WO2019184937A1

WO2019184937A1 - Method for producing pig having improved properties

Info

Publication number: WO2019184937A1
Application number: PCT/CN2019/079818
Authority: WO
Inventors: 王皓毅; 项光海; 任吉龙; 海棠; 周琪
Original assignee: 中国科学院动物研究所
Priority date: 2018-03-28
Filing date: 2019-03-27
Publication date: 2019-10-03
Also published as: CN112041445A; CN112041445B

Abstract

Provided is a method for producing a pig of which the sequence in an IGF2 gene intron is gene-edited.

Description

Method of producing pigs with improved characteristics

Technical field

The invention relates to the field of bioengineering. In particular, the invention relates to a method of producing pigs with improved characteristics. More specifically, the invention relates to improving pork production by genetically editing sequences within intron 3 of the porcine IGF2 gene.

Background technique

Pigs are one of the most important livestock as a source of meat. In the past few decades, in order to support the rapid population growth and meet the customer's requirements for quality food, the breeding experts focus on pig molecular breeding to accelerate the promotion of lean meat production. Previous studies have revealed many genes related to body growth, muscle mass and fat deposition, such as the growth hormone gene (GH) (Hammer, REet al. Nature 315, 680-683 (1985)), myostatin (Myostatin) ( Grobet, L. et al. Nat Genet 17, 71-74 (1997); McPherron, AC & Lee, SJ Proc Natl Acad Sci U S A 94, 12457-12461 (1997)) and IGF2 (Jeon, JTet al. Nat Genet 21, 157-158 (1999); Nezer, C. et al. Nat Genet 21, 155-156 (1999)). The transgene expression of specific genes in livestock is increasingly used in breeding and biomedical applications, resulting in a variety of desirable traits (Hammer, RE et al. Nature 315, 680-683 (1985); Laible, G., Wei, J. & Wagner, S. Biotechnol J 10, 109-120 (2015)). However, most transgenic strategies introduce foreign elements into the genome, which can lead to unpredictable effects. Therefore, there is a need in the art for non-GMO methods to improve pork production.

Summary of invention

In a first aspect, the invention provides a method of producing a pig having improved characteristics comprising the step of modifying the sequence in intron 3 of the porcine IGF2 gene by gene editing.

In a second aspect, the present invention provides a pig or a progeny thereof, a germ cell, an embryo, an isolated somatic cell, a tissue or an organ having improved characteristics produced by the method of the present invention, wherein the IGF2 gene intron in the pig The sequence in 3 was modified.

In a third aspect, the present invention also provides a meat product derived from a pig having improved characteristics produced by the method of the present invention or a progeny thereof, wherein the sequence in the intron 3 of the IGF2 gene in the pig is modified.

In a fourth aspect, the invention provides a kit for producing a pig having improved properties by the method of the invention, comprising at least a gene editing system that targets a sequence in intron 3 of the porcine IGF2 gene.

In a fifth aspect, the invention provides the use of a pig or a progeny thereof, a germ cell, an embryo, an isolated somatic cell, a tissue or an organ produced by the method of the invention, for example for pig breeding or for pork production.

DRAWINGS

Figure 1 shows genotyping of pig lines, as well as expression of mutant alleles and IGF2 in the parental line. (a) Genotyping of Chinese local breeds and imported commodity pig breeds; (b) Sanger sequencing to identify mutant alleles in primary modified pigs; (c) Deep sequencing analysis of mutation patterns in primary modified pigs; d) Relative expression of IGF2 in four male primary modified pigs of different ages. The error bars indicate S.E.M. ***, P < 0.001; **, P < 0.01; *, P < 0.05.

Figure 2 shows the increase in body weight gain of primary modified pigs and F1 generation by editing pig IGF2 regulatory elements. (a) Schematic representation of the porcine IGF2 locus and paired sgRNA target sequences, sgRNA target sequences are shown in bold, underlined for PAM sequences; (b) primary ages with different IGF2 introns 3-3072 region mutations Modification of mean body weight changes in pigs and WT; (c) Four mutant alleles from 6#3M and 6#6M were passed to F1 generation; (d) Relative to IGF2 in muscle samples of IGF2 ^{IVS3 indels} and WT of different ages Expression; (e) Growth rate of F1 mutants and WT body weight at different ages; (f) Representative photographs of IGF2 ^{IVS3 indels} and WT at 4 months of age; (g) F1 (N=6) at 4 months of age slaughter Average body weight of pigs with WT (N=4); (h) mean body weight of F1 (N=6) and WT (N=4) at 4 months of age (n=10); (i) 4 months Average lean meat weight of F1 (N=6) and WT (N=4) at age slaughter (n=10); (j) Changes in muscle fiber density in IGF2 ^IVS3 ^indels (N=3) and WT (N=2) . Error bars indicate SEM. ***, P <0.001; **, P <0.01; *, P <0.05; ns, not significant.

Figure 3 shows methylation near QTN in muscle and ear samples of 4 month old WT, primary modified pigs 6#4M and 6#6M. The WT contains 56 CpGs, while the primary modified pigs lost several CpGs. The thick underline shows the QTN. Vertical lines and numbers indicate the CpG position of the primary modified pig relative to the WT.

Figure 4 shows a luciferase assay of a reporter construct using IGF2 promoter 3. (a) Schematic representation of each reporter gene vector containing 578 bp from IGF2 intron 3 followed by IGF2 promoter 3; (b) changes in relative luciferase activity of each reporter gene. Three biological replicates were performed in the experiment, and the error bars indicate S.E.M. ***, P < 0.001; **, P < 0.01; *, P < 0.05.

Figure 5 shows the weight gain and feed consumption of the F1 generation. (a) Average daily gain gain of F1 IGF2 ^{IVS3 indels} (n=15) and WT (n=6). (b) Changes in feed conversion ratio of F1 IGF2 ^{IVS3 indels} (n=15) and WT (n=6). Data are expressed as mean ± SEM. ***, P <0.001; **, P <0.01; *, P <0.05; ns, not significant.

Summary of the invention

Unless otherwise indicated or defined, all terms used have their ordinary meaning in the art and will be understood by those skilled in the art. Reference is made, for example, to standard handbooks such as Sambrook et al., "Molecular Cloning: A Laboratory Manual"; Lewin, "Genes VIII"; and Roitt et al., "Immunology" (8th Edition), and the general references cited herein. In addition, all methods, steps, techniques, and procedures that are not specifically described may be, and are, in a manner known per se, as will be apparent to those skilled in the art. Reference is also made, for example, to the standard handbook, the general prior art described above, and other references cited therein.

As used herein, the term "CRISPR nuclease" generally refers to a nuclease present in a naturally occurring CRISPR system, as well as modified forms thereof, variants thereof (including nickase mutants), or catalytically active fragments thereof. The CRISPR nuclease can recognize and/or cleave the target nucleic acid structure by interacting with a guide RNA such as a crRNA and optionally a tracrRNA or an artificial gRNA such as a sgRNA. The term encompasses any nuclease based on the CRISPR system that enables gene editing in cells.

Examples of "CRISPR Nucleases" include Cas9 nucleases or variants thereof. The Cas9 nuclease may be a Cas9 nuclease from a different species, such as spCas9 from S. pyogenes or SaCas9 derived from S. aureus.

Examples of such Cas9 nuclease variants include, but are not limited to, highly specific variants of Cas9 nuclease, such as the Cas9 nuclease variant eSpCas9 (1.0) of Feng Zhang et al. (comprising mutation K810A/K1003A/R1060A), eSpCas9 ( 1.1) (comprising the mutation K848A/K1003A/R1060A), and the Cas9 nuclease variant SpCas9-HF1 (comprising the mutation N497A/R661A/Q695A/Q926A) developed by J. Keith Joung et al.

The Cas9 nuclease variant further comprises a Cas9 nickase (nCas9) in which one of two subdomains (HNH nuclease subdomain and RuvC subdomain) in the DNA cleavage domain of Cas9 nuclease is inactivated The nicking enzyme is formed. The Cas9 nickase comprises, for example, a mutation D10A or H840A relative to a wild-type Cas9 nuclease.

Examples of "CRISPR nucleases" may also include Cpfl nucleases or variants thereof such as highly specific variants. The Cpf1 nuclease may be a Cpf1 nuclease from a different species, such as a Cpf1 nuclease from Francisella novicida U112, Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium ND2006.

Examples of "CRISPR Nucleases" that may be used may also include Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1. Csn2, Cas4, C2c1, C2c3 or C2c2 nuclease or a variant thereof.

As used herein, "gRNA" and "guide RNA" are used interchangeably and refer to an RNA capable of forming a complex with a CRISPR nuclease and capable of targeting the complex to a target sequence due to certain complementarity to the target sequence. molecule. For example, in a Cas9-based gene editing system, gRNAs are typically composed of crRNA and tracrRNA molecules that partially complement each other to form a complex, wherein the crRNA comprises sufficient complementarity to the target sequence to hybridize to the target sequence and direct the CRISPR complex (Cas9+ crRNA+tracrRNA) A sequence that specifically binds to the sequence of the target sequence. However, it is known in the art to design a single-guide RNA (sgRNA) that simultaneously contains features of crRNA and tracrRNA. In a Cpf1-based genome editing system, gRNAs are typically composed only of mature crRNA molecules, wherein the crRNA comprises sequences that are sufficiently identical to the target sequence to hybridize to the complement of the target sequence and direct the complex (Cpf1+crRNA) to The target sequence sequence specifically binds. It is within the ability of those skilled in the art to design suitable gRNA sequences based on the CRISPR nuclease used and the target sequence to be edited.

As used herein, "expression construct" refers to a vector, such as a recombinant vector, suitable for expression of a nucleotide sequence of interest in a cell or organism or in vitro. "Expression" refers to the production of a functional product. For example, expression of a nucleotide sequence can refer to transcription of a nucleotide sequence (eg, transcription to produce mRNA or functional RNA) and/or translation of RNA into a precursor or mature protein. The "expression construct" of the present invention may be a linear nucleic acid fragment (such as an mRNA), a circular plasmid, or a viral vector. An "expression construct" of the invention may comprise regulatory sequences of different origin and nucleotide sequences of interest, or regulatory sequences of the same origin but arranged in a manner different from that normally found in nature, and nucleotide sequences of interest. "Regulatory sequences" and "regulatory elements" are used interchangeably and refer to either upstream (5' non-coding sequences), intermediate or downstream (3' non-coding sequences) of a coding sequence, and affect transcription or RNA processing of related coding sequences or Stability or translated nucleotide sequence. Regulatory sequences can include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

The present inventors have surprisingly found that mutation of the sequence in the intron 3 of the porcine IGF2 gene by a CRISPR-based gene editing system can significantly improve pig growth performance and pork quality, for example, an increase in lean meat weight of up to 50 %or above. Importantly, the methods of the present invention do not introduce integrated exogenous nucleic acid sequences into pigs and are therefore non-transgenic. Moreover, since the targeted non-coding region does not cause structural changes in the expression product, genetic alterations can be minimized. More importantly, it is known that overexpression of the IGF2 gene in mice leads to abnormal growth, however, unexpectedly, the genetically edited pig produced by the method of the present invention has no such adverse side effects despite its IGF2. The gene is significantly overexpressed.

Thus, in a first aspect, the invention provides a method of producing a pig having improved characteristics comprising the step of modifying the sequence in intron 3 of the porcine IGF2 gene by gene editing. The improved characteristics include, for example, increased growth rate, increased pork yield such as increased lean meat production.

The porcine IGF2 gene sequence information can be found in Genbank accession number AY242098. An exemplary sequence of intron 3 of the porcine IGF2 gene is shown in SEQ ID NO:11. However, it will be apparent to those skilled in the art that for different breeds of pigs, the sequences may differ, such as single nucleotide polymorphisms. For example, the nucleotide sequence of intron 3 of the porcine IGF2 gene can be different from SEQ ID NO: 11 but has at least about 80%, at least about 85%, at least about 90%, at least about 91%, and SEQ ID NO: At least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity. Thus, when referring to a particular nucleotide in the intron 3 of the porcine IGF2 gene, such as nucleotide position 3072, it may refer to nucleotide position 3072 of SEQ ID NO: 11, but if the intron 3 The sequence differs from SEQ ID NO: 11 and also covers nucleotides corresponding to this position. The correspondence of such nucleotide positions can be readily determined by those skilled in the art.

In some embodiments, the modification results in a nucleotide substitution in intron 3 of the IGF2 gene relative to an unmodified corresponding wild-type pig. In some specific embodiments, the modification results in the substitution of nucleotide 3072 of the IGF2 gene intron 3 for A.

In some embodiments, the modification results in a nucleotide insertion in intron 3 of the IGF2 gene relative to the unmodified corresponding wild-type pig, eg, from about 1 to about 10, from about 1 to about 50, from about 1 to 1 A nucleotide insertion of about 100, about 1 to about 150, or about 1 to about 200 nucleotides. In some embodiments, the modification results in a nucleotide insertion within or outside the sequence of positions 3068-3073 in intron 3 of the IGF2 gene relative to the unmodified wild type pig. In some embodiments, the nucleotide insertion is any one of the insertions as shown in Figure Ib.

In some embodiments, the modification results in a deletion of a nucleotide in intron 3 of the IGF2 gene relative to the unmodified corresponding wild-type pig, eg, from about 1 to about 10, from about 1 to about 50, from about 1 to 1 Nucleotides of about 100, about 1 to about 150 or about 1 to about 200 nucleotides are deleted.

In some embodiments, the nucleotide deletion comprises nucleotide position 3072 of intron 3 of the porcine IGF2 gene, eg, the nucleotide number 3072 is G. In some embodiments, the nucleotide deletion comprises a flanking sequence comprising nucleotide position 3072 of intron 3 of the porcine IGF2 gene.

In some embodiments, the nucleotide deletion comprises a sequence at positions 3068-3073 of intron 3 of the porcine IGF2 gene, eg, the sequence at positions 3068-3073 is

(SEQ ID NO: 12).

In some embodiments, the nucleotide deletion comprises a sequence

(SEQ ID NO: 13) (6#3M 119 bp deletion).

In some embodiments, the nucleotide deletion comprises the sequence 5'-GGCAGCCGGGCCGCGGCTTCGCCTCGGC-3' (SEQ ID NO: 14) (6#3M 28 bp deletion).

In some embodiments, the nucleotide deletion comprises the sequence 5'-CCGCGGCTTCGCCTAG-3' (SEQ ID NO: 15) (6#6M 16 bp deletion).

In some embodiments, the nucleotide deletion comprises a sequence

(SEQ ID NO: 16) (6#6M 30 bp deletion).

In some embodiments, the nucleotide deletion is any one of the deletions as shown in Figure Ib.

In some embodiments, the method comprises introducing a gene editing system that targets sequences in intron 3 of the porcine IGF2 gene into a pig.

In some embodiments, the gene editing system targets a sequence comprising nucleotide position 3072 in intron 3 of the porcine IGF2 gene. In some embodiments, the gene editing system targets a flanking sequence at position 3072 of intron 3 of the porcine IGF2 gene.

In some embodiments, the gene editing system comprises a CRISPR nuclease or an expression construct encoding the CRISPR nuclease, and a guide RNA or an expression construct encoding the guide RNA. Preferably, the expression construct is a linear nucleic acid vector.

In some embodiments, the CRISPR nuclease is a CRISPR nickase, such as a Cas9 nickase.

In some embodiments, the gene editing system comprises two guide RNAs, or an expression construct encoding the two guide RNAs. The two guide RNAs are targeted to the flanking sequences upstream (5' direction) and downstream (3' direction) of the 3072th nucleotide in intron 3 of the porcine IGF2 gene, respectively. In some embodiments, the upstream and/or downstream flanking sequences may comprise nucleotide 3072 of intron 3 of the porcine IGF2 gene. In some embodiments, the upstream and downstream flanking sequences are located on different DNA strands.

In some embodiments, the two guide RNAs are directed to the sequence 5'-GCGCGGGAGCGCGTGGGGCG-3' (downstream) and 5'-GCCTAGGCGAAGCCGCGGCC-3' (upstream) in intron 3 of the porcine IGF2 gene, respectively.

The gene editing system of the present invention can be introduced into pigs by a variety of methods known in the art, such as fertilized eggs or embryo injection. Preferably, the components of the gene editing system are not integrated into the genome of the pig.

In some embodiments, the method comprises introducing the gene editing system that targets a sequence in intron 3 of the porcine IGF2 gene into a fertilized egg or embryo of a pig, and then transferring the fertilized egg or embryo to the recipient The surrogate pigs were used to produce pigs in which the sequence in intron 3 of the IGF2 gene was modified.

In some embodiments, the pig to be modified is G at position 3072 of intron 3 of the IGF2 gene. Such pigs include, but are not limited to, Bama pigs, pigs, Meishan pigs, and Wuzhishan pigs. Preferably, the pig is a Bama pig.

In a second aspect, the present invention provides a pig having improved characteristics produced by the method of the present invention or a progeny thereof, a germ cell, an embryo, an isolated somatic cell, a tissue or an organ, wherein the IGF2 gene intron 3 in the pig The sequence in it is modified.

In some embodiments, the unmodified wild-type pig from which the pig having improved properties produced by the method of the invention has nucleotides at position 3072 in intron 3 of the IGF2 gene is G. Such pigs include, but are not limited to, Bama pigs, pigs, Meishan pigs, and Wuzhishan pigs. Preferably, the pig is a Bama pig.

In some embodiments, the porcine IGF2 gene intron 3 produced by the method of the invention comprises a nucleotide substitution relative to an unmodified corresponding wild-type pig. In some embodiments, the nucleotide 3,072th G of intron 3 of the IGF2 gene of pig produced by the method of the invention is substituted with A.

In some embodiments, the porcine IGF2 gene intron 3 produced by the method of the invention comprises nucleotide insertions, for example from about 1 to about 10, about 1 to about 1 relative to the unmodified corresponding wild-type pig. 50. A nucleotide insertion of from about 1 to about 100, from about 1 to about 150, or from about 1 to about 200 nucleotides. In some embodiments, the nucleoside is contained within or within the sequence of positions 3068-3073 of intron 3 of the IGF2 gene produced by the method of the invention relative to the unmodified corresponding wild-type pig. Acid insertion. In some embodiments, the porcine IGF2 gene intron 3 produced by the method of the invention comprises any one of the insertions as shown in Figure lb relative to the unmodified corresponding wild-type pig.

In some embodiments, the porcine IGF2 gene intron 3 produced by the method of the invention comprises a nucleotide deletion, eg, from about 1 to about 10, about 1 to 1 corresponding to the unmodified corresponding wild-type pig. Nucleotides of about 50, about 1 to about 100, about 1 to about 150, or about 1 to about 200 nucleotides are deleted.

In some embodiments, the 3072th nucleotide of intron 3 of the IGF2 gene produced by the method of the invention is deleted relative to the unmodified corresponding wild-type pig, eg, the 3072th The nucleotide is G.

In some embodiments, the nucleotide sequence at positions 3068-3073 of intron 3 of the IGF2 gene of the resulting pig is deleted relative to the unmodified corresponding wild-type pig, eg, the 3068-3073 The sequence of the bit is SEQ ID NO:12.

In some embodiments, the SEQ ID NO: 13 is deleted from the intron 3 of the IGF2 gene produced by the method of the invention relative to the unmodified corresponding wild-type pig. In some embodiments, the SEQ ID NO: 14 is deleted from intron 3 of the IGF2 gene produced by the method of the invention relative to the unmodified corresponding wild-type pig. In some embodiments, the sequence of SEQ ID NO: 15 is deleted from intron 3 of the IGF2 gene produced by the method of the invention relative to the unmodified corresponding wild-type pig. In some embodiments, the SEQ ID NO: 16 is deleted from intron 3 of the IGF2 gene produced by the method of the invention relative to the unmodified corresponding wild-type pig.

In some embodiments, the pig IGF2 gene intron 3 produced by the method of the invention comprises any one of the deletions as shown in Figure Ib relative to the unmodified corresponding wild type pig.

In a fourth aspect, the invention provides a kit for producing a pig having improved properties by the method of the invention, which may, for example, comprise a gene editing system that targets sequences in intron 3 of the porcine IGF2 gene. The kit may also contain reagents for introduction into the gene editing system, and/or instructions on how to practice the methods of the invention.

In some preferred embodiments, the CRISPR nuclease is a CRISPR nickase, such as a Cas9 nickase.

In some preferred embodiments, the two guide RNAs are directed to the sequence 5'-GCGCGGGAGCGCGTGGGGCG-3' (downstream) and 5'-GCCTAGGCGAAGCCGCGGCC-3' (upstream) in intron 3 of the porcine IGF2 gene, respectively.

In a fifth aspect, the invention provides the use of a pig or a progeny thereof, a germ cell, an embryo, an isolated somatic cell, tissue or organ produced by the method of the invention, for example for pig breeding or for pork production.

To the best of the inventors' knowledge, the present invention is the first to perform gene editing in non-coding regions to promote livestock meat production. Previous large-scale animal breeding efforts have focused on transgenic expression or gene knockout, such as knocking out Myostain and transgene expression of UCP1. Each gene exerts its unique function by integrating into a specific regulatory network, and the deletion or insertion of any gene can affect the natural network, thus causing certain adverse effects. In addition, the introduction of transgenes often carries exogenous components that can lead to unpredictable effects. Knocking out endogenous genes usually changes more phenotypes than knocking out the desired phenotype. The present invention uses the CRISPR system to edit IGF2 regulatory elements without introducing any exogenous DNA fragments, significantly increasing lean meat production. More importantly, this change maintains the general characteristics of the pig without affecting the structure of the body. There are many famous and valuable local species around the world. Using this new breeding strategy, genetic breeding of these pig lines can be promoted.

Example

The invention is further illustrated by the following examples, which are not intended to limit the invention.

Materials and Method

Ethical statement

All experiments related to animal experiments in this study were carried out in strict accordance with the Regulations on the Administration of Laboratory Animals and approved by the Laboratory Animal Welfare Ethics Review Committee of the Institute of Zoology, Chinese Academy of Sciences.

In vitro transcription of nickase mRNA and sgRNA

The T7-nickase DNA fragment was amplified using the forward primer containing the T7 promoter, the kozak sequence and the Cas9 nickase forward coding sequence, and the reverse primer of the nickase coding sequence, using the PX335 vector as a template (Table 1). The nickase mRNA was synthesized in vitro by transcription using the mMESSAGE mMACHINE T7 ULTRA kit (Thermo Fisher Scientific, USA). A sgRNA DNA fragment was amplified using a forward primer containing a T7 promoter, a 20 bp sgRNA target sequence, and a sgRNA backbone forward sequence, and a sgRNA backbone reverse primer, using PX335 as a template (Table 1). SgRNA was synthesized by in vitro transcription using the MEGAshortscript T7 kit (Thermo Fisher Scientific, USA). The nickase mRNA and sgRNA were purified using a MEGAclear kit (Thermo Fisher Scientific, USA).

Table 1 sgRNA sequences and primers

引物名称Primer name	序列(5'-3')Sequence (5'-3')	SEQ ID No.SEQ ID No.
IGF2 gRNA pair1-1IGF2 gRNA pair1-1	GCGCGGGAGCGCGTGGGGCGGCGCGGGAGCGCGTGGGGCG	11
IGF2 gRNA pair1-2IGF2 gRNA pair1-2	GCCTAGGCGAAGCCGCGGCC GCCTAGGCGAAGCCGCGGCC	22
IGF2-663bp-FIGF2-663bp-F	CCTCTCCTTTCCCAGTCCTTCCCTCTCCTTTCCCAGTCCTTC	33
IGF2-663bp-RIGF2-663bp-R	GGAGGTCCCAGAAAAAGTCGTGGAGGTCCCAGAAAAAGTCGT	44
IGF2 BSP 334bp FIGF2 BSP 334bp F		GGATTGTTGAAGTTTTCGAGAGGGATTGTTGAAGTTTTCGAGAG	55
IGF2 BSP 334bp RIGF2 BSP 334bp R		CCACTAAAAACGCCCCGATACCACTAAAAACGCCCCGATA	66
IGF2 qRT FIGF2 qRT F		GTGCTGCTATGCTGCTTACCGGTGCTGCTATGCTGCTTACCG	77
IGF2 qRT RIGF2 qRT R	CCGCAGACAAACTGGAGGGCCGCAGACAAACTGGAGGG	88
IGF2-347bp-deep seq-FIGF2-347bp-deep seq-F	ACTGTTGAAGTCCCCGAGAGCGCACTGTTGAAGTCCCCGAGAGCGC	99
IGF2-347bp-deep seq-RIGF2-347bp-deep seq-R		GAGGCCCGCGGACTCGAGGCCCGCGGACTC	1010

Microinjection of CRISPR-Cas9 system in fertilized eggs

The nickase mRNA, sgRNA and ssODN (single-stranded oligodeoxynucleotide) were injected into the cytoplasm of the parthenogenetic embryo and the fertilized egg using a FemtoJet microinjector (Eppendorf, Germany). To test the editing efficiency of sgRNA, parthenogenetic embryos were used in preliminary experiments. The injected oocytes were induced to induce parthenogenetic stimulation using a BTX electro-cell manipulator 200 (BTX, San Diego, CA) in a fusion medium with two 30 μs DC pulses (1 second interval) of 1.2 kV/cm. Then, the activated oocytes were cultured in PZM3 medium in a humidified atmosphere of 38.5 ° C and 5% CO ₂ for 144 hours to the blastocyst stage for genotyping.

Embryo Transfer

Midline laparotomy was performed under general anesthesia, and the injected embryos were transferred to recipient surrogates. The pregnancy was diagnosed after 28 days, and the pregnant pigs were routinely examined by ultrasound technique every two weeks.

Genotyping of IGF2 modification in embryos and piglets

Each injected embryo was collected on

day

7 and 10 μl of lysis buffer (10 mM Tris-Cl, pH 8.0; 2 mM EDTA; 2.5% (v/v) Triton-X 100; 2.5% (v/v) Tween-20 was collected. 100 ng/mL proteinase K), incubated at 50 ° C for 60 min, then incubated at 95 ° C for 15 min. Genotyping primers (Table 1) were used and amplified with 2 μl of lysate by AccuPrime Taq polymerase (Invitrogen, USA) in a 25 μl PCR reaction. The purified PCR product was sequenced for further analysis.

In order to genotype piglets, tissues from piglets were collected and lysed, and then amplified under the same conditions as embryo genotyping. The purified PCR product was cloned into the pEASY-T1 cloning vector (Transgen, Beijing, China) and transformed. Mutant alleles were determined by sequencing 10 single colonies per piglet sample.

Quantitative real-time PCR

RNA from muscle samples was extracted using Trizol reagent (Invitrogen, USA). The cDNA was reverse transcribed using TransScript miRNA First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China). Specific primers designed to detect promoter 3 driven IGF2 transcripts (Table 1). Expression relative to GAPDH was determined using the ΔΔCt relative quantification method.

Luciferase assay

The regulatory elements of IGF2 were amplified from WT and IGF2 ^m pigs and cloned into vectors containing regulatory elements, IGF2 promoter 3 and firefly luciferase. The firefly luciferase construct and the Renilla luciferase control vector were co-transfected into C2C12 myoblasts (Promega, USA) using lipofectamine 3000 (Invitrogen, USA). Luciferase activity was measured using a Dual-Lucy Assay Kit (Vigorous, Beijing, China).

Animal slaughter

The pigs were euthanized at 5 months of age and blood samples were taken for blood routine and biochemical tests. The hair, internal organs, head and hooves were removed from each pig to measure the weight of the body. Cut bone, skin, muscle and fat from the left body and weigh them.

Histochemical analysis of the number of muscle fibers

The longissimus muscle samples were collected and used for histological examination. The sample was placed on a glass slide, stained with hematoxylin-eosin, and observed by a microscope. For each sample, select five fields of view and calculate the average number.

Statistical Analysis

All statistical analyses were performed using GraphPad Prism 6 (GraphPad Software Inc, La Jolla, CA, USA). This value is expressed as mean ± standard error of measurement (SEM). The P value is determined by the student's t-test (unpaired).

Example 1: IGF2 intron 3 genotyping of different breeds of pigs

IGF2 encodes an important growth factor that affects skeletal muscle mass and fat deposition (Jeon, JT et al. Nat Genet 21, 157-158 (1999); Nezer, C. et al. Nat Genet 21, 155-156 (1999)). Several promoter-driven transcript variants of IGF2 encode multiple isoforms expressed in different tissues (Ohlsen, SM, Lugenbeel, KA & Wong, EADNA Cell Biol 13, 377-388 (1994); Curchoe, C. et al. Biol Reprod 73, 1275-1281 (2005)). Deletion or overexpression of the IGF2 gene in mice leads to abnormal growth (DeChiara, TM, Efstratiadis, A. & Robertson, EJ Nature 345, 78-80 (1990); Sun, FL, Dean, WL, Kelsey, G., Allen, ND & Reik , W. Nature 389, 809-815 (1997); and Eggenschwiler, J. et al. Genes Dev 11, 3128-3142 (1997)). Quantitative trait nucleotides (QTN) (IGF2-intron 3-nucleotide 3072) naturally found in intron 3 of IGF2 were identified in pigs by quantitative trait locus (QTL) mapping. The most important locus for lean meat production (Van Laere, ASet al. Nature 425, 832-836 (2003)). ZBED6 was identified as a repressor protein that binds to IGF2 intron 3, and its conserved binding motif sequence is

(Bold and underlined is the QTN). G to A conversion at 3-3072 in the IGF2 intron disrupts ZBED6 binding, resulting in increased expression of IGF2 in skeletal muscle and increased lean meat production (Van Laere, ASet al. Nature 425, 832-836 (2003); Markljung, E. et al. PLoS Biol 7, e1000256 (2009)).

The present inventors genotyped the IGF2-intron 3-3072 region of several Chinese native breed pigs and imported commercial pigs. All native species in China have wild-type alleles (G) in intron 3 of IGF2, while imported commercial pigs mainly have mutant alleles (A) (Fig. 1a).

Example 2: Production of a Bama pig with a mutation in the IGF2-intron 3-nucleotide 3072 region

This example uses the CRISPR system to edit the IGF2-intron 3-3072 region of Bama pig, a Chinese native commercial variety with the G allele at the IGF2-intron 3-3072 locus, to improve pork production. effectiveness.

Considering the use of Cas9 nicking enzymes and paired sgRNAs to significantly increase gene editing specificity (Ran, FA et al. Cell 154, 1380-1389 (2013)), a pair of single-guide RNA (sgRNA) targeting target regions was designed. On both sides (Figure 2a). To assess gene editing efficiency, Cas9 nickase mRNA and paired sgRNA were injected into parthenogenetically activated pig embryos. The editing efficiencies of this pair of sgRNAs in two independent experiments were 72.2% and 46.7%, respectively (Table 2).

Table 2 CRISPR-Cas9-mediated gene editing in parthenogenetic embryos of pigs

组成composition	浓度(ng/μl)Concentration (ng/μl)	注入胚胎数量Number of injected embryos	NEHJ效率NEHJ efficiency
切口酶mRNA+2种gRNANick enzyme mRNA + 2 gRNA	100+50+50100+50+50	1818	72.2％72.2%
切口酶mRNA+2种gRNANick enzyme mRNA + 2 gRNA	100+50+50100+50+50	1515	46.7％46.7%

After confirming the high efficiency of editing, the same editing system was injected into the naturally fertilized Bama pig embryo and a total of 19 blastocysts were transferred to both recipients (Table 3).

Table 3 CRISPR-Cas9-mediated gene editing in Bama embryos

Number of injected embryos

Number of transferred embryos

Embryo type

Number of pigs born

genotype

2828	1414	4细胞5+2细胞94 cells * 5 + 2 cells * 9	66	突变体 mutant
55	55	1细胞51 cell 5	22	野生型Wild type

Produced 6 primary modified pigs, 2 females (6#1F, 6#2F) and 4 males (6#3M, 6#4M, 6#5M and 6#6M) (Table 3), each containing in the target area Different mutations (Fig. 1b). To further characterize the proportion of mutations in these 6 piglets, deep sequencing was used to analyze genotyping PCR products of muscle samples. The results showed that the two female primary modified pigs still contained a large part of the WT allele, while the four male primary modified pigs mainly contained the mutant allele (Fig. 1c).

Example 3: Editing IGF2-intron 3 accelerates the growth of primary modified pigs

Primary modified pigs of each gender were fed with control WT pigs, and each pig consumed 0.4-0.8 kg of food per day (depending on age) and their body weight was measured monthly. In both females and males, the weight gain of the mutants was significantly faster than that of the WT pigs (Fig. 2b). Muscle samples were collected from 4 male primary modified pigs at 2 and 4 months, and quantitative real-time PCR (qRT-PCR) was performed to determine the expression level of IGF2. IGF2 expression was observed to increase by about 2 to 6 fold in these primary modified pigs (Fig. 1d).

IGF2-intron 3-3072 is located in a conserved CpG island and methylation of this region can impair ZBED6 binding (Van Laere, A Set al. Nature 425, 832-836 (2003); Markljung, E. et al. PLoS Biol 7, e1000256 (2009)). Therefore, the methylation status of the 300 bp region centered on IGF2-intron 3-3072 in all primary modified animals was examined. Muscle and ear samples from primary modified pigs 6#4M and 6#6M and WT Bama pigs were collected for bisulfite sequencing. It was found that this region was not substantially methylated in both mutant and WT pigs (Fig. 3), indicating that gene editing in this region did not alter the state of DNA methylation, whereas increased IGF2 expression was due to disruption of ZBED6 binding. Site.

Example 4: Production and growth performance of F1 modified pigs

Two male primary modified pigs (6#3M and 6#6M) were crossed with female wild-type pigs to produce F1 hybrids. Fifteen piglets and six wild-type pigs carrying four different mutant alleles were obtained by natural production (Table 4).

Table 4 Two male primary modified pigs crossed with WT females

For all four mutant alleles (designated IGF2 ^{IVS3 indels} ), the ZBED6 binding motif was deleted or disrupted (Fig. 2c). IGF2 expression in muscle samples of F1 piglets of different ages was examined. As observed in primary modified pigs, regardless of gender, a significant increase in IGF2 expression was observed in piglets of 2 months old and 3 months old, increasing approximately 2-fold to 6-fold. However, in IGF2 ^{IVS3 indels} pigs, IGF2 expression levels were similar at 4 months of age to WT pigs of the same age (Fig. 2d).

To test whether the above-described mutation introduced in IGF2-intron 3-3072 and IGF2-intron 3-3072A mutation have similar effects on IGF2 expression, transient transfection assay was used to evaluate IGF2 which plays a major role in muscle tissue. - Activity of promoter 3. Four constructs were constructed by inserting the two mutant alleles, the IGF2 intron 3-3072G allele and the IGF2 intron 3-3072A allele into the firefly luciferase reporter gene, respectively, and named it IGF2. -16, IGF2-30, IGF2G and IGF2A. A firefly luciferase reporter gene driven separately by IGF2 promoter 3 (P3) was used as a control (Fig. 4a). IGF2G acts as a repressor element and reduces luciferase activity by about 60% compared to the P3 promoter alone. In contrast, IGF2A and IGF2-16, IGF2-30 are significantly weaker repressor elements and show luciferase signals similar to P3 alone (Fig. 4b).

Piglets are weighed within 24 hours of birth to determine birth weight. After 21 days of weaning, each F1 pig was housed in a single cage and provided an unlimited feed to accurately monitor changes in body weight. There was no significant difference in IGF2 ^{IVS3 indels} and WT birth weight (IGF2 ^{IVS3 indels} was 0.67±0.02, WT was 0.68±0.02, P=0.71), and body weight difference began to appear at 45 days of age (IGF2 ^{IVS3 indels} was 6.26±0.19, WT It is 5.42 ± 0.19, P = 0.016) (Fig. 2e). By weighing the piglets monthly until slaughter, it was found that the growth rate of IGF2 ^{IVS3 indels was} faster than that of WT of the same age. At 5 months of age, the difference in body weight between IGF2 ^{IVS3 indels} and WT was highly significant (IGF2 ^{IVS3 indels} was 37.38 ± 1.41, WT was 29.36 ± 2.02, P = 0.005) (Fig. 2e). By comparing the body shape of IGF2 ^{IVS3 indels} with WT pigs, the increase in growth rate was also evident (Fig. 2f).

In addition, the average daily gain (ADG) of IGF2 ^{IVS3 indels} and WT pigs was ^quantified from 45 days to 150 days, and feed conversion ratio (FCR) (feed consumption/weight gain) was calculated. The results showed a significant difference in ADG between IGF2 ^{IVS3 indels} and WT pigs (IGF2 ^{IVS3 indels} was 0.25 ± 0.01, WT was 0.19 ± 0.10, P = 0.00009) (Fig. 5a), while IGF2 ^{IVS3 indels was} associated with WT pigs. There was no significant difference in feed conversion ratio (IGF2 ^{IVS3 indels} was 3.28 ± 0.11, WT was 3.51 ± 0.09, P = 0.19) (Fig. 5b). These results indicate that IGF2 ^{IVS3 indels} pigs grow faster than WT pigs, and there is no more feed per kilogram of body weight than WT. These results indicate that gene editing in non-coding regulatory elements increases IGF2 expression, resulting in faster growth rates.

Example 5: ^{Body phenotype of} IGF2 ^{IVS3 indels} pigs

To further characterize F1 IGF2 ^{IVS3 indels} pigs, 6 IGF2 ^{IVS3 indels} and 4 WT pigs were slaughtered at 6 months of age. Table 5 lists the body details of the pig.

Table 5 Growth performance and physical traits of IGF2 ^{IVS3 indels} and WT pigs

BW: body weight; ADG: average daily gain; CW: body weight; LCW: left body weight; CLW: body lean weight; CFW: body fat weight; LFW: leaf fat weight; CSW: body skin weight CBW: body bone weight; BFT: back fat thickness; LMA: back longest muscle area data expressed as Mean±SEM, significance was established by Student's t test, and the difference was considered when *P<0.05, **P<0.01 It is remarkable.

The average body weight of IGF2 ^{IVS3 indels} pigs was 49.64±1.55 kg, which was 34.58% higher than the average body weight of WT pigs (36.88±2.06 kg) (Fig. 2g). In addition, the body weight of IGF2 ^{IVS3 indels} pigs was 33.35 higher than that of WT pigs. % (Fig. 2h). Further analysis of muscle, fat, skin and bone tissue showed that the lean meat weight of IGF2 ^{IVS3 indels} pigs increased by 50.82% compared to WT pigs, which was the main cause of body weight gain (Fig. 2i, Table 5). The present invention also determines the cause of the increase in muscle mass. Histological analysis of the longissimus dorsi muscle section showed that the increase in muscle mass in IGF2 ^{IVS3 indels} pigs was caused by muscle fiber hypertrophy rather than hyperplasia (Fig. 2j). Skin, bone and body fat weights are greatly improved. Interestingly, there was no significant difference in lean meat, fat, skin and bone ratios compared to WT pigs (Table 5). These results indicate that modification of the IGF2 regulatory element can significantly increase lean meat production while maintaining the general characteristics of the animal line.

Example 6: Meat quality analysis of IGF2 ^{IVS3 indels} and WT pigs

Editing IGF2 intron 3 increases muscle growth, however whether it alters meat quality is unknown. By measuring the main parameters (eg, pH, color stability, water retention, drip loss, and nutrients), it was found that there was no significant difference in meat quality between IGF2 ^{IVS3 indels} and WT pigs except for the "b" value of the flesh color. (Table 6). In addition, the main nutrients (including collagen, fat, water, and protein) of IGF2 ^{IVS3 indels} and WT pigs were similar (Table 6).

Table 6 IGF2 ^{IVS3 indels} and WT pig's longest muscle traits

Data are expressed as Mean ± S. E. M., and significance is established by Student's t test. The difference was considered significant at *P < 0.05.

Example 7: IGF2 ^{IVS3 indels} pig health assessment

Previous work has shown that overexpression of IGF2 in mice may induce excessive growth disorders (Eggenschwiler, J. et al. Genes Dev 11, 3128-3142 (1997)), such as Beckwith-Wiedemann syndrome (BWS), which is characterized by Neonatal death, disproportionate organ overgrowth. In order to assess the health status of IGF2 ^{IVS3 indels} pigs, blood samples were taken for blood routine examinations reflecting basic health conditions and blood biochemical tests reflecting liver and kidney function status. There were no significant differences between IGF2 ^{IVS3 indels} and WT pigs in both analyses (Table 7, Table 8).

Table 7 Blood biochemical tests of IGF2 ^{IVS3 indels} and WT pigs

TBIL, total bilirubin; DBIL, direct bilirubin; TP, total protein; ALB, albumin; Glob, globulin; A/G, albumin/globulin; GLU, glucose; ALT, alanine aminotransferase; AST, aspartate aminotransferase; GGT, γ-glutamyl transpeptidase; ALP, alkaline phosphomonoesterase; TBA, total bile acid; CRE, creatinine serum; UURE, urea; U/R, creatinine Serum/urea; Ca, calcium; P, phosphorus; CHO, cholesterol; TG, triglyceride; AMY, amylase; CK, creatine kinase; LDH, lactate dehydrogenase; K, potassium; Na, sodium; chlorine.

Table 8 Blood routine examination of IGF2 ^{IVS3 indels} and WT pigs

RBC, red blood cell count; HGB, hemoglobin; HCT, hematocrit; MCV, mean red blood cell volume; MCH, mean hemoglobin of red blood cells; MCHC, mean hemoglobin concentration of red blood cells; PLT, platelet count; WBC, white blood cell count; SEG%, leafy Percentage of neutrophils; BAND%, percentage of rod-shaped neutrophils; MON%, percentage of monocytes; LYM%, percentage of lymphocytes; EOS%, percentage of eosinophils; BAS%, percentage of basophils.

Claims

A method of producing a pig having improved characteristics, comprising the step of modifying the sequence in intron 3 of the porcine IGF2 gene by gene editing.
The method of claim 1, wherein the modification results in a nucleotide substitution in intron 3 of the IGF2 gene, for example, the nucleotide 3302 of intron 3 of the IGF2 gene is substituted with A.
The method of claim 1, wherein said modification results in a nucleotide insertion in intron 3 of the IGF2 gene, for example, said modification results in a sequence within position 3068-3073 of the IGF2 gene intron 3 or at its flanks Nucleotide insertion.
The method of claim 1, wherein said modification results in deletion of a nucleotide in intron 3 of the IGF2 gene, for example, said nucleotide deletion comprises

a) nucleotide 3072 of intron 3 of the pig IGF2 gene;

b) a sequence at positions 3068-3073 of intron 3 of the porcine IGF2 gene, eg SEQ ID NO: 12;

c) the sequence of one of SEQ ID NOs: 13-16.
The method of claim 1 which comprises introducing into a pig a gene editing system that targets sequences in intron 3 of the porcine IGF2 gene.
The method of claim 5, wherein said gene editing system targets a sequence comprising nucleotides 3072 in intron 3 of the porcine IGF2 gene or flanking the 3072th nucleotide in intron 3 of the porcine IGF2 gene. sequence.
The method of claim 5, wherein the gene editing system comprises a CRISPR nuclease or an expression construct encoding the CRISPR nuclease, and a guide RNA or an expression construct encoding the guide RNA.
The method of claim 7, wherein the CRISPR nuclease is a CRISPR nickase such as a Cas9 nickase.
The method of claim 7 or 8, wherein said gene editing system comprises two guide RNAs, or expression constructs encoding said two guide RNAs, each of which targets the porcine IGF2 gene intron 3 Flanking sequences upstream and downstream of nucleotide position 3072.
The method of claim 9, wherein the two guide RNAs respectively target the sequences SEQ ID NO: 1 and SEQ ID NO: 2 in intron 3 of the porcine IGF2 gene.
The method of claim 1, which comprises introducing the gene editing system targeting the sequence in intron 3 of the porcine IGF2 gene into a fertilized egg or embryo of a pig, and then transferring the fertilized egg or embryo to the recipient The surrogate pigs were used to produce pigs in which the sequence in intron 3 of the IGF2 gene was modified.
The method according to any one of claims 1 to 11, wherein the pig to be modified has a G at position 3072 of intron 3 of the IGF2 gene, for example, the pig is selected from the group consisting of a Bama pig, a pig, and a Meishan pig. Wuzhishan pig, preferably Bama pig.
A pig having improved characteristics produced by the method of any one of claims 1 to 12 or a progeny thereof, a germ cell, an embryo, an isolated somatic cell, a tissue or a cell, wherein the pig has an IGF2 gene intron 3 The sequence is modified.
A meat product derived from a pig having improved characteristics produced by the method of any one of claims 1 to 12 or a progeny thereof, wherein the sequence in the intron 3 of the IGF2 gene in the pig is modified.
A kit for producing a pig having improved characteristics by the method of any one of claims 1 to 12, comprising a gene editing system that targets a sequence in intron 3 of the porcine IGF2 gene.
Use of a pig or its progeny, germ cells, embryos, isolated somatic cells, tissues or cells produced by the method of any of claims 1-12, for example for pig breeding or for pork production.