CN117051143A

CN117051143A - Method for rapidly detecting toxoplasmosis nucleic acid based on CRISPR-Cas14a1 system and kit for detecting toxoplasmosis

Info

Publication number: CN117051143A
Application number: CN202310541897.8A
Authority: CN
Inventors: 杜忆南; 王小凤; 程苗; 李倩; 邢晨; 杨树起; 祝亚亭
Original assignee: Anhui Medical University
Current assignee: Anhui Medical University
Priority date: 2023-05-15
Filing date: 2023-05-15
Publication date: 2023-11-14

Abstract

A method for rapidly detecting toxoplasmosis nucleic acid based on a CRISPR-Cas14a1 system and a kit for detecting toxoplasmosis. The invention includes extracting nucleic acid from sample to be detected, purifying Cas14a1 protein, and purifying toxoplasma gondiiB1Analyzing a gene sequence, and designing a specific CRISPR-Cas14a1 detection site and a RAA isothermal amplification primer; preparing a CRISPR reaction system, adding a to-be-detected nucleic acid product amplified by RAA into the CRISPR reaction system, and incubating at 37 ℃ for 30 minutes, wherein the detection result can be directly read by fluorescence or naked eyes. The rapid detection method and the kit can rapidly detect whether toxoplasma nucleic acid exists in the sample to be detected, and are more rapid than the traditional methodConvenient, has the characteristics of low cost, simple operation, high sensitivity, strong specificity, suitability for toxoplasmosis screening in resource-limited environments, and the like.

Description

Method for rapidly detecting toxoplasmosis nucleic acid based on CRISPR-Cas14a1 system and kit for detecting toxoplasmosis

Technical Field

The invention belongs to the technical field of genes, and particularly relates to a method for rapidly detecting toxoplasmosis nucleic acid based on a CRISPR-Cas14a1 system and a kit for detecting toxoplasmosis.

Background

Toxoplasmosis is a zoonosis caused by Toxoplasma gondii which is parasitic in specific cells, and is distributed worldwide. Toxoplasma is a cat-terminated host that infects all warm-blooded animals, including humans. Infection of toxoplasma gondii in immunocompromised persons is often a mild "flu-like" symptom that disappears after weeks to months. When the immune function of patients is low, such as AIDS patients, the elderly, immunosuppressant users, etc., infection of toxoplasma can cause other serious lesions and even death. Pregnant women, if infected with toxoplasma during pregnancy, cause congenital toxoplasmosis in the fetus and even miscarriage, malformed or stillbirth. In livestock, the infection of toxoplasma can lead to abortion and stillbirth of female animals, explosive infection can occur in farms, and the death rate is extremely high.

Toxoplasmosis seriously threatens the health of humans and animals and the development of animal husbandry, but because toxoplasmosis lacks specific clinical symptoms, diagnosis is difficult, so that the establishment of an effective toxoplasmosis detection method is particularly important. Conventional toxoplasmosis detection such as tissue section staining and microscopic detection can be performed to detect the toxoplasmosis, but the operation is time-consuming, and false negative results can occur in light infection. Immunological detection including ELISA is the most common method for detecting toxoplasmosis, mainly detecting toxoplasmosis IgM antibodies, is simple to operate, and can rapidly obtain results, but the method is interfered by various factors, such as false positive of rheumatoid factor positive patients.

The CRISPR (Clustered regularly interspaced short palindromic repeats) system, which is reported in recent years to originate from bacteria and archaebacteria and is similar to the "acquired immune system", is a defense mechanism for bacteria. CRISPR-Cas systems are divided into different classes 1 (class I, III, IV and class 2 (class II, V, VI). Wherein the CRISPR-Cas12F family related effector proteins of the V-F subtype are divided into Cas12F1 (class Cas14a and V-U3), cas12F2 (Cas 14 b) and Cas12F3 (class Cas14c, V-U2 and U4). Most proteins of the Cas12F family are only 400 to 700 amino acid residues in size compared to other typical class II nucleases (Cas 9, cas12 and Cas 13), almost half as large as Cas9 or Cas12 nucleases, which are currently the smallest proven RNA-guided nucleases, for example, doudna team extracts DNA from saliva of blue eye and brown eye population and carries out HERC2 gene amplification, then Cas14a1 (Cas 12F 1) -DETECTR is used for detection, and the genotypes of blue eyes and brown eyes are successfully distinguished, only 1 base difference exists in the gene sequences of the eyes with 2 colors, and single base resolution is specifically achieved.

Disclosure of Invention

The invention aims to provide a method for rapidly detecting toxoplasmosis nucleic acid based on a CRISPR-Cas14a1 system and a kit for detecting toxoplasmosis.

To achieve the above and other related objects, the present invention provides the following technical solutions: a kit for rapid detection of toxoplasmosis based on a CRISPR-Cas14a1 system, the kit comprising:

a set of primers for amplifying toxoplasma gondii conserved target gene by RAA:

RAA upstream primer:

5’-gtgttcgtctccattccgtacagtcttcaa-3’；

RAA downstream primer:

5’-ttcgtgatggcgcgttttgccttctctttg-3’；

an sgRNA sequence for specifically detecting a toxoplasma gondii conserved target gene:

5’-TAATACGACTCACTATAGGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAAA GCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGT CGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTgaaaGAATGAAGGA ATGCAACgcctcaatagcaggatgacg-3’；

DNA fluorescent probe:

5’-FAM-TTTTTTTTTTTT-BHQ1-3’；

cas14a1 protein.

The preferable technical scheme is as follows: the kit further comprises: buffer A Buffer, buffer B Buffer, protease lyophilized powder (purchased from Hangzhou Biotechnology Co., ltd.) and CRISPR-Cas14a1 system.

The preferable technical scheme is as follows: the kit further comprises: 5 XMMLV RT buffers and miRNART primers.

To achieve the above and other related objects, the present invention provides the following technical solutions: a method for rapid detection of toxoplasma nucleic acid based on CRISPR-Cas14a1 system for non-diagnostic purposes, comprising the steps of:

step 1: extracting nucleic acid from a sample to be detected by using a DNA extraction kit to obtain nucleic acid to be detected;

step 2: firstly, adding 41.5 mu L of Buffer A Buffer, 4 mu L of RAA upstream primer and RAA downstream primer mixture into a reaction tube filled with freeze-dried powder, then adding 2.5 mu L of Buffer B Buffer into the tube cover (inside) of the reaction tube, and finally adding 2 mu L of nucleic acid to be detected into the reaction tube; covering a tube cover on the reaction tube, uniformly mixing, and performing RAA amplification reaction on the nucleic acid to be detected to obtain an RAA amplification product;

the buffer A solution configuration method comprises the following steps: to 1L of water was added 50mmol of Tris buffer, 100nmol of potassium acetate, 20g of polyethylene glycol powder and 2mmol of dithiothreitol; the BufferB solution was a 280mM magnesium acetate solution.

RAA upstream primer:

5’-gtgttcgtctccattccgtacagtcttcaa-3’；

RAA downstream primer:

5’-ttcgtgatggcgcgttttgccttctctttg-3’

step 3: configuring a CRISPR reaction system: 500nM of sgRNA, RAA amplification product, 500nM of Cas14a1 protein, 100uM of DNA fluorescent probe, 10mM Tris-HCl,50 mM NaCl aqueous solution, 10mM MgCl ₂ Mixing the aqueous solution with the concentration of 100 mug/ml Recombinant Albumin with nuclease-free water to obtain a CRISPR reaction system;

sgRNA:

DNA fluorescent probe:

5’-FAM-TTTTTTTTTTTT-BHQ1-3’；

step 4: incubating the CRISPR reaction system at 37 ℃ for 30 minutes in a fluorescence quantitative PCR instrument, and simultaneously recording fluorescence; judging according to the signal value of the fluorescent group of the CRISPR reaction system, or directly observing the change of the fluorescence of the reaction tube by naked eyes.

1. The fluorescence quantitative PCR instrument reads the fluorescence value under the FAM channel, incubates for 20 cycles at 37 ℃, and collects fluorescence data every 2 minutes; judging the B1 gene detection result according to the final fluorescence signal intensity, namely, judging that the fluorescence value is larger than 3000 to represent B1 detection positive, the fluorescence value is smaller than 2000 to represent B13 detection negative, if the fluorescence value is between 2000 and 3000, re-detecting once is needed, and if the fluorescence value is still between 2000 and 3000, judging that the B1 detection positive;

2. after the reaction is finished, the reaction tube is placed under ultraviolet excitation light to observe the color change to determine the detection result; the reaction tube with positive B1 detection shows green fluorescence, and the reaction tube with negative B1 detection shows no fluorescence.

Due to the application of the technical scheme, compared with the prior art, the invention has the advantages that:

the invention has the advantages of high detection speed, high accuracy and lower cost, and the detection mode has low equipment dependence, so that the multi-scene real-time detection can be performed.

Drawings

FIG. 1 schematic diagram of the detection of toxoplasma nucleic acid by Cas14a 1.

FIG. 2 protein purification scheme.

Fig. 3 sensitivity verification.

FIG. 4 is a graph of tachyzoite sensitivity verification.

FIG. 5 is a specificity verification chart.

FIG. 6 is a modeling sample detection graph.

Detailed Description

Further advantages and effects of the present invention will be readily apparent to those skilled in the art from the following disclosure of the present invention by reference to the specific embodiments.

Please refer to fig. 1-6. It should be understood that the structures, proportions, sizes, etc. shown in the drawings are shown only in the drawings and should not be taken as limiting the invention to those having ordinary skill in the art, since modifications, changes in proportions, or adjustments of sizes, etc. could be made without departing from the spirit or essential characteristics of the invention. The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the examples described below were purchased from conventional biochemical reagent stores unless otherwise specified.

The reagents and materials described in the examples below are commercially available unless otherwise indicated.

Example 1: a method for rapidly detecting toxoplasmosis nucleic acid based on a CRISPR-Cas14a1 system and a kit for detecting toxoplasmosis, comprising:

as shown in FIG. 1, the flow and principle of the method for detecting schistosome nucleic acid by CRISPR-Cas14a1 nucleic acid

Pretreatment of animal blood samples to obtain nucleic acids to be detected, followed by isothermal amplification of the nucleic acids to be detected using Phosphorothioate (PT) -modified RAA primers to protect one strand from exonuclease degradation. When incubated at 37 ℃, RAA can rapidly increase the copy number of target DNA, then we add T7 exonuclease to the reaction tube, which acts to degrade the unmodified strand, leaving single-stranded DNA that can be detected by Cas14a1, finally add the obtained DNA amplification product to the formulated CRISP-Cas14a1 reaction system, the trans-cleavage ability of Cas14a1 is activated, the fluorescent reporter is cut off, fluorescence is emitted, and the result is observed by detection of the fluorescent signal of FAM channel by the device, thereby confirming that target DNA is detected.

(1) Extraction of Toxoplasma gondii nucleic acids

Whole blood DNA of the toxoplasma infection mouse model is extracted, and the whole blood DNA is subpackaged and stored in a refrigerator at the temperature of minus 80 ℃ to avoid DNA degradation and used for detecting the subsequent actual sample. The samples were subjected to nucleic acid extraction using a DNA extraction kit, exemplified here by TIANamp Genomic DNA Kit (tengen#dp304). a. 200 mu L of blood sample is taken, three times of volume of erythrocyte lysate is added, and the mixture is inverted and mixed uniformly. b. Add 20. Mu.L of Proteinase K to dissolve and mix well. c. 200. Mu.L of buffer GB was added and mixed well by inversion and left at 70℃for 10min. 200 mu L of absolute ethyl alcohol are fully and uniformly mixed for 15sec by shaking. e. Adding the solution obtained in the last step into an adsorption column CB3 (the adsorption column is placed in a collecting pipe), centrifuging at 12000rpm for 2min, and discarding the waste liquid. f. To the adsorption column CB3, 500. Mu.L of the buffer solution GD was added, and the mixture was centrifuged at 12000rpm for 30sec, whereby the waste liquid was discarded. g. 600. Mu.L of the rinse PW was added to the column CB3, centrifuged at 12000rpm for 30sec, and the waste liquid was discarded. h. The above steps are repeated. i.12000rpm, centrifuging for 2min, and discarding the waste liquid. j. The mixture was left at room temperature for several minutes. k. Transferring the adsorption column CB3 into a clean centrifuge tube, placing 50-200 mu L of elution buffer TE at room temperature for 2-5min at 12000rpm, centrifuging for 2min, collecting the solution into the centrifuge tube, and preserving under proper conditions.

(2) Design and screening of Cas14a1sgRNA

In order to obtain high-efficiency and specific sgrnas, we compare B1 gene with other sequences in a database on the basis of multicopy genes to screen out a target region that is conserved and not easily mutated, and we design 3 sgrnas in total according to the existing design experience. In vitro transcription of sgrnas: the single-stranded DNA template of the sgRNA is synthesized, then the in vitro transcription of the RNA is carried out, and finally the sgRNA for detection can be obtained through purification.

sgRNA:

5’-TAATACGACTCACTATAGGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAA AGCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAAT GTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTgaaaGAATGAAG GAATGCAACgcctcaatagcaggatgacg-3’；

(3) Expression and purification of Cas14a1 proteins

Cas14a1 plasmid (Addgene plasmid number 112500), an expression vector containing an N-terminal 10×his-tag, MBP and TEV protease cleavage site was transformed into competent cells e.collbl21 (DE 3), the cells were cultured in LB medium at 37 ℃ for 7h, after the cells reached the logarithmic growth phase, the cells were grown according to 1:200 was transferred into 400mLB medium, 16℃at 200rpm, cultured overnight, and the cells were collected and centrifuged. The supernatant was discarded and resuspended in Lysis buffer (50 nM Tris-HCl,500mM NaCl,5% (v/v) glycol, 1mM TCEP,0,5mM PMSF and 0.25mg/ml lysozyme, pH 7.5), followed by sonication (disruption for 10min,100 amplitude 1s, batch 2 s), the pellet was removed by centrifugation (10000 g,4 ℃ C., 1 h) from the liquid obtained after disruption, and the centrifuged protein supernatant was filtered using a bacterial filter with a pore size of 0.22. Mu.m. The filtrate was applied to a Ni-NTA purification resin pre-packed column (Sangon Biotech, cat# C600791-0010), and after washing off the impurity band by Binding/Wash Buffer (cat# C600303-0500), elution was performed using an Elutation Buffer (cat# C600304-0500). Then pass throughThe Ultra-4 centrifugal filtration device (Millipore, UFC 8003) was used for protein concentration and buffer was replaced with final buffer for Cas14a1 (20 mM Tris-HCl,2.0M NaCl, PH8.5), and Cas14a1 was assayed for concentration by BCA method, identified by SDS-PAGE and stored at-20 ℃.

(4) RAA primer design

The RAA reaction can exponentially amplify target DNA in a short time, and a protein-DNA complex formed by combining a recombinase and a primer can search for homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a strand exchange reaction is generated to form and start DNA synthesis, and the target area on the template is amplified exponentially, so that the effect of amplifying signals and improving detection sensitivity is achieved. RAA primers were designed on the SnapGene software. Specificity of designed RAA primers and toxoplasma genome candidate target sequences was analyzed using BLAST and sequence alignment.

The RAA primer design followed the following principle: 1) The primer is 30-35 bases long. 2) The GC content of the primer is 30% < GC < 70%. 3) The length of the amplified product ranges from 100bp to 200bp, and the optimal effect is achieved. 4) Amplified regions require GC content of 40% < GC < 60% avoiding single repeat sequences. 3 upstream primers and 3 downstream primers are respectively designed for each amplification site, and a 3×3 amplification primer library is formed for optimal primer set screening.

The invention designs 3 groups of primers aiming at toxoplasma B1 genes, and the optimal primers are obtained by screening as follows:

RAA upstream primer:

5’-gtgttcgtctccattccgtacagtcttcaa-3’

RAA downstream primer:

5’-ttcgtgatggcgcgttttgccttctctttg-3’

(5) RAA nucleic acid amplification

The Hangzhou public detection RAA nucleic acid amplification kit is used for nucleic acid isothermal amplification. The total reaction system for amplification was 50. Mu.l, 41.5. Mu.l Buffer A solution, 4. Mu.l upstream and downstream primers each were 20. Mu.M, diluted 2. Mu.l template DNA was added to a RAA reaction tube containing enzyme lyophilized powder, 2.5. Mu.l volume of Buffer B solution was then added to the tube cap of the reaction tube, the tube cap was capped, and mixed up and down upside down for 5-6 times, the RAA reaction was activated at this time, the reaction tube was water-bath at 37℃for 30 minutes, and the obtained nucleic acid amplification product was used for subsequent CRISPR detection. Then we add 5U T7 exonuclease to the reaction tube, degrading the unmodified strand.

(6) Configuring CRISPR reaction system for rapid toxoplasma nucleic acid detection

The CRISPR reaction was performed in 200 μl of quantitative PCR octamer, and the formulation of the reaction system was required in an enzyme-free environment. The metal PCR tube rack is put into a refrigerator with the temperature of minus 80 ℃ in advance for precooling, and then the following systems are prepared on the cooled PCR tube rack: 500nM Cas14a1, 500nM sgRNA, 10mM Tris-HCl,50 mM NaCl, 10mM MgCl2 at a concentration of 100. Mu.g/ml Recombinant Albumin, and finally 20. Mu.l of RNase-free water were made up. After incubation at 37℃for 10 minutes, 500nM of DNA fluorescent probe (5 '-FAM-TTTTTTTTTTTT-BHQ 1-3';) was added. To 18ul of the above reaction system, 2. Mu.l of RAA amplification product was added, and fluorescence was monitored in FAM channel using BioRad CFX96, and the fluorescence value was read.

RNA fluorescent probe:

5’-FAM-TTTTTTTTTTTT-BHQ1-3’；

(7) Fluorescence detection and result reading

Mu.l of RAA amplification product was added to 18ul of the reaction system and incubated at 37℃for 20 minutes. Fluorescence values at FAM channels (FAM channels, corresponding to channels from which qPCR instruments read fluorescence at wavelengths 450nm-490 nm) can be read using BioRad CFX96 at the beginning of the CRISPR reaction incubation, with 20 cycles of incubation at 37 ℃ and fluorescence data collected every 2 minutes at intervals. Judging the B1 gene detection result according to the final fluorescence signal intensity, namely, judging that the fluorescence value is larger than 3000 to represent B1 detection positive, the fluorescence value is smaller than 2000 to represent B1 detection negative, if the fluorescence value is between 2000 and 3000, re-detecting once is needed, and if the fluorescence value is still between 2000 and 3000, judging that the B1 detection positive; the test tube can also be observed under ultraviolet excitation light after the reaction is completed, and the detection result can be read by naked eyes. The EP tube in which the B1 gene is detected emits yellow-green fluorescence under excitation light, and the EP tube in which the B1 gene is not detected emits fluorescence. The detection result was determined by comparing the presence or absence of fluorescence of the EP tube.

Establishment of method for rapid nucleic acid detection diagnosis of toxoplasmosis by CRISPR-Cas14a1 system

1. Material

RAA amplification primers, sgRNA and single-stranded probes were synthesized by Nanjing Optimaceae, nanjing Style biosystems. RAA nucleic acid-based amplification kits were purchased from Hangzhou mass biosciences. Cas14a1 protein purification experiments.

2. Method and results

2.1: protein purification

Cas14a1 plasmid (112500), an expression plasmid vector containing an N-terminal 10 xhis-tag, MBP and TEV protease cleavage site was transformed into competent cells e.collbl21 (DE 3) and induced with 0.5mM IPTG in LB medium, grown to od600=0.5. Competent cells were grown at 18 ℃At night, collected by centrifugation, resuspended in lysis buffer (50 mM Tris-HCl,500mM NaCl,1mM TCEP,5% (v/v) glycol, 0.5mM PMSF,0.25mg/ml lysozyme,20mM imidazole,pH 7.5) and subjected to sonication, the resulting liquid after lysis was centrifuged to remove the precipitate, and the centrifuged protein supernatant was filtered using a bacterial filter. The supernatant was incubated with equilibration buffer (50 mM Tris-HCl, pH 7.5, 20mM imidazole, 0.5mM TCEP,500mM NaCl) 1:1 binding was added to Ni-NTA resin in portions, washed with the equilibration buffer described above and eluted with elution buffer (50 mM Tris-HCl, pH 7.5, 300mM imidazole, 0.5mM TCEP,500mM NaCl) after loading was complete. Eluent passingThe Ultra-4 centrifugal filtration apparatus (Millipore, UFC 8003) was desalted and concentrated, and the buffer was replaced with the final buffer of cas14a1 (20 mM Tris-HCl,200mM Nacl,0.5mM TCEP,PH8.5), the concentration was determined by BCA method, identified by SDS-PAGE, and stored at-20℃for use.

As shown in fig. 2

2.2: RAA primer design

According to the published toxoplasma B1 gene sequence in GenBank (GenBank accession number is AF 179871), B1 site RAA amplification primers are designed, and an upstream primer and a downstream primer corresponding to each target site are designed according to the RAA requirement, wherein the specific sequences are shown in the following table:

RAA primer name	Sequence (5 '-3')
		An upstream primer:	5’-gtgttcgtctccattccgtacagtcttcaa-3’；
a downstream primer:	5’-ttcgtgatggcgcgttttgccttctctttg-3’；

2.3 design and screening of Cas14a1sgRNA

We constructed plasmid standards for B1 gene for screening sgRNA.

The final designed sgRNA detection sites of the invention are as follows:

B1:

5’-TAATACGACTCACTATAGGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTgaaaGAATGAAGGAATGCAACgcctcaatagcaggatgacg-3’；

2.4CRISPR-Cas14a1 nucleic acid detection toxoplasmosis sensitivity verification

After determining the optimal reaction system components for the CRISPR-Cas14a1 detection method, the in vitro transcribed toxoplasma B1 fragment DNA template was used to gradient dilute to 7 different concentration gradients: the sensitivity of the detection method is verified by detecting the diluted templates with different concentrations. From the figure, the sensitivity of detecting toxoplasmosis B1 site by CRISPR-Cas14a1 nucleic acid in the present invention is: 10aM.

As shown in fig. 3

2.5CRISPR-Cas14a1 nucleic acid detection of Toxoplasma gondii tachyzoites sensitivity verification

This patent also extracts 10 ⁷ DNA of the tachyzoites of Toxoplasma gondii, pair 10 using CRISPR-Cas14a1 detection System ⁵ ～10 ^-1 The detection of the diluted toxoplasma tachyzoite DNA was limited to 1 tachyzoite per reaction. Can be detected even under the condition that the concentration of toxoplasma in the sample is extremely low.

As shown in fig. 4

2.6 detection of toxoplasmosis by CRISPR-Cas14a1 nucleic acid specificity verification

To verify the specificity of the method for toxoplasma detection, we selected plasmodium, cryptosporidium and babesia, which are similar to toxoplasma habit or infection symptoms, to perform specific detection, the CRISPR-Cas14a1 detection system of toxoplasma only shows positive to toxoplasma DNA, and the fluorescence values of the other three protozoa are consistent with that of the negative control group, so that the method has no cross reaction with toxoplasma DNA.

As shown in fig. 5

2.7CRISPR-Cas14a1 nucleic acid detection of toxoplasmosis actual sample verification

The method establishes an animal model of toxoplasmosis of 1000 RH tachyzoites infected mice, utilizes a CRISPR-Cas14a1 toxoplasmosis rapid detection method to detect whole blood of the infected mice, and results show that 15 blood samples of the mice infected with 1000 RH tachyzoites can detect toxoplasmosis DNA from the 1 st, 3 rd and 5 th days, and 5 blood sample control groups injected with physiological saline are all negative.

As shown in FIG. 6

Fig. 1: flow and principle of method for detecting toxoplasmosis by CRISPR-Cas14a1 nucleic acid

Pretreatment is carried out on an animal blood sample to obtain nucleic acid to be detected, and isothermal amplification and decomposition are carried out on the nucleic acid to be detected by using RAA primer modified by Phosphorothioate (PT). When the RAA is incubated at the constant temperature of 37 ℃, the copy number of target DNA can be rapidly increased, finally, the obtained DNA amplification product is added into a prepared CRISPR-Cas14a1 reaction system, the trans-cleavage capacity of the Cas14a1 is activated, a fluorescent reporter molecule is cut off, fluorescence is emitted, and the result is observed through two methods of detection or fluorescence visualization of a fluorescence signal of a FAM channel by equipment.

Fig. 2: CRISPR-Cas14a1 protein purification

The Cas14a1 expression plasmid vector was transformed into competent cells, induced to express and grown overnight in LB medium, the supernatant was collected by centrifugation sonication lysis, and the centrifuged protein supernatant was filtered using a bacterial filter. Purifying and expressing the Cas14a1 protein through the steps of column loading, impurity washing, eluting, desalting, concentrating and the like. Identification was performed by SDS-PAGE.

Fig. 3: CRISPR-Cas14a1 toxoplasmosis detection sensitivity verification

The sensitivity of the detection method is verified by detecting the diluted templates with different concentrations. From the figure, the sensitivity of detecting toxoplasmosis B1 site by CRISPR-Cas14a1 nucleic acid in the present invention is: 10aM

Fig. 4: CRISPR-Cas14a1 detection toxoplasma tachyzoite sensitivity verification

Pair 10 using CRISPR-Cas14a1 detection system ⁵ ～10 ^-1 The detection of the diluted toxoplasma tachyzoite DNA was limited to 1 tachyzoite per reaction.

Fig. 5: CRISPR-Cas14a1 nucleic acid detection toxoplasmosis specificity verification

The CRISPR-Cas14a1 detection system only shows positive DNA of toxoplasma, and has fluorescence values of plasmodium, cryptosporidium and babesia for other three protozoa consistent with that of a negative control group, so that the CRISPR-Cas14a1 detection system has no cross reaction with toxoplasma DNA.

Fig. 6: actual sample verification

The method for rapidly detecting the toxoplasma gondii by using the CRISPR-Cas14a1 is used for detecting whole blood of the infected mice, and the result shows that 15 blood samples of the infected mice on the 1 st day, the 3 rd day and the 5 th day can detect toxoplasma gondii DNA, and the 5 blood sample control groups injected with physiological saline are negative.

The foregoing description of the preferred embodiment of the invention is not intended to be limiting in any way, but rather, it is intended to cover all modifications or variations of the invention which fall within the spirit and scope of the invention.

Claims

1. A kit for rapidly detecting toxoplasmosis based on a CRISPR-Cas14a1 system is characterized in that: the kit comprises:

a set of primers for amplifying toxoplasma gondii conserved target gene by RAA:

RAA upstream primer:

5’- gtgttcgtctccattccgtacagtcttcaa-3’；

RAA downstream primer:

5’- ttcgtgatggcgcgttttgccttctctttg -3’；

DNA fluorescent probe:

5’-FAM-TTTTTTTTTTTT-BHQ1-3’；

cas14a1 protein.

2. The kit for rapid detection of toxoplasmosis based on the CRISPR-Cas14a1 system according to claim 1, characterized in that: the kit further comprises: buffer A Buffer, buffer B Buffer, protease lyophilized powder and a reaction system for detecting the CRISPR-Cas14a1 system.

3. The kit of claim 1, wherein: the kit further comprises: 5×mmlv RT buffers and miRNA RT priorities.

4. A method for rapidly detecting toxoplasma nucleic acid based on a CRISPR-Cas14a1 system for non-diagnostic purposes, which is characterized in that: comprises the following steps:

step 2: firstly, adding 41.5 mu L of Buffer A Buffer, 4 mu L of RAA upstream primer and RAA downstream primer mixture into a reaction tube filled with freeze-dried powder, then adding 2.5 mu L of Buffer B Buffer into the tube cover of the reaction tube, and finally adding 2 mu L of nucleic acid to be detected into the reaction tube; covering a tube cover on the reaction tube, uniformly mixing, and performing RAA amplification reaction on the nucleic acid to be detected to obtain an RAA amplification product;

RAA upstream primer:

5’-gtgttcgtctccattccgtacagtcttcaa-3’；

RAA downstream primer:

5’- ttcgtgatggcgcgttttgccttctctttg -3’

step 3: configuring a CRISPR reaction system: 500nM of sgRNA, RAA amplification product500nM Cas14a1 protein, 100uM DNA fluorescent probe, 10 Tris-HCl concentration mM, 50mM NaCl aqueous solution, 10mM MgCl concentration ₂ Mixing the aqueous solution with the concentration of 100 mug/ml Recombinant Albumin with nuclease-free water to obtain a CRISPR reaction system;

sgRNA :

DNA fluorescent probe:

5’-FAM-TTTTTTTTTTTT-BHQ1-3’ ；

step 4: incubating the CRISPR reaction system at 37 ℃ for 30 minutes in a fluorescence quantitative PCR instrument, and simultaneously recording fluorescence; judging according to the signal value of the fluorescent group of the CRISPR reaction system, or directly observing the change of the fluorescence of the reaction tube by naked eyes;

(1) The fluorescence quantitative PCR instrument reads the fluorescence value under the FAM channel, incubates for 20 cycles at 37 ℃, and collects fluorescence data every 2 minutes; judging the B1 gene detection result according to the final fluorescence signal intensity, namely, judging that the fluorescence value is larger than 3000 to represent B1 detection positive, the fluorescence value is smaller than 2000 to represent B13 detection negative, if the fluorescence value is between 2000 and 3000, re-detecting once is needed, and if the fluorescence value is still between 2000 and 3000, judging that the B1 detection positive;

(2) After the reaction is finished, the reaction tube is placed under ultraviolet excitation light to observe the color change to determine the detection result; the reaction tube with positive B1 detection shows green fluorescence, and the reaction tube with negative B1 detection shows no fluorescence.