos.

Fig. 2 shows that Polq down-regulation promotes HDR efficiency.

(A) Representative pictures show the knock-in efficiency of the Actb gene (left) and Gata6 gene (right). The number of mCherry positive blastula indicates the efficiency of the knockin. Genes in the control group were not knocked down; rad52 KD, ku70 KD, polq KD and Rad52/Ku70/Polq KD indicate that the Rad52 gene knockdown, the Ku70 gene knockdown, the Polq gene knockdown and the three genes are knockdown simultaneously. Scale bar 100 μm.

(B) Representative pictures demonstrate the knock-in effect of the CATI method on mCherry knock-in among 9 genes. n=blastocyst number. Scale bar 100 μm.

(C) CATI method was used for analysis of 11 gene knock-in efficiencies in mouse embryos. A total of 33 experimental data sets were used for analysis.

(D) Control and CATI methods were effective in Cre or LoxP knock-in mice (left) and birth rate of mice (right).

Fig. 3 shows that the CATI approach is generic in terms of improving HDR efficiency.

(A) Demonstration of HDR repair modes and methods tested in the present invention.

(B) Seven methods to increase the efficiency of the knock-in of the Actb site (left) and the Dppa3 site (right). The Tild method served as a control. TCTS means addition of truncated sgRNA sequences recognizable by Cas9 on both sides of the homologous template; biotin means that additional Biotin is added to the 5-end of the DNA template; TSA means increasing TSA treatment (triclosastatin a, HDAC inhibitor) in the medium; cas9-CtIP represents a strategy for fusion of Cas9 protein with a CtIP domain; rad51 OE indicated Rad51 protein overexpression strategy; 2-cell injection refers to a strategy of injecting reagents at the 2-cell stage.

(C) The HITI approach fails to improve the knock-in efficiency of Actb and Gata6 sites.

(D) The DDRNA-based approach failed to improve the knock-in efficiency of the Actb and h3.3b loci.

(E) Demonstration of the efficiency of knock-in of the multiple sgRNA strategy at the Actb, gata6, cdx2 and H3.3 sites.

(F) CATI+2C strategy was used for representative picture presentation of the Actb and Dppa3 gene knockins. Scale bar 100 μm.

(G) And (3) analyzing the synergistic effect of the CATI method and the 2-cell injection method on improving the HDR efficiency of the mouse embryo.

(H) CATI improves the knock-in efficiency of CDX2 sites. Left, representative pictures show mCherry positive embryos. The right panel shows the summary of CDX2 site experiment results. Scale bar 100 μm.

(I) CATI improves the knock-in efficiency of the H3.3B site. Left, representative pictures show mCherry positive embryos. The right panel shows the summary of the results of the H3.3B site experiment. Scale bar 100 μm.

FIG. 4 shows that CATI can improve nucleotide substitution efficiency.

(A) Experimental flow chart. After ssODN mediated EcoRI site integration, the inventors performed cleavage site analysis and Sanger sequencing experiments. Lightning represents CRISPR/Cas9 mediated DSB; blue lines indicate EcoRI sites.

(B) The knock-in efficiency at Oct4 and Ctcf sites was achieved using the control method and CATI method.

(C) Restriction enzyme site analysis showed that CATI improved the efficiency of HDR. Gel images (left) and quantitative analysis (right) show that CATI methods are more efficient at Oct4 and Ctcf sites.

(D) Positive rates of mice carrying G93A and A4V mutations can be simulated using control and CATI methods construction.

(E) Mutation efficiency of each positive mouse carrying the Sod1 gene G93A and A4V mutations.

(F) The proportion of Indel and mmoej events in the gene tested.

FIG. 5 shows the editing efficiency in embryo, NHEJ/MMEJ ratio, DNA repair related gene expression and knockdown method test, related to FIG. 1

(A) Editing efficiency and NHEJ/MMEJ ratio of mouse embryos. Orange bars represent editing efficiency of individual sgrnas. The respective values of editing efficiency and NHEJ/MMEJ ratio for each sgRNA are listed in the following boxes.

(B) Principal component analysis of three sets of sample transcriptomes. The samples within the same group are looped together.

(C) Volcanic diagrams show differentially expressed genes. Genes that were up-and down-regulated are indicated on the figure.

(D) Expression of three groups of DNA repair related genes analyzed. DNA repair pathways include HR, NHEJ, SSA and MMEJ.

(E) RT-PCR results of siRNA strategy in gene suppression.

(F) Quantitative analysis of siRNA mediated gene suppression. Polq prime-1 and prime-2 represent two different pairs of primers used in the assay.

(G) RT-PCR analysis of the CasRX strategy to suppress embryo endogenous Gene expression. For each gene, the inventors tested 5 or 6 samples, each containing 5 embryos. Samples without specific bands indicated that the relevant genes were successfully down-regulated.

FIG. 6 shows an integrated analysis of the Cre knock-in of the Lypd1 and Calcr loci, in relation to FIG. 2

(A) Strategy schematic for generating Lypd1-Cre, calcr-Cre and Mllt3-loxp-Exon3-loxp knock-in alleles. The sgRNA targeting sites are highlighted in cyan, followed by yellow PAM. Stop codons are highlighted in red. Primers for genotyping and probes for Southern blotting were labeled.

(B) Genotyping analysis of three knock-in lines at F1 generation.

(C) Sanger sequencing was performed at the knock-in ligation sites of 3 different rows.

(D) The Lypd1 and Calcr loci were integrated exactly by Southern blot analysis. The red rectangle indicates the desired southern band.

(E) Cre protein expression was detected by western blotting in hippocampal (Hip), prefrontal cortex (PFC) and cerebellum (cel) tissues of Lypd1-Cre mice.

FIG. 7 shows a 2-cell injection strategy test in mouse and monkey embryos, related to FIG. 3

(A) 2 cell injection strategies combined with them with the HDR efficiencies at the Actb and Dppa3 loci, respectively, of Polq knockdown, rad52 knockdown, or Ku70 knockdown.

(B) Description of fertilized egg, 2 cell and 4 cell injection strategy in monkey embryo.

(C) Efficiency of the synthon, 2 cell and 4 cell injection methods was compared at the CDX2 locus knock-in. Left: representative images show mcherry positive embryos. Right figure: knock-in efficiency comparison for different injection phases. Scale bar, 100 μm.

FIG. 8 shows the use of CATI in monkey CDKL 5-site nucleotide substitution and GOTI experiments for off-target analysis, related to FIG. 4

(A) Schematic representation of monkey CDKL5 locus for nucleotide substitutions. The substituted nucleotides are shown in red. BE. ABE, GBE cannot be used for G-to-a mutations.

(B) The positive rate of monkey embryo R178Q mutation was compiled using basal and CATI strategies.

(C) The proportion of HDR and MMEJ events for monkey embryos edited at the CDKL5 locus.

(D) Goli experimental workflow for off-target analysis.

(E) Targeting efficiency of RPF-positive and GFP-positive cells based on Sanger sequencing to control and CATI groups.

(F) Targeting efficiency of WGS-based RPF-positive and GFP-positive cells in control and CATI groups.

(G) Comparison of total number of de novo SNPs detected in control and CATI groups. ns indicates no significant difference.

(H) Comparison of the total number of new indels detected in the control and CATI groups. ns indicates no significant difference.

(I) Mutation type distribution in control and CATI groups. The numbers in each cell represent the proportion of a mutation in all mutations. Ctrl-1 and Ctrl-2 represent two independent samples of the control group. CATI-1 and CATI-2 represent two independent samples of the CATI group.

Detailed Description

Through extensive and intensive studies, the inventors of the present invention have unexpectedly found for the first time that inhibiting expression of Polq, by modulating the MMEJ repair-related protein, promoting the CRISPR/Cas9 editing process, the integration efficiency of embryonic cell gene editing can be significantly improved. On this basis, the present invention has been completed.

Specifically, in the present invention, the present inventors first examined DNA repair pathways and gene expression associated with DNA repair during the editing of mouse embryo CRISPR/Cas 9. The inventors found that MMEJ is the primary form of nuclease-mediated DSB repair. Furthermore, the inventors found that expression of the DNA polymerase Polq was up-regulated during CRISPR/Cas9 mouse embryo editing, whereas Polq is known to promote the MMEJ pathway of DSB repair (Brambati et al 2020). The inventors then found that the efficiency of HDR-mediated DNA integration in mouse embryos can be greatly improved by RNA editing CasRX to reduce expression of Polq. Importantly, this CasRX-assisted targeted integration (CATI) approach can also improve the HDR efficiency of monkey embryos. Thus, the CATI method can be used to develop gene editing monkey models and human germ cell gene therapies.

CRISPR/Cas9 base editing

CRISPR/Cas9 is an adaptive immune defense that bacteria and archaea form during long-term evolution can use against invasive viruses and foreign DNA. CRISPR/Cas9 systems provide immunity by integrating fragments of invading phage and plasmid DNA into CRISPR and utilizing corresponding CRISPR RNAs (such as gRNAs) to direct degradation of homologous sequences.

The principle of operation of this system is that crRNA (CRISPR-extended RNA) binds to the tracrRNA (trans-activating RNA) by base pairing to form a tracrRNA/crRNA complex that directs the nuclease Cas9 protein to cleave double-stranded DNA at the sequence target site paired with the crRNA. By manually designing the two RNAs, a guide-acting gRNA (single-guide RNA) can be engineered to be sufficient to guide the site-directed cleavage of DNA by Cas 9.

As an RNA-guided dsDNA binding protein, cas9 effector nucleases are the first known unifying factor (unifying factor) capable of co-localizing RNA, DNA and proteins. Fusing the protein to Cas9 without nuclease (Cas 9 nucleic-null) and expressing the appropriate gRNA, any dsDNA sequence can be targeted, while the ends of the gRNA can be linked to the target DNA without affecting Cas9 binding. Thus, cas9 can bring about any fusion protein and RNA at any dsDNA sequence. This technique is known as CRISPR/Cas9 gene editing system.

MMEJ and Polq

Micro-homology mediated end ligation (MMEJ), also known as selective non-homologous end ligation (Alt-NHEJ), is a pathway that is normally active in the S and G2 phases of the cell cycle, with part occurring in the G0/G1 phase. Unlike classical NHEJ, MMEJ relies on homologous regions to repair broken lesions, and annealing reactions occur mainly using microhomologous fragments (2-25 bp) of the damaged region, rejoining the broken DNA. Repair of DSBs by MMEJ often results in deletion of micro-homologous fragments at junctions and even gene rearrangement, resulting in knockout of genes. Studies have shown that the MMEJ pathway exists in many types of cells, such as plants, bacteria, humans, and the like, and that the MMEJ pathway has also been used in studies of targeted insertion of exogenous donor DNA in mammalian cells, zebra fish, and frog embryos.

DNA polymerase θ (Polθ, also known as Polq) is one of 16 DNA polymerases in the human genome and is a core enzyme in the MMEJ repair pathway. Compared to other polymerases, pol θ is the only DNA polymerase containing a helicase-like domain at its N-terminus. Pol theta consists of three domains, comprising a C-terminal a-family DNA polymerase and an N-terminal superfamily 2 (SF 2) DNA helicase, separated by a long and less conserved central domain of unknown function. The RAD51 binding domain is located in the helicase and central domains. The N-terminal helicase domain exhibits DNA-dependent ATPase activity and comprises a conserved nucleotide binding site, a conserved DEAH box motif and a conserved helicase C-terminal domain.

Studies have been reported on the use of NHEJ and MMEJ to boost targeted knockins. Repair of DNA damage in embryos is a blind area of current research. Past studies have shown that the use of HDR, NHEJ and MMEJ methods to promote targeted knockin in cells has made it difficult to achieve stable and efficient results in embryos, suggesting that damage repair in our embryo may be different from cultured cells. Polq is the core of MMEJ repair, has the function of antagonizing the HDR core protein RAD51, is a star target newly reported in recent years, and is likely to play a role in the embryo damage repair process in the regulation of the Polq.

Formulations of the invention and uses thereof

The present invention provides a formulation for promoting CRISPR/Cas9 editor-mediated gene editing activity and/or specificity. Such formulations include (but are not limited to): pharmaceutical compositions, scientific research reagent compositions, and the like.

The preparation can assist a CRISPR/Cas9 base editor, and obviously improves the efficiency of gene editing, so that the preparation has revolutionary potential in different fields such as therapeutic application and the like.

The preparation of the invention can be used for improving the HDR efficiency, and further can be used for preventing or treating diseases related to pathogenic genes.

The invention also provides a method of promoting CRISPR/Cas 9-mediated gene editing using the compounds of the invention, which may be therapeutic or non-therapeutic. Generally, the method comprises the steps of: the compound of the invention is administered to a subject in need thereof before, during, after, or simultaneously with administration of the CRISPR/Cas9 editor.

Preferably, the subject includes humans and non-human mammals (rodents, rabbits, monkeys, domestic animals, dogs, cats, etc.).

In another preferred embodiment, the use is in vitro and/or non-therapeutic.

The main advantages of the invention include:

(a) The inhibitors of the invention can provide very high in-embryo knock-in efficiency.

(b) Strategies for transient knockout of Polq have low embryo damage.

(c) No obvious off-target effect exists.

(d) The indel level is reduced at the same time as the tap-in.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

General methods and materials

1. A mouse

Fertilized eggs were collected using B6D2F1 (C57 BL/6J. Times. DBA/2N) mice (3 or 8 weeks old). ICR female mice were used as surrogate rats. The use and care of animals accords with guidelines of the national academy of sciences and the excellent center of intelligent technology.

2. Monkey

The invention uses healthy female cynomolgus monkeys ((Macaca fascicularis) all animals are kept in sunny rooms with normal menstrual cycles the use and care of animals is in line with guidelines of the superior center of brain science and intelligence technology of the national academy of sciences, and the ethical application (ION-2019022) is approved.

3. Construction of linearization donors

Tild homology templates of the mouse Actb/Dppa5/Cfl1/H3.3b/Cdx2/H2afZ/Cdk4/Lmna/Dppa3/Gata6/Tubb5 gene and monkey Cdx2/H3.3b gene were constructed. The present inventors developed detailed descriptions using the mouse Actb gene as an example. The Tild homology template of the Actb gene (transgenic DNA sandwiched by homology arms of different lengths) was obtained by PCR amplification. The template for PCR contains (800 bp) the Actb-HR-vector of HAL-p2A-mCherry- (-800) HAR. The PCR product was then purified using a PCR extraction kit (Magen, D2121-03).

Constructing a mouse Calcr/Lyypd1 gene Tild homology template. The present inventors developed detailed descriptions using the mouse Calcr gene as an example. The Calcr-HR template vector containing (-800 bp) HAL-P2A-Cre- (-800) Har was amplified by PCR and the PCR product was purified as described above.

Tild donor of mouse Mllt3 gene was constructed. Mllt3-HR template vector containing (-800 bp) HAL-LoxP-exon3-LoxP- (-800) HAR was amplified by PCR and the PCR product was purified as described above.

4. Improved construction of linearization donors and ssODN donors

For biotin-modified linearized templates, amplified templates were synthesized with 5' -biotin-modified primers (GenScript). ssODN (GenScript) targeting the mouse Oct4/Ctcf/Sod1 gene was synthesized, with the addition of phosphorylation and phosphorothioate modifications at 5' during synthesis, and diluted to 1 μg/μl.

5. Preparation of Cas9/Cas9-msa/CasRX/Rad51 mRNA and sgRNA

The T7 promoter was added to the N-terminus of the Cas9/Cas9-msa/CasRX/Rad51 coding region by PCR amplification using the indicated primers (general methods and materials section 5.1). The purified T7-Cas9/Cas9-msa/CasRX/Rad51 PCR product was used as template for the mMESSAGE mMACHINE T ULTRA kit (Life Technologies) In Vitro Transcription (IVT). The T7 promoter was added to the sgRNA template by PCR amplification, primers see general methods and materials section 5.1. The purified T7-sgRNA PCR product was used as template for the IVT of the MEGA shortscript T7 kit (Life Technologies). mRNA and sgRNAs were purified using MEGA clear kit (Life Technologies) and eluted in RNase-free water.

5.1 oligonucleotides for use in the present invention

5.1.1 oligonucleotides (primer sequences (5 '-3')

Cas9-sgRNA-R (common reverse primer) (SEQ ID No. 1): TTGTGAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC

mouse-Actb-sg2(SEQ ID NO.2)：GAAATTAATACGACTCACTATAGGGCACCGCAAGTGCTTCTAGGGTTTTAGAGCTAGAAATAGC

mouse-Actb-sg3(SEQ ID NO.3)：GAAATTAATACGACTCACTATAGGAGTCCGCCTAGAAGCACTTGGTTTTAGAGCTAGAAATAGC

mouse-Actb-sg5(SEQ ID NO.4)：GAAATTAATACGACTCACTATAGGGAAGCACTTGCGGTGCACGAGTTTTAGAGCTAGAAATAGC

mouse-Actb-sg6(SEQ ID NO.5)：GAAATTAATACGACTCACTATAGGGCGGTGCACGATGGAGGGGCGTTTTAGAGCTAGAAATAGC

mouse-Actb-sg7(SEQ ID NO.6)：GAAATTAATACGACTCACTATAGGAAGCAGGAGTACGATGAGTCGTTTTAGAGCTAGAAATAGC

mouse-Actb-sg8(SEQ ID NO.7)：GAAATTAATACGACTCACTATAGGTGTCCACCTTCCAGCAGATGGTTTTAGAGCTAGAAATAGC

mouse-Calcr-sg1(SEQ ID NO.8)：GAAATTAATACGACTCACTATAGGGTCTTGCTGGATGACGTTCAGTTTTAGAGCTAGAAATAGC

mouse-Calcr-sg2(SEQ ID NO.9)：GAAATTAATACGACTCACTATAGGTTCAAGCGGATGCGTCTTGCGTTTTAGAGCTAGAAATAGC

mouse-Calcr-sg3(SEQ ID NO.10)：GAAATTAATACGACTCACTATAGGGGGGTGGCTTCACATTCAAGGTTTTAGAGCTAGAAATAGC

mouse-Calcr-sg4(SEQ ID NO.11)：GAAATTAATACGACTCACTATAGGGTGGATCACAATGCTTGGGGGTTTTAGAGCTAGAAATAGC

mouse-Calcr-sg5(SEQ ID NO.12)：GAAATTAATACGACTCACTATAGGTCCACTGAGCCTTCATTTCCGTTTTAGAGCTAGAAATAGC

mouse-Cck-sg1(SEQ ID NO.13)：GAAATTAATACGACTCACTATAGGACTACGAATACCCATCGTAGGTTTTAGAGCTAGAAATAGC

mouse-Cck-sg2(SEQ ID NO.14)：GAAATTAATACGACTCACTATAGGATCGTAGTGGGCCAGCGTCTGTTTTAGAGCTAGAAATAGC

mouse-Cck-sg3(SEQ ID NO.15)：GAAATTAATACGACTCACTATAGGAAGACGCTGGCCCACTACGAGTTTTAGAGCTAGAAATAGC

mouse-Cck-sg4(SEQ ID NO.16)：GAAATTAATACGACTCACTATAGGTCCAAGCAGGGCCAAGACGCGTTTTAGAGCTAGAAATAGC

mouse-Cdk4-sg1(SEQ ID NO.17)：GAAATTAATACGACTCACTATAGGAAGCGACGCAGAGTGAGAAGGTTTTAGAGCTAGAAATAGC

mouse-Cdk4-sg2(SEQ ID NO.18)：GAAATTAATACGACTCACTATAGGTTCTCCACCAAGACTGGGAAGTTTTAGAGCTAGAAATAGC

mouse-Cdk4-sg3(SEQ ID NO.19)：GAAATTAATACGACTCACTATAGGGCAGCACTCCTACCTGCACAGTTTTAGAGCTAGAAATAGC

mouse-Cdk4-sg4(SEQ ID NO.20)：GAAATTAATACGACTCACTATAGGGAGGGTTTCTCCACCAAGACGTTTTAGAGCTAGAAATAGC

mouse-Cdk4-sg5(SEQ ID NO.21)：GAAATTAATACGACTCACTATAGGTGGAGAAACCCTCGCTGAAGGTTTTAGAGCTAGAAATAGC

mouse-Cdx2-sg2(SEQ ID NO.22)：GAAATTAATACGACTCACTATAGGGGGTTCTGGGGCCAGCTGGAGTTTTAGAGCTAGAAATAGC

mouse-Cdx2-sg3(SEQ ID NO.23)：GAAATTAATACGACTCACTATAGGGAGGGGTCACTGGGTGACAGGTTTTAGAGCTAGAAATAGC

mouse-Cdx2-sg4(SEQ ID NO.24)：GAAATTAATACGACTCACTATAGGCCACGAACAGCATCTACTGAGTTTTAGAGCTAGAAATAGC

mouse-Cdx2-sg6(SEQ ID NO.25)：GAAATTAATACGACTCACTATAGGGGCGGCGGCACAGCAATCCCGTTTTAGAGCTAGAAATAGC

mouse-Cdx2-sg7(SEQ ID NO.26)：GAAATTAATACGACTCACTATAGGAGTGGAATTATGGACCTCAGGTTTTAGAGCTAGAAATAGC

mouse-Cfl1-sg1(SEQ ID NO.27)：GAAATTAATACGACTCACTATAGGGGGCTGGAGGTGGCTCACAAGTTTTAGAGCTAGAAATAGC

mouse-Cfl1-sg2(SEQ ID NO.28)：GAAATTAATACGACTCACTATAGGTCCAGGCAGGGGGCTGGAGGGTTTTAGAGCTAGAAATAGC

mouse-Cfl1-sg3(SEQ ID NO.29)：GAAATTAATACGACTCACTATAGGGCCACCTCCAGCCCCCTGCCGTTTTAGAGCTAGAAATAGC

mouse-Cfl1-sg4(SEQ ID NO.30)：GAAATTAATACGACTCACTATAGGAGATGCTCCAGGCAGGGGGCGTTTTAGAGCTAGAAATAGC

mouse-Ctcf-sg2(SEQ ID NO.31)：GAAATTAATACGACTCACTATAGGGGTGATGCTGGGGCCTTGCTGTTTTAGAGCTAGAAATAGC

mouse-Ctcf-sg3(SEQ ID NO.32)：GAAATTAATACGACTCACTATAGGTGCTCGGCACCAGGACTATTGTTTTAGAGCTAGAAATAGC

mouse-Ctcf-sg4(SEQ ID NO.33)：GAAATTAATACGACTCACTATAGGATCATGCTGAGGATCATCTCGTTTTAGAGCTAGAAATAGC

mouse-Ctcf-sg5(SEQ ID NO.34)：GAAATTAATACGACTCACTATAGGGCCACCACAGACGCCCCCAAGTTTTAGAGCTAGAAATAGC

mouse-Dppa3-sg1(SEQ ID NO.35)：GAAATTAATACGACTCACTATAGGTGCGAAAATCGGGAAGAATTGTTTTAGAGCTAGAAATAGC

mouse-Dppa3-sg2(SEQ ID NO.36)：GAAATTAATACGACTCACTATAGGGTGCGGCATCGTCGACAGCCGTTTTAGAGCTAGAAATAGC

mouse-Dppa3-sg4(SEQ ID NO.37)：GAAATTAATACGACTCACTATAGGCAGGTCGGAGACACAAGGACGTTTTAGAGCTAGAAATAGC

mouse-Dppa3-sg5(SEQ ID NO.38)：GAAATTAATACGACTCACTATAGGGCATCCAGGTCGGAGACACAGTTTTAGAGCTAGAAATAGC

mouse-Gata6-sg1(SEQ ID NO.39)：GAAATTAATACGACTCACTATAGGGGCGGCATGGGCTCAGGCCAGTTTTAGAGCTAGAAATAGC

mouse-Gata6-sg2(SEQ ID NO.40)：GAAATTAATACGACTCACTATAGGGCCCATGCCGCCAAGAGGCAGTTTTAGAGCTAGAAATAGC

mouse-Gata6-sg4(SEQ ID NO.41)：GAAATTAATACGACTCACTATAGGGCGGAGCCTTCCCTGCCTCTGTTTTAGAGCTAGAAATAGC

mouse-Gata6-sg5(SEQ ID NO.42)：GAAATTAATACGACTCACTATAGGTCCCTGCCTCTTGGCGGCATGTTTTAGAGCTAGAAATAGC

mouse-Gata6-sg6(SEQ ID NO.43)：GAAATTAATACGACTCACTATAGGCCTCTTGGCGGCATGGGCTCGTTTTAGAGCTAGAAATAGC

mouse-Dppa5-sg1(SEQ ID NO.44)：GAAATTAATACGACTCACTATAGGACTGGCTTCACTCGATACACGTTTTAGAGCTAGAAATAGC

mouse-Dppa5-sg2(SEQ ID NO.45)：GAAATTAATACGACTCACTATAGGGAGACACAAGGACTGGAAACGTTTTAGAGCTAGAAATAGC

mouse-Dppa5-sg3(SEQ ID NO.46)：GAAATTAATACGACTCACTATAGGCAGGTCGGAGACACAAGGACGTTTTAGAGCTAGAAATAGC

mouse-Dppa5-sg4(SEQ ID NO.47)：GAAATTAATACGACTCACTATAGGGCATCCAGGTCGGAGACACAGTTTTAGAGCTAGAAATAGC

mouse-Grp1-sg1(SEQ ID NO.48)：GAAATTAATACGACTCACTATAGGCAGGTTCTCAAGGAAAAGGGGTTTTAGAGCTAGAAATAGC

mouse-Grp1-sg2(SEQ ID NO.49)：GAAATTAATACGACTCACTATAGGGGGAGGAACTGCCAGCTGAAGTTTTAGAGCTAGAAATAGC

mouse-Grp1-sg3(SEQ ID NO.50)：GAAATTAATACGACTCACTATAGGCTTGTCGTTGTCCCTTCAGCGTTTTAGAGCTAGAAATAGC

mouse-Grp1-sg4(SEQ ID NO.51)：GAAATTAATACGACTCACTATAGGAGCTGAAGGGACAACGACAAGTTTTAGAGCTAGAAATAGC

mouse-Grp1-sg5(SEQ ID NO.52)：GAAATTAATACGACTCACTATAGGAACGACAAGGGCGGCTTCCAGTTTTAGAGCTAGAAATAGC

mouse-H2afz-sg1(SEQ ID NO.53)：GAAATTAATACGACTCACTATAGGGGACAACAGAAGACTGTTTAGTTTTAGAGCTAGAAATAGC

mouse-H2afz-sg2(SEQ ID NO.54)：GAAATTAATACGACTCACTATAGGGAAGACTGTTTAAGGATGCCGTTTTAGAGCTAGAAATAGC

mouse-H2afz-sg3(SEQ ID NO.55)：GAAATTAATACGACTCACTATAGGCCTGAGATAATAAGGAATCCGTTTTAGAGCTAGAAATAGC

mouse-H2afz-sg4(SEQ ID NO.56)：GAAATTAATACGACTCACTATAGGTTTAGAGTCCTGAGATAATAGTTTTAGAGCTAGAAATAGC

mouse-H3.3b-sg1(SEQ ID NO.57)：GAAATTAATACGACTCACTATAGGAAGCTCTCTCCCCCCGTATCGTTTTAGAGCTAGAAATAGC

mouse-H3.3b-sg2(SEQ ID NO.58)：GAAATTAATACGACTCACTATAGGAGTTGGCTCGCCGGATACGGGTTTTAGAGCTAGAAATAGC

mouse-H3.3b-sg4(SEQ ID NO.59)：GAAATTAATACGACTCACTATAGGCATGCCCAAAGACATCCAGTGTTTTAGAGCTAGAAATAGC

mouse-H3.3b-sg5(SEQ ID NO.60)：GAAATTAATACGACTCACTATAGGGTAAATTCTGTAAAATACTTGTTTTAGAGCTAGAAATAGC

mouse-LMNA-sg1(SEQ ID NO.61)：GAAATTAATACGACTCACTATAGGAACTGCAGCATCATGTAATCGTTTTAGAGCTAGAAATAGC

mouse-LMNA-sg4(SEQ ID NO.62)：GAAATTAATACGACTCACTATAGGAATCTGGGACCTGCCAGGCAGTTTTAGAGCTAGAAATAGC

mouse-Lypd1-sg1(SEQ ID NO.63)：GAAATTAATACGACTCACTATAGGCTTCCACTTAGCCCTCTGCTGTTTTAGAGCTAGAAATAGC

mouse-Lypd1-sg2(SEQ ID NO.64)：GAAATTAATACGACTCACTATAGGTTCAGCAGTGTGCCAAGCAGGTTTTAGAGCTAGAAATAGC

mouse-Lypd1-sg3(SEQ ID NO.65)：GAAATTAATACGACTCACTATAGGCCCCTGCTGCCTCACCTGTCGTTTTAGAGCTAGAAATAGC

mouse-Lypd1-sg4(SEQ ID NO.66)：GAAATTAATACGACTCACTATAGGACAGGTGAGGCAGCAGGGGTGTTTTAGAGCTAGAAATAGC

mouse-Lypd1-sg5(SEQ ID NO.67)：GAAATTAATACGACTCACTATAGGTGGCACACTGCTGAAGCTAAGTTTTAGAGCTAGAAATAGC

mouse-Nanog-sg1(SEQ ID NO.68)：GAAATTAATACGACTCACTATAGGAGATCACAAGAAAGAGTGCGGTTTTAGAGCTAGAAATAGC

mouse-Nanog-sg2(SEQ ID NO.69)：GAAATTAATACGACTCACTATAGGTATGAGACTTACGCAACATCGTTTTAGAGCTAGAAATAGC

mouse-Nanog-sg3(SEQ ID NO.70)：GAAATTAATACGACTCACTATAGGCGTAAGTCTCATATTTCACCGTTTTAGAGCTAGAAATAGC

mouse-Nanog-sg4(SEQ ID NO.71)：GAAATTAATACGACTCACTATAGGCTTAAAGTCAGGGCAAAGCCGTTTTAGAGCTAGAAATAGC

mouse-Oct4-sg2(SEQ ID NO.72)：GAAATTAATACGACTCACTATAGGCTCTGTTCCCGTCACTGCTCGTTTTAGAGCTAGAAATAGC

mouse-Oct4-sg3(SEQ ID NO.73)：GAAATTAATACGACTCACTATAGGGGTGCCTCAGTTTGAATGCAGTTTTAGAGCTAGAAATAGC

mouse-Oct4-sg4(SEQ ID NO.74)：GAAATTAATACGACTCACTATAGGGACAAGAGAACCTGGAGCTTGTTTTAGAGCTAGAAATAGC

mouse-pv-sg1(SEQ ID NO.75)：GAAATTAATACGACTCACTATAGGTCTGGTGGCTGAAAGCTAAGGTTTTAGAGCTAGAAATAGC

mouse-pv-sg3(SEQ ID NO.76)：GAAATTAATACGACTCACTATAGGCGTTGGGGATGGAGAGGTGGGTTTTAGAGCTAGAAATAGC

mouse-pv-sg4(SEQ ID NO.77)：GAAATTAATACGACTCACTATAGGTTAGCTTTCAGCCACCAGAGGTTTTAGAGCTAGAAATAGC

mouse-Sox2-sg1(SEQ ID NO.78)：GAAATTAATACGACTCACTATAGGGGTACGTTAGGCGCTTCGCAGTTTTAGAGCTAGAAATAGC

mouse-Sox2-sg3(SEQ ID NO.79)：GAAATTAATACGACTCACTATAGGCCAGCCCTCACATGTGCGACGTTTTAGAGCTAGAAATAGC

mouse-Sox2-sg6(SEQ ID NO.80)：GAAATTAATACGACTCACTATAGGCCAGCACTACCAGAGCGGCCGTTTTAGAGCTAGAAATAGC

mouse-Sox2-sg7(SEQ ID NO.81)：GAAATTAATACGACTCACTATAGGCAGGGGCAGTGTGCCGTTAAGTTTTAGAGCTAGAAATAGC

mouse-Sox2-sg8(SEQ ID NO.82)：GAAATTAATACGACTCACTATAGGCCGCAGCGAAACGACAGCTGGTTTTAGAGCTAGAAATAGC

mouse-Tubb5-sg1(SEQ ID NO.83)：GAAATTAATACGACTCACTATAGGGAGGCAGAAGAGGAGGCCTAGTTTTAGAGCTAGAAATAGC

mouse-Tubb5-sg2(SEQ ID NO.84)：GAAATTAATACGACTCACTATAGGGATGCAGGGCTCTCTGCCTTGTTTTAGAGCTAGAAATAGC

mouse-Tubb5-sg3(SEQ ID NO.85)：GAAATTAATACGACTCACTATAGGTTTCGGAGAGGAGGCAGAAGGTTTTAGAGCTAGAAATAGC

mouse-Tubb5-sg4(SEQ ID NO.86)：GAAATTAATACGACTCACTATAGGCGGAGAGGAGGCAGAAGAGGGTTTTAGAGCTAGAAATAGC

mouse-Vip-sg2(SEQ ID NO.87)：GAAATTAATACGACTCACTATAGGGCTGGAGAAATGATGGGAAGGTTTTAGAGCTAGAAATAGC

mouse-Vip-sg3(SEQ ID NO.88)：GAAATTAATACGACTCACTATAGGAAATGATGGGAAGAGGCCTCGTTTTAGAGCTAGAAATAGC

mouse-Vip-sg4(SEQ ID NO.89)：GAAATTAATACGACTCACTATAGGCTGATTTCAGCTCTGCCCAGGTTTTAGAGCTAGAAATAGC

5.1.2 oligonucleotides (primer sequences (5 '-3')

CasRX-sgRNA-F(SEQ ID NO.90)：TAATACGACTCACTATAGGAACCCCTACCAACTGGTCGGGGTTTGAAAC

mouse-K70-sg1-R(SEQ ID NO.91)：CACTGTGCCTTACTCTGTGAATAGTTTCAAACCCCGACCAGTT

mouse-K70-sg2-R(SEQ ID NO.92)：AGGAACTGCTAGATGCTCTTATCGTTTCAAACCCCGACCAGTT

mouse-K70-sg3-R(SEQ ID NO.93)：ACGTCTCCCCGTATTTTGTGGCTGTTTCAAACCCCGACCAGTT

mouse-K80-sg1-R(SEQ ID NO.94)：ACTTGCGGCAATACATGTTTTCCGTTTCAAACCCCGACCAGTT

mouse-K80-sg2-R(SEQ ID NO.95)：CTGTGCGTCTTTAAGAAGATTGAGTTTCAAACCCCGACCAGTT

mouse-K80-sg3-R(SEQ ID NO.96)：CTGAGCGCTATTGATGATCTGATGTTTCAAACCCCGACCAGTT

mouse-Parp1-sg1-R(SEQ ID NO.97)：CCGATTGGCTTAATACTGCTGGGGTTTCAAACCCCGACCAGTT

mouse-Parp1-sg2-R(SEQ ID NO.98)：ATGGTGTCCAAAAGTGCAAACTAGTTTCAAACCCCGACCAGTT

mouse-Parp1-sg3-R(SEQ ID NO.99)：GCATGCTTCACATATCAGCAAGTGTTTCAAACCCCGACCAGTT

mouse-Rad52-sg1-R(SEQ ID NO.100)：AGAGGTGGCAGCCAAGCATGCGGGTTTCAAACCCCGACCAGTT

mouse-Rad52-sg2-R(SEQ ID NO.101)：ACAGCGTCCCACATATCCATTGCGTTTCAAACCCCGACCAGTT

mouse-Rad52-sg3-R(SEQ ID NO.102)：TGATGTGGATTTAACTAAAACAAGTTTCAAACCCCGACCAGTT

mouse-Polq-sg1-R(SEQ ID NO.103)：TGGCGCTTGCTTTAAAGGGAATGGTTTCAAACCCCGACCAGTT

mouse-Polq-sg2-R(SEQ ID NO.104)：CGTGGCTGTTAGAAAATGAGTTCGTTTCAAACCCCGACCAGTT

mouse-Polq-sg3-R(SEQ ID NO.105)：GCTGCTTCCTACATTGACTCTTTGTTTCAAACCCCGACCAGTT

monkey-POLQ-sg1-R(SEQ ID NO.106)：GTGGAGGTGATTCTGAAAAGTGCGTTTCAAACCCCGACCAGTT

monkey-POLQ-sg2-R(SEQ ID NO.107)：ATGCTGCCTGCACATTTTTGGCTGTTTCAAACCCCGACCAGTT

monkey-POLQ-sg3-R(SEQ ID NO.108)：TGTGGCTGCTAGAAAATGAATTCGTTTCAAACCCCGACCAGTT

monkey-POLQ-sg4-R(SEQ ID NO.109)：TGGTGGTCGACCTTTAGATATTCGTTTCAAACCCCGACCAGTT

5.1.3 oligonucleotides for SSODN (primer sequence (5 '-3'))

Monkey-CDKL5-SSODN(SEQ ID NO.110)：AGAAGGCAATAATGCTAATTACACAGAGTACGTTGCCACCAGCTGGTATCAGTCCCTGGAGCCTTTACTTGGGTGAGTTACCATCCCAAAATAGAATGACA

mouse-Ctcf-SSODN(SEQ ID NO.111)：CAGCATGATGGACCGGTGATGCTGGGGCCTTGCTCGGCACCAGGACTATTGAATTCGGGCTGTGTTTAAACGGCCCAAATCTTAATTTTTCTCTTTTTTTTCTTTG

mouse-Oct4-SSODN(SEQ ID NO.112)：GGGATGCTGTGAGCCAAGGCAAGGGAGGTAGACAAGAGAACCTGGAGCTTGAATTCTGGGGTTAAATTCTTTTACTGAGGAGGGATTAAAAGCACAACAGGGGTGG

mouse-SOD1-A4V-SSODN(SEQ ID NO.113)：CCCTCCGGAGGAGGCCGCCGCGCGTCTCCCGGGGAAGCATGGCGATGAAAGTAGTGTGCGTGCTGAAAGGCGACGGTCCGGTGCAGGGAACCATCCACTTCGA

mouse-SOD1-G93A-SSODN(SEQ ID NO.114)：TTAATGTTAGGCATGTTGGAGACCTGGGCAATGTGACTGCTGGAAAGGACGCCGTGGCAAATGTGTCCATTGAAGATCGTGTGATCTCACTCTCAGGAGAGCA

6. Preparation of injection mixtures

All injection mixtures were prepared at the following concentrations, with a final volume of 10. Mu.l, and diluted with RNase-free water. Cas9, cas9-msa, cas9-CtIP, casRX, rad51 (final concentration 100 ng/. Mu.l); cas9-sgRNA, casRX-gRNA, and DDRNA (final concentration of 50ng/μl per synthetic RNA); tild-CRISPR linearized homology template, TCTS linearized homology template, HITI linearized vector (final concentration 100 ng/. Mu.l), 5' biotin modified linearized homology template (final concentration 20 ng/. Mu.l), ssODN donor (final concentration 30 ng/. Mu.l). In a Tild-CRISPR mediated experiment, cas9 mRNA, site-specific sgRNA and a Tild-CRISPR homologous template are mixed; in Tild-TCTS-CRISPR mediated experiments, cas9 mRNA, site-specific sgRNA and linearized TCTS homology templates are mixed; mixing Cas9 mRNA, site-specific sgRNA and linearized HITI vector in Tild-HITI-CRISPR mediated experiments; in CtIP mediated experiments, cas9-CtIP mRNA, site-specific sgRNA and Tild-CRISPR homology templates are mixed; in 5 'biotin modification-mediated experiments, cas9-msa mRNA, site-specific sgRNA, and 5' biotin modified linearized homology templates were mixed; in Rad51 overexpression-mediated experiments, cas9 mRNA, site-specific sgRNA, tild-CRISPR homology templates and Rad51 mRNA were mixed; in a multiple sgRNA mediated experiment, cas9 mRNA, 3 sgrnas of one target gene, and a gold-CRISPR homology template were mixed; in CATI-mediated experiments, cas9 mRNA, site-specific Cas9-sgRNA, tild-CRISPR homology template, casRX mRNA, casRX-sgRNA (3 mouse gene sgRNA,4 monkey gene sgRNA) were mixed.

7. Mouse embryo injection, embryo culture, embryo transfer

Superbank B6D2F1 (C57 BL/6J. Times. DBA/2N) female mice (3 or 8 weeks old) were used to obtain embryos for gene editing. Briefly, pregnant mare serum gonadotropins (PMSG, 5 IU/mouse for 3 weeks old mice, 10 IU/mouse for 8 weeks old mice) were injected at 3 weeks old or 8 weeks old, and human chorionic gonadotropins (hCG, 5 IU/mouse for 3 weeks old, 10 IU/mouse for 8 weeks old) were injected 48 hours later, and then caged with adult B6D2F1 male mice.

Dissection was performed 20 hours after hCG injection in mice, and oviducts were removed and fertilized eggs were collected therefrom. The mixed reagent was injected into the cytoplasm of fertilized eggs having identifiable prokaryotes in a volume of 1-3 pl. 2-cell embryo injection, embryos were collected from the oviduct 40 hours after hCG injection. The mixed reagent was injected into the cytoplasm of one or both blastomeres of a 2-cell embryo at a volume of 1-3pl 45-48 hours after hCG injection. Injection was performed using a piezo-driven micromanipulator (Prime Tech) in M2 medium containing 5. Mu.g/ml Cytokinin B (CB). The injected embryos are then cultured in amino acid-containing KSOM medium.

In the case of Trichostatin A (TSA) treatment, fertilized eggs after injection are cultured in KSOM medium containing 10nM TSA for 5-6 hours and then transferred to fresh KSOM medium containing amino acids at 37℃in 5% CO ₂ Culturing in the environment. Finally, the present inventors collected E4.5 blastula for fluorescent observation or genotyping analysis.

If it is desired to produce a genetically edited mouse, the injected embryos are incubated in amino acid-containing KSOM medium at 37℃in 5% CO2 air for 2 hours and then transferred to the oviducts of pseudopregnant ICR female mice (20 embryos/surrogate).

8. Monkey oocyte collection, ICSI, embryo injection and embryo culture

In terms of oocyte collection in monkeys, procedures for ICSI (intracytoplasmic sperm injection), embryo injection and culture have been mentioned in the previous article (Liu et al, 2018). Briefly, healthy female cynomolgus monkeys received 25IU of recombinant human follicles twice daily for 7-8 days, starting on day 3 of the menstrual cycle. On day 11 of the menstrual cycle, the oocytes were retrieved from the follicles 36 hours after injection of 1000IU of human chorionic gonadotrophin. MII oocytes were selected for ICSI and fertilization was confirmed by confirming the presence of both prokaryotes after 6 hours. Then, the fertilized eggs were injected with 1-3pl of the mixed reagent. At the time of 2-cell or 4-cell embryo injection, each blastomere is injected with the mixed reagent. After microinjection, embryos are cultured in pre-equilibrated HECM-9 at 37℃in 5% CO ₂ . Embryos were transferred to HECM-9+5% fbs medium after culturing to 8 cell stage. Embryos develop to blastula stage for fluorescent observation or genotyping analysis.

9. Genotyping assays for embryos and mice

Single embryos were transferred directly to PCR tubes containing 5. Mu.l of lysis buffer (lysis Buffer from Mouse Direct PCR Kit) containing proteinase K. The samples were incubated at 56℃for 30min to lyse the cells, followed by heat inactivation of proteinase K at 95℃for 10 min. Genomic DNA was amplified using random primers (general methods and materials section 5.1). The amplification conditions were: 30. Mu.l of the reaction mixture (0.5. Mu.l rTaq, 10. Mu.l random primer, 1.5. Mu.l 2.5mM dNTP mix, 3. Mu.l 10 Xbuffer, sterile distilled water) was added to a total reaction volume of 30. Mu.l. The PCR cycle parameters are one cycle (95 ℃ C., 5 min); 30 cycles (95 ℃,1 minute; 37 ℃,2min;55 ℃,4 min); one cycle (55 ℃,4 min). Secondary PCR was performed with 1. Mu.l of random PCR product and primers (general methods and materials section 5.1). The total amount of the reaction solution was 50. Mu.l, and the composition was: 1. Mu.l KOD-fx DNA polymerase, 25. Mu.l KOD buffer, 10. Mu.l dNTP mix, 1.5. Mu.l 10mM forward and reverse primer, 1. Mu.l random PCR product DNA template, sterile distilled water. The touchdown PCR method is adopted, and the cycle parameters are 1 cycle (94 ℃ for 2 min); 10 cycles (98 ℃,10s;65 ℃,15s;68 ℃,50 seconds); 34 cycles (98 ℃,10s;55 ℃,15s;68 ℃,50 seconds); 1 cycle (68 ℃,5 minutes). The specific PCR products were gel purified and sequenced. When genotyping mice, mouse genomic DNA was extracted from a Mouse toe sample using the Mouse Direct PCR kit. PCR amplification was performed using primers for amplifying the correct targeting sequence (general methods and materials section 5.1). The specific DNA sequence was amplified using KOD-FX DNA polymerase, and the product was gel purified and sequenced.

10、Southern blot

25 μg of Lypd1-p2A-Cre mouse genomic DNA was digested with Nde I enzyme. 25 μg of Calcr-p2A-Cre mouse genomic DNA was digested with PstI enzyme, then separated with 0.8% agarose gel and transferred to positively charged nylon transfer membranes (GE Healthcare, RPN 303B). Southern blot analysis was performed using the digoxin labelling system and the membrane hybridized with the internal Cre probe (0.5 kb). The probe sequence was (SEQ ID NO. 115):

AATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAG. Cre probe amplification was performed using the PCR DIG probe synthesis kit (Roche). Detection was performed using DIG-High Prime DNA labelling and detection initiation kit II (Roche, germany). For Lypd1-p2A-Cre mice, the Cre internal probe expected fragment size is WT=N/A, targeted=2.95 kb. For Calcr-p2A-Cre mice, the Cre internal probe expected fragment size is wt=n/a, targeted=5.5 kb.

11. Smart-seq2 library preparation

PBS, cas9/sgRNA and 4 reagents of Cas9/sgRNA/DNA homologous templates were injected into embryos, respectively, 5 embryos per group were placed into the EP tube 6 hours after injection, mRNA amplification was performed according to the instructions (Vazyme, N712-03), and the amplification period was 18 cycles. The cDNA concentration was determined by a Qubit Flex fluorometer (Thermo Fisher Scientific) and the fragment size distribution was verified by Agilent bioanalyzer 2100. For library preparation TruePrep DNA Library Prep Kit V For Illumina (Vazyme, TD 503) was used as indicated.

12、RT-PCR

SYBR-qPCR was performed using ChamQ SYBR Color qPCR Master Mix (Vazyme, Q421-02). Gene expression levels were detected using the Roche 480 II Real-Time PCR system (Roche). Primers are as indicated in section 5.1 of the general methods and materials.

13. GOTI overview

In this experiment, cre mRNA, cas9 mRNA, sgRNA, casRX mRNA, and crRNA (targeting Polq is the experimental group, no endogenous gene targeting is the control group, the control group does not contain Cre mRNA) were mixed and then injected into one blastocyst of a 2-cell mouse embryo obtained by mating an mTmG male mouse with a wild female mouse. The Cre injection into one of the blastomeres can produce a chimeric embryo labeled with both GFP and RFP. When the chimeric embryo developed to E14.5, it was minced into small pieces and digested into single cell suspensions. GFP was collected separately using a flow cytometer (FACS) ⁺ And RFP ⁺ Is a cell of (a) a cell of (b). The two populations of cells after sorting were used for Whole Genome Sequencing (WGS).

14. Quantification and statistical analysis

14.1, RNA-seq analysis

The RNA-seq sequences were quality checked, trimmed and aligned using STAR and aligned with the reference genome mm 9. The feature counts and readings of the normalized data were counted using DEseq2 in R/BioConductor. All other RNA-seq analyses and statistics were performed in R/BioConductor using custom R script.

14.2 edit efficiency analysis and repair Pattern analysis

The collected embryos and cells were lysed and subjected to Sanger sequencing, followed by ICE v2 CRISPR analysis (Wilde et al 2021) (https:// www.synthego.com/publications) on the sequencing results. In order to analyze HDR efficiency, the inventors also provided wild-type sequences at the same time as the analysis. After outputting the editing result, the present inventors analyzed all editing events displayed for each sample. The results of indel and HDR are relatively easy to obtain. ICE v2, however, does not separate MMEJ and NHEJ from indels. To sort the NHEJ and mmoej, the inventors divided all editing modes according to the rules of the research described in the literature. The results of all sequenced embryos (including the embryos edited therein and the embryos knocked in) were then counted to calculate their indel, HDR, MMEJ and NHEJ frequencies.

14.3 GOTI pipelining

After quality inspection and removal of the adapter of the original sequencing reads, the qualified data is then mapped onto the reference genome (mm 9). Next, the alignment data is ordered and the repeated sequence is marked. GFP was detected by using three different algorithms for SNV detection (Mutect 2, loFreq and Strelka 2) and for indel detection (Mutect 2, SCALPEL and Strelka 2) ⁺ Cell and RFP ⁺ The cells were compared to identify newly generated SNV and Indel. In the present invention, SNV or Indel, which can be detected using all three algorithms, is defined as a true mutation.

14.4 statistical analysis

All statistical analyses used Prism 8 (GraphPad), except for the RNA-seq data analysis using R/Bioconductor. Details of the individual experiments, including the number and type (n) of repetitions, are listed in each figure and legend. All statistical data were calculated using a two-tailed student t-test and all charts showed mean ± SEM. All experiments were performed under double blind conditions.

Example 1 MMEJ repair plays a leading role in CRISPR/Cas9 embryo editing

Many past studies have shown that the efficiency of embryo HDR can be increased by altering DNA repair pathways (Chu et al 2015;Maruyama et al, 2015). However, repair pathways for endogenous DNA damage after CRISPR/Cas9 editing in embryos remain to be investigated. Thus, the inventors first performed extensive editing pattern (deletion and insertion of nucleotides, indel) analysis on 88 sgRNA-mediated embryo editing results. These sgRNAs were designed to target 21 genes, including housekeeping genes, pluripotency genes, and neuron-specific genes. The inventors microinjected single sgrnas and Cas9 mRNA into mouse fertilized eggs and collected the blasts for genotyping using the ICE v2 CRISPR analysis tool (ice.synthgo.com) (fig. 1A). 88 sgrnas/Cas 9 mRNA was injected into approximately 1500 mouse embryos (> 10 embryos/sgRNA) in total. The frequency of editing of sgrnas was between 3.9% and 94.2%, the inventors found that nucleotide deletions were more common than insertions (fig. 1B and 5A).

The inventors then analyzed the pattern of DNA repair of the mouse embryo after gene editing. According to previous reports (Fu et al, 2021a;Ottaviani et al, 2014;Sfeir and Symington,2015;Taheri-ghafarokhi et al, 2018), the inventors designated the DNA repair pathway as NHEJ when an insertion event occurred or when there were no microhomologous sequences around the deleted fragment. The presence of a microhomologous sequence around the deleted fragment was considered to be an MMEJ repair pattern (FIG. 1C). The inventors found that NHEJ and MMEJ are normally present in both sgRNA-mediated embryo editing (fig. 1C and 1D). The inventors then calculated the ratio of the occurrence frequency of NHEJ to mmoej in each sgRNA-mediated editing. Contrary to previous results of the study in cells (Fu et al 2021 a), the inventors found that 61/88 (69.3%) sgRNA-mediated embryo editing showed a clear preference for MMEJ repair (NHEJ/MMEJ frequency ratio less than 1). For example, calcr-sgRNA2 showed a high degree of MMEJ biased repair because NHEJ and MMEJ occurred at a frequency of 1.64% and 88.91% (ratio 0.02), respectively (fig. 1C). Furthermore, for higher editing efficiency sgRNAs (66.7-100%, n=38), MMEJ clearly predominates (81.5%, 31/38 sgRNAs) (fig. 1D and 5A).

These results indicate that MMEJ may play a key role in nuclease-mediated repair of embryonic DSBs, particularly sgRNA-directed efficient editing.

Example 2 Polq was upregulated during CRISPR/Cas9 embryo editing

Repair of DSBs is critical to maintaining proper cell function (Agarwal et al, 2006), a number of DSB repair-related genes have been identified (humismann et al, 2021;Jasin and Rothstein,2013;Stinson et al, 2020). To study the expression characteristics of DSB repair related genes during embryo gene editing, the inventors selected the Actb gene for targeted knockout and knock-in, and performed RNA-seq analysis on embryos. The inventors compared the RNA-seq data of Cas 9/sgRNA-injected embryos (Actb knockouts) and Cas 9/sgRNA/homologous template DNA-injected embryos (knockin mCherry after Actb) to determine genes that are disturbed during DSB repair. The inventors found that during the Actb knockout, only few genes were altered in expression level, but that expression levels of more than 200 genes in the knock-in group were altered by the presence of homologous template DNA (fig. 5B and 5C). The inventors speculate that the latter is due to the large amount of linearized DNA being recognized as DNA damage within the embryo.

Next, the present inventors compared the expression levels of HR, NHEJ, SSA and MMEJ repair pathway related genes in the three sets of embryo RNA-seq data (fig. 5D). The inventors found that the expression level of most genes was not significantly changed except that the mmoj key factor Polq was up-regulated by nearly 2-fold in the knock-in embryo editing group (fig. 1E and 5D). RT-PCR detects the expression levels of the key factors Rad52, ku70 and Polq of the SSA, NHEJ and MMEJ repair pathways. The results also confirm the increased expression of Polq in the knock-in embryo-edited group (fig. 1E). These results inspired the inventors to investigate the feasibility of improving HDR efficiency by blocking MMEJ repair by down-regulating Polq expression.

Example 3 HDR efficiency of mouse embryos can be improved by CasRX down-regulating Polq

The inventors first tried to suppress the expression of key DSB repair related factors (Rad 52, ku70 and POLQ) in mouse embryos by siRNA strategy (3 random sirnas per gene) and found that none of the three genes tested were down-regulated (fig. 5E and 5F). The inventors then attempted to down-regulate the expression of these three factors using the recently reported RNA editor CasRX. 3 crRNAs were designed for each gene and injected into mouse fertilized eggs along with CasRX mRNA. RT-PCR analysis showed that CasRX significantly reduced expression of these three genes and did not additionally interfere with other indicated DNA repair genes (FIGS. 1F and 5G).

Next, the present inventors studied the role of knockdown of DNA repair related factors in improving HDR efficiency. A well-established strategy for linearizing DNA as a homology template was chosen as a control (Yao et al, 2017; yao et al, 2018 b). The Actb and Gata6 genes were designed for the knock-in target of mCherry by injecting the Cas 9/sgRNA/linearized DNA mix with the Polq-targeted crRNAs/CasRX mix into fertilized eggs. The inventors found that there was a significant increase in HDR efficiency at both sites when Polq knockdown, whereas no stable results were obtained in Ku70, rad52 or three gene simultaneous knockdown groups (fig. 2A and table 1).

TABLE 1 data corresponding to the Gata6-mCherry histogram of FIG. 2A

Thus, the inventors have initially demonstrated that the HDR efficiency of mouse embryos can be improved by CasRX knock-down of Polq. The inventors named this strategy CATI (CasRX-assisted targeted integration by homology-dependent repair). The inventors then selected sites for expression in another 9 embryos for mCherry knock-in testing, further examining the role of Polq knockdown in HDR efficiency improvement (fig. 2B). The inventors performed at least three independent replicates for each site. Overall, the gene integration efficiency of all targets was improved to varying degrees (fig. 2B). Normalized analysis of all experiments at 11 sites tested in the control and CATI groups found a 2.4-fold increase in HDR efficiency in the CATI group after Polq knockdown (fig. 2C).

In addition to the knock-in of the fluorescent reporter protein, the present inventors also performed the knock-in of the Cre gene and the integration of the LoxP site for one leukemia related gene (Mllt 3) for two neuron-specific expressed genes (Calcr, lyypd 1) (fig. 6A). And transferring the embryo injected by the fertilized ovum into a embryo substitute, and carrying out genotype analysis on tail tissues of the embryo. Compared with the control group, the integration efficiency of the three sites of the CATI group is obviously improved (0% -25% of Calcr-cre, 5.2% -27.8% of lyp-cre and 20% -36.8% of Mllt 3-LoxP) (fig. 2d and table 2). At the same time, there was no significant difference in birth rates between the control and CATI groups (fig. 2D), indicating that transient Polq knockdown by CasRX was not detrimental to embryo development. Germline transmission analysis showed successful transmission of the integrated DNA fragment to the next generation in all 7 tested F0 bands (FIGS. 6B and 6C; table 2). Southern blot and western blot analysis showed precise integration and expression of the Cre gene fragment. (FIG. 6D, FIG. 6E)

Table 2: summary of the construction of mouse strains by CATI strategy, the results are correlated to FIG. 2

Example 4 System evaluation of various methods for improving HDR efficiency

Currently, a range of reported approaches have demonstrated that CRISPR/Cas 9-based HDR efficiencies in cells and embryos can be improved. The inventors summarized 9 different methods for improving HDR efficiency in cultured cells or embryonic cells (fig. 3A). It comprises the following steps: using a DNA homology template with truncated Cas9 targeting sequence (TCTS for short) (Nguyen et al, 2019), using a DNA homology template with biotin modification (Gu et al, 2018), TSA (Trichostatin A) treatment (Fu et al, 2021 a), fusion strategy of the CtIP functional domain with Cas9 protein (charpelier et al, 2018), over-expression strategy of Rad51 (Song et al, 2016), 2-cell stage microinjection strategy (Gu et al, 2021 a), NHEJ-based targeted integration (HITI) (Suzuki et al, 2016), strategy of simultaneous injection of DDRNAs (DNA damage response RNAs) (Michelini et al, 2017; rzeszutek and tlej, 2020) and simultaneous utilization of multiple sgrnas (Aida et al, 2015).

The inventors have made a thorough assessment of the reproducibility or universality of these methods in mouse embryos. For each method, the inventors performed 3 independent replicates of mCherry knockins at least at 2 sites. The inventors found that most of the methods have no significant efficiency improvement except that the HDR efficiency of the 2-cell injection method is increased from 21.2% to 52.3% (Actb gene) and 20.6% to 33.5% (Dppa 3 gene) (fig. 3B-3E).

To investigate whether the combined use of the CATI method and the 2-cell injection method of the present inventors could improve embryo HDR efficiency, the present inventors performed 2-cell phase injections of the Actb and Dppa3 loci with or without CATI knockout of Polq. The inventors further improved the HDR efficiency of the Actb site from 42.2% to 91.3% (fig. 3F). The HDR efficiency of the Dppa3 site was also increased from 23.5% to 37.4% (fig. 3G). However, HDR efficiency did not improve when 2-cell phase injections were knocked down simultaneously with Rad52 or Ku70 (fig. 7A). In summary, the inventors believe that the cati+2c (CATI in combination with 2 cell injection) method has shown the highest efficiency to date and recommended it as a better strategy for mouse embryo knock-in experiments.

Example 5 CATI can effectively improve HDR efficiency of monkey embryo editing

Non-human primate models are of great value in neuroscience and biomedical research (Qiu et al, 2019; deposition, 2013; tu et al, 2019; wang et al, 2020; yang et al, 2008; zhang et al, 2018). However, there is little research to improve HDR efficiency in monkey embryos. The inventor considers that a high-efficiency monkey embryo HDR editing method has important significance for generation of a monkey model. Thus, the present inventors studied whether an effective knock-in method in mouse embryos is applicable to monkey embryos. The inventors first tested a 2-cell injection method in monkey embryos. Cas 9/sgRNA/linearized DNA templates were injected into monkey fertilized eggs and 2 cell embryos, with the injection reagents targeting the CDX2 site for mCherry knockin. The inventors found that the mCherry fluorescence positive rate was significantly lower in the 2-cell injected group than in the fertilized egg injected group (fig. 7B and 7C). Considering that monkey fertilized egg genome activation occurs in the 4-8 cell phase (Lee et al, 2014; schulz and Harrison,2019;Stadhouders et al, 2019), the inventors further tested whether 4-cell injection is beneficial for improving monkey HDR efficiency. The inventors found that the HDR efficiency of the 4-cell injected group was the lowest among fertilized eggs, 2-cell and 4-cell injected groups (fig. 7B and 7C). These results indicate that the HDR-effective strategy for mouse 2 cell injection is not suitable for monkeys.

Next, the inventors studied the effectiveness of CATI strategies developed by the inventors in improving the HDR efficiency of monkey embryos. Likewise, CDX2 sites were selected for mCherry integration. The monkey fertilized eggs were injected with Cas 9/sgRNA/linearized DNA templates, with or without POLQ targeting crRNA/CasRX as control or CATI groups, respectively. Three independent experiments were used to collect statistics for analysis. The inventors found that the CATI group CDX2 site HDR efficiency was significantly improved (37.9% vs. 64.9%) (fig. 3H). Further testing at another site, h3.3b, also demonstrated the effect of CATI strategy in monkey embryo editing (50.8% vs. 74.5%) (fig. 3I). Thus, the inventors have demonstrated that CATI strategies based on MMEJ modulation are universally applicable in improving HDR efficiency of rodent and primate embryo editing. Although the inventors tested the CATI strategy only in monkey early embryo expressed genes, the inventors believe that the CATI strategy is also applicable to genes expressed by other tissues and plays an important role in future monkey model generation.

Example 6 CATI improves the efficiency of ssODN mediated nucleotide substitution

Single stranded oligonucleotide (ssODN) -mediated HDR repair is considered a promising germ cell gene therapy strategy. The inventors studied the effect of CATI on ssODN mediated HDR. First, an EcoRI restriction endonuclease site was designed to be introduced on the ssODN targeting the Oct4 and Ctcf sites. The Cas9/sgRNA/ssODN mixtures (control) or Cas9/sgRNA/ssODN/crRNA/CasRX mixtures (CATI group) were injected into mouse embryos and the resulting blasts were genotyped and restriction analysis (fig. 4A). The inventors found that the HDR efficiency of the CATI group was significantly improved at both sites compared to the control group (Ctcf: 17.1% vs.40.0%, oct4:22.3% vs.43.1%, FIG. 4B). This result was further confirmed by the restriction enzyme strip and the quantitative data in the restriction enzyme analysis (FIG. 4C).

The inventors then used CATI to simulate clinically relevant diseases in mouse offspring. The inventors selected the G93A and A4V mutations of the Sod1 gene to mimic the mutations associated with Amyotrophic Lateral Sclerosis (ALS) disease (Hough et al, 2004; niwa et al, 2002). Using a strategy similar to that described above, the present inventors transplanted fertilized eggs injected with the editing mix reagent into surrogate mice to generate mouse offspring. The results of the genotyping of the mice showed that 1 out of 16 mice in the control group (6.25%) were positive for the G93A mutation, while 6 out of 11 mice in the CATI group (54.55%) were positive for the G93A mutation. For the A4V mutation, the control and CATI groups were positive for 4/10 (40%) and 3/7 (42.86%) of the mouse genotypes, respectively (FIG. 4D). Analysis of positive progeny HDR efficiencies showed that the mutation efficiencies of both CATI group G93A and A4V site were much higher than the control group (G93A: 22.0% vs.48.8%, A4V:23.5% vs.40.8%, fig. 4E). Notably, the inventors found a decrease in Indel frequency near the CATI group target sites compared to the control (fig. 4F), further analysis indicated that this decrease was probably due to reduced MMEJ repair (fig. 4F). The inventors believe that a reduction in indels will favor the stability and integrity of the genome (Hsu et al, 2014; wen et al, 2021).

Next, the inventors used CATI to introduce clinically relevant mutations in monkey embryos. The present inventors devised a clinical presence of the R178Q mutation, integrated into the monkey CDKL5 site using ssODN (fig. 8A). The inventors found that 2/9 and 5/9 embryos showed positive for the R178Q mutation in the control and CATI groups, respectively (FIG. 8B). The highest efficiency of positive embryos increased from 5% to 26% between control and CATI groups (fig. 8C). In monkey embryos, the inventors also observed a decrease in the mmoj ratio in CATI group (fig. 8C).

These results indicate that CATI has efficacy and potential safety advantages in ssODN-mediated gene correction of HDR germ cells.

Example 7 CATI method does not increase off-target Effect

Off-target and safety are important issues for the development of gene editing technology. To fully evaluate the safety of CATI methods, the inventors performed stringent off-target analysis experiments, GOTI (Zuo et al, 2019), at the whole genome level. Briefly, the knock-in reagent and Cre mRNA were injected into one blastomere of the 2-cell stage embryo of mTmG transgenic mice. The injected blastomere developed into RFP expressing tissue and the uninjected blastomere developed into GFP expressing tissue. RFP and GFP cells were sorted for whole genome sequence alignment analysis (fig. 8D).

According to the invention, the Lypd1-Cre gene is selected for GOTI experiments. And (3) taking the target crRNAs/CasRX with or without Polq as a control group and a CATI group respectively, simultaneously injecting Cas 9/sgRNA/linearization DNA/Cre mRNA into the CATI group, and injecting Cas 9/sgRNA/linearization DNA into an experimental group. 2E 14.5 embryos were taken from each group. Whole genome sequencing was performed with GFP and RFP labeled cells. The inventors first verified the editing effect of RFP expressing cells by Sanger sequencing and whole genome sequencing. The inventors found that both the control group and CATI group exhibited higher targeting efficiency (fig. 8E and 8F). The inventors then analyzed the number of nascent SNVs in each embryo RFP and GFP-tagged cell using the GOTI assay, investigating the potential off-target effects of the control and CATI groups (Zuo et al, 2019). The inventors found 46 and 20 new-born SNPs in the control samples, and 70 and 30 new-born SNPs in the CATI samples (fig. 8H). The number of nucleotide insertions also showed no significant difference between the two groups (fig. 8I). Furthermore, the inventors also found no nucleotide bias between mutation types (fig. 8J), indicating that Polq knockout may not cause spontaneous mutation of base editing.

These results indicate that CATI is a safe gene editing method, without introducing additional mutations.

Discussion of the invention

The application of CRISPR/Cas9 in embryo gene editing greatly facilitates the development of the fields of model construction and germ cell therapy trials. Heretofore, NHEJ was considered the primary pathway for DNA repair in nuclease-mediated embryo gene editing (Taheri-ghafarokhi et al, 2018). Thus, several studies have focused on improving HDR efficiency by inhibiting NHEJ (Chu et al, 2015;Maruyama et al, 2015). However, the reproducibility of this NHEJ inhibition strategy is challenged by subsequent studies (Song et al, 2016; taheri-gharokhi et al, 2018). By genotyping 88 sgRNA/Cas9 mRNA injected mouse embryos, the inventors found that the proportion of MMEJ-mediated DNA repair in mouse embryo gene editing was much higher than NHEJ. This explains why the HDR efficiency enhancement based on NHEJ regulation was not reproducible in different studies in the past and provides an important basis for the inventors' method CATI for HDR efficiency enhancement based on MMEJ regulation.

Methods for improving HDR efficiency have been reported in many different systems and biological studies, and the inventors considered that a comprehensive evaluation and comparison of mouse embryo editing systems is highly necessary. Subsequently, the inventors found that most methods have no supporting effect on the improvement of HDR efficiency in mouse embryos, probably because most methods are based on the development of cultured cell systems. Another important reason is that the basic control used in the studies of the present inventors has been an improved efficient method. This further demonstrates the effectiveness and significance of the CATI process of the present inventors. As the inventors say, cati+2c methods have higher HDR efficiencies than other methods, which may cause mouse model construction to be no longer difficult in the future.

Studies of gene editing in non-human primate embryos have prompted the recent generation of a series of knockout monkeys (Ke et al, 2016; wan et al, 2015; yang et al, 2019; zhang et al, 2018; zhou et al, 2019). However, HDR mediated gene knock-in monkey models have also been relatively few (Cui et al, 2018; yao et al, 2018 a). According to the experience of the present inventors, the overall editing efficiency of sgrnas in monkey embryos was lower than in mouse embryos. At the same time, transcriptome analysis of monkey embryos also showed that the expression of HDR repair-related genes in the embryos was lower than in mouse embryos (Wang et al, 2017). Thus, traditional HDR-based knock-in methods in monkey embryos are particularly difficult in model construction. The CATI method based on MMEJ regulation developed by the present inventors represents a significant advantage in monkey embryos, which is believed to be the first method of choice for future knock-in monkey model construction. In addition to animal model construction, gene editing techniques offer tremendous potential for germ and somatic gene therapy (Komor et al, 2017;Nelson et al, 2017). While base editing has been widely used for gene repair in mouse and human fertilized eggs, the base editor is still not applicable for most non-base-replacement gene mutations (Anzalone et al, 2020;reys and Liu,2018). Recently developed pilot editors have the potential to repair all types of mutations in theory, but have limited efficiency (Anzalone et al, 2019; liu et al, 2020). In the present inventors' studies, the inventors found that CATI methods can increase the efficiency of ssODN mediated HDR in mouse and primate embryos. The results show the potential of CATI in germ cell gene therapy, which is to be further investigated for the treatment of clinical mutations.

Safety is one of the main problems of concern in gene editing technology, especially in gene therapy technology. According to previous reports, elevated expression of Polq increased the risk of random integration (Mateos-Gomez et al, 2015;Schrempf et al, 2021). Complete deletion of Polq also causes genomic instability in cells (Yousefzadeh et al, 2014). Thus, the inventors believe that CasRX-mediated knockdown is the best option to regulate Polq expression, as crRNAs/CasRX are transiently working during embryo editing. In the stringent GOTI off-target analysis of the present inventors, the present inventors found that CATI group had no significant off-target compared to control group. Therefore, the CATI method has wide application prospect in the aspects of animal reproduction and germ cell gene therapy.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims

1. Use of a Polq (micro-homology mediated end-linked MMEJ key factor polymerase Q) inhibitor for the preparation of a composition or formulation for:

(a) During gene editing, MMEJ is down-regulated;

(b) During gene editing, HDR (homology-mediated repair) is facilitated;

(d) In the gene editing process, promoting gene editing of CRISPR/Cas 9; and/or

(e) Promoting cellular gene therapy and/or gene correction.

2. The use of claim 1, wherein the gene editing is CRISPR/Cas 9-based gene editing.

3. The use according to claim 1, wherein the gene editing comprises gene editing of embryonic cells at 2-cell stage and/or 4-cell stage and/or 8-cell stage.

4. The use of claim 1, wherein the Polq inhibitor is an RNA editor CasRX that down-regulates expression of Polq.

5. A method of CRISPR/Cas9 gene editing, the method comprising:

6. A method of CRISPR/Cas9 gene editing in vitro, comprising:

7. A reagent product (or reagent combination), comprising: