CN106755598A - Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus - Google Patents
Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus Download PDFInfo
- Publication number
- CN106755598A CN106755598A CN201710100714.3A CN201710100714A CN106755598A CN 106755598 A CN106755598 A CN 106755598A CN 201710100714 A CN201710100714 A CN 201710100714A CN 106755598 A CN106755598 A CN 106755598A
- Authority
- CN
- China
- Prior art keywords
- seq
- reaction
- primer
- fluorescence
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus, sequence is：SEQ ID NO：1、SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQ ID NO：6；Detection method includes：Reaction is placed in 60 DEG C to 65 DEG C of reaction environment and is incremented by with 1 DEG C and optimized, optimal reaction temperature is determined from being repeated several times in experiment；Reaction condition is adjusted to 63 DEG C of 1min of holding stage on fluorescent PCR instrument；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel elects FAM as.The present invention carries out phosphor collection using instrument, and the sensitivity of detection is further improved, more objective, easy to operate, easily standardization, it is easy to promote the use of.
Description
Technical field
It is the invention belongs to the sick virus detection techniques field of shrimp cream head more particularly to a kind of for detecting shrimp cream head disease virus
Fluorescence LAMP primer and its detection method.
Background technology
Yellow head disease (Yellow Head Disease, YHD) is drawn by yellow head virus (Yellow Head Virus, YHV)
The prawn communicable disease for rising, yellow head virus belong to shell type virales (Nidovirales) rod set Viraceae (Roniviridae)
The single strand RNA virus of helmet Tobamovirus (Okavirus), because dying shrimp cephalothorax because hepatopancrease turn to be yellow and yellowing, be referred to as
Yellow head disease.Yellow head virus infectious rate is very high, and there was only several days time from prawn infection to the time of dead experience, to aquaculture
Personnel bring huge economic loss.1992, Thailand caused the kiloton of the underproduction five, economy to be damaged because prawn has infected yellow head virus
It is weightless big.The phenomenon of abnormal a large amount of feeds occurs at 2~4 days of initial infection for the disease, then almost stops completely
Feed, next will find that a large amount of dying shrimps can be only gathered in around the water surface of culturing pool or pond, serious
Shrimp substantially all death in 3 days in full pond can be made during morbidity, the death rate is very high.China is classified as two class epidemic diseases, and the world is moved
Being classified as must notifiable epidemic disease for thing health organization (Office International des Epizooties, OIE).
The yellow head virus group for knowing has six kinds, is divided into YHV (YHV-1 types), gill connection viral (Gill-associated virus, GAV)
(YHV-2 types) and other 4 kinds of genotype (YHV-3 type-YHV-6 types).Wherein YHV-3 types-YHV-6 types are common in East Africa, Asia
With the healthy Penaeus monodon of Australia, show as seldom or never triggering disease.YHV can survive in the seawater three days with
On, can be inactivated within 15 minutes at 60 DEG C.Up to now, detection method both at home and abroad for YHV is at present and few, wherein
Molecules detection method is mainly liquid phase genetic chip method and RT-PCR methods, OIE《Aquatic animal diagnoses handbook》(OIE, 2012)
What is recommended is RT-PCR methods, but needs follow-up processing procedure, complex steps, and time-consuming also more long, workload is larger.And it is glimmering in real time
The development of light RT-PCR technology, makes virus detection techniques obtain further raising, this detection technique be also applied to IHNV,
In the detection of VHSV and SVCV.Real-time fluorescence RT-PCR technology further increases the specificity of detection, sensitivity, reduces work
Measure, improve operating efficiency, but also quantitative determination, but TaqMan fluorescence RT-PCRs can be carried out to purpose fragment due to making
Fluorescence probe, its cost is high compared with regular-PCR.
In sum, there are complex steps in the detection method of existing shrimp cream head disease virus, take it is also more long, workload compared with
Greatly, it is relatively costly.
The content of the invention
It is an object of the invention to provide a kind of fluorescence LAMP primer for detecting shrimp cream head disease virus and its detection side
Method, it is intended to which the detection method for solving existing shrimp cream head disease virus has complex steps, and time-consuming also more long, workload is larger, into
This problem higher.
The present invention is achieved in that a kind of fluorescence LAMP primer for detecting shrimp cream head disease virus, described for examining
The sequence of fluorescent primer for surveying shrimp cream head disease virus is：SEQ ID NO：1、SEQ ID NO：2、SEQ ID NO：3、SEQ ID
NO：4、SEQ ID NO：5、SEQ ID NO：6.
Another object of the present invention is to provide a kind of described fluorescence LAMP primer for detecting shrimp cream head disease virus
Method for designing, the method for designing comprises the following steps：
According to LAMP primer design principle, according to YHV genome sequences are downloaded in GenBank databases, multisequencing is carried out
Compare, one section of conservative gene of YHV is found as amplification object, then by molecular biology software LAMP
Designer1.1.4 designs primer；Using HPLC way of purification；It is molten that primer after synthesis is diluted to 100 μm of ol/L with DEPC water
Liquid, -20 DEG C save backup.
Another object of the present invention is to provide described in a kind of utilization for detecting shrimp cream head virus fluorescence LAMP primer
Detection method for detecting shrimp cream head virus, it is described for detecting that the detection method of shrimp cream head virus is comprised the following steps：
Step one, the nucleic acid extraction of sample：According to nucleic acid extraction kit Mag-BindViral DNA/RNA Kit
(200) specification extracts sample nucleic；
Step 2, into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein 2 × Taq reaction solutions RM
12.5 μ L, inner primer FIP, BIP40 μm ol/L each 1.0 μ L, ring primer LF and LB each 1.0 μ L, outer primer F3, B35 μm ol/L are each
1.0 μ L, Bst DNApolymerase 0.8 μ L, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of RNA template 2.0, moisturizing is extremely
25.0μL.Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
Step 3, instrument detection：Reaction is placed in 60 DEG C to 65 DEG C of reaction environment and is incremented by with 1 DEG C and optimized,
Determine optimal reaction temperature from being repeated several times in experiment；Reaction condition is adjusted to 63 DEG C of 1min of holding stage on fluorescent PCR instrument,
1 circulation；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel is elected as
FAM。
Provided by the present invention for the fluorescence LAMP primer and its detection method of detection shrimp cream head disease virus, the primer can be with
6 specific regions on target sequence combine, therefore specificity is higher than traditional fluorescence PCR method；And the addition without probe,
So that cost is substantially reduced.It is contemplated that setting up a kind of quick, accurate, simple to operation shrimp cream head virus detection method；
Loop-mediated isothermal amplification technique (1oop-mediated isothermal amplification, LAMP) is Japanese Notomi etc.
In a kind of new nucleic acid amplification technologies of report in 2000.Compared with traditional amplification technique, the specificity of technology amplification is more
By force, course of reaction 30~60min need to can only be completed under 60~65 DEG C of constant temperature, it is not necessary to thermal cycle.Due to reaction
During need not open test tube cap, therefore greatly reduce the possibility of laboratory pollution, and with reproducible, specially
The features such as strong, susceptibility of property is high and easily operated.The present invention is that fluorescent dye is introduced on the basis of original LAMP technology, is set up
Fluorescence LAMP detection techniques, due to carrying out phosphor collection using instrument, the sensitivity of detection is further improved, more objective,
Operation is easier, easily by methodological standardization, it is easy to promote the use of.
Brief description of the drawings
Fig. 1 is the detection method flow for detecting the fluorescent primer of shrimp cream head disease virus provided in an embodiment of the present invention
Figure.
Fig. 2 is yellow head virus OIE methods clinical test schematic diagram provided in an embodiment of the present invention；
In figure：1-10：Shrimp sample；M：DL-2000DNAMarker；N：Negative control；P：Positive control.
Fig. 3 is that yellow head virus LAMP detection method provided in an embodiment of the present invention sets up schematic diagram；
In figure：P positive controls；N：Negative control.
Fig. 4 is yellow head virus LAMP method specific test schematic diagram provided in an embodiment of the present invention；
In figure：1-10：Shrimp tissue sample；N：Negative control；P：Positive control.
Fig. 5 is yellow head virus LAMP method sensitivity technique schematic diagram provided in an embodiment of the present invention；
In figure：1-9：Copy number gradient is followed successively by 109、108、107、106、105、104、103、102、101；N：Negative control.
Fig. 6 is the schematic diagram of detection method stability test 1 provided in an embodiment of the present invention.
Fig. 7 is the schematic diagram of detection method stability test 2 provided in an embodiment of the present invention.
Fig. 8 is sample detection result schematic diagram provided in an embodiment of the present invention；
In figure：1-10：Shrimp sample；N：Negative control；P：Positive control.
Specific embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
Below in conjunction with the accompanying drawings and specific embodiment is further described to application principle of the invention.
It is provided in an embodiment of the present invention for detecting that the sequence of fluorescent primer of shrimp cream head disease virus is：
SEQ ID NO：1
FIP TCATAGACGCCTTCTGGACAGACACAGTCATTCGCATTACAAG
SEQ ID NO：2
BIP TATCGTCCCGGCAATTGTGATCAACCAGTGACGTTCGATG
SEQ ID NO：3
F3CAACATCCTCAAGATGGACAT
SEQ ID NO：4
B3GAATTGTCATGTCTTCATGTGG
SEQ ID NO：5
LF TGTTGTCTGGAGTGATGTCG
SEQ ID NO：6
LB CAACGCCGTCACGTATTG
As shown in figure 1, provided in an embodiment of the present invention for detecting that the detection method of shrimp cream head disease virus includes following step
Suddenly：
S101：The nucleic acid extraction of sample：Said according to nucleic acid extraction kit Mag-BindViral DNA/RNAKit (200)
Bright book extracts sample nucleic；
S102：Into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein 2 × Taq reaction solutions RM
12.5 μ L, inner primer FIP, BIP40 μm ol/L each 1.0 μ L, ring primer LF and LB each 1.0 μ L, outer primer F3, B35 μm ol/L are each
1.0 μ L, Bst DNApolymerase 0.8 μ L, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of viral nucleic acid template 2.0,
Moisturizing is to 25.0 μ L.Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
S103：Instrument is detected：Reaction is placed in 60 DEG C to 65 DEG C of reaction environment and is incremented by with 1 DEG C and optimized, from
It is repeated several times in testing and determines optimal reaction temperature；Reaction condition is adjusted to holding stage 63 DEG C of 1min, 1 on fluorescent PCR instrument
Individual circulation；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel is elected as
FAM。
Application principle of the invention is further described with reference to experiment.
1.1 yellow head disease FLuorescent LAMP detection methods
1.1.1 sample and instrument
1.1.1.1 gene Huang head disease virus O RF1 full genomes synthesize and cloning and sequencing；Taura syndrome NS full genomes synthesize simultaneously
Cloning and sequencing, completes in Shanghai Xu Guan bio tech ltd.
1.1.1.2 sample
10 parts of prawn submitted samples that laboratory preserves, wherein 5 parts of shrimp Leucoplakia Viral diagnosis are positive, 5 parts add peach to draw
Virus N S full genome synthetic plasmids.Verified with method in OIE handbooks, it was demonstrated that whether it contains yellow head disease viral nucleic acid.
Totally 10 parts of the shrimp sample from market is bought, is gathered by this laboratory and in -80 DEG C of Storage in refrigerator.
1.1.1.3 main agents
Nucleic acid constant-temperature amplification kit is purchased from Guangzhou Di Ao Bioisystech Co., Ltd；Nucleic acid extraction kit Mag-
BindViral DNA/RNA Kit (200) are purchased from OMEGA companies.
1.1.1.4 key instrument
ABI 7500Fast Real-Time PCR System, are U.S.'s Applied Biosystems Products.
SIGMA3-18K miniature high-speeds freeze desk centrifuge, are German Sartorius Products.NanoDrop ND-
1000Spectrophotometer ultraviolet specrophotometers, are U.S.'s NanoDrop Technologies Products.Alpha
Imager HP Labworks image acquisition and analysis softwares, are U.S.'s Alpha Innotech Products
1.1.2 method
1.1.2.1LAMP design of primers
According to LAMP primer design principle, according to the genome of the YHV-1 types-YHV-6 types of YHV in GenBank databases
Sequence, through Multiple Sequence Alignment, using ORF1 genes as amplification object, then by molecular biology software LAMP Designer
1.14 design primers.Primer is synthesized by Shanghai Hui Rui bio tech ltd, using HPLC way of purification.Primer after synthesis
100 μm of ol/L solution are diluted to ultra-pure water, -20 DEG C save backup.Primer sequence is shown in Table 1.
The yellow head virus LAMP primer of table 1
1.1.2.2 the RNA of sample is extracted
Method for extracting nucleic acid in nucleic acid extraction agent box specification according to requiring to carry out.
1.1.2.3 fluorescence LAMP reaction systems
Real-time fluorescence LAMP reaction systems cumulative volume is 25 μ L：2 × reaction solution RM 12.5 μ L, inner primer FIP, BIP 40 μ
Mol/L each 1.0 μ L, outer primer F3, B35 μm ol/L each μ L of 1.0 μ L, Bst archaeal dna polymerase 1.0, the μ L of fluorescent dye 0.5, virus
Nucleic acid-templated 2.0 μ L, moisturizing to 25 μ L.Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution.
1.1.2.4 fluorescence LAMP reaction condition optimizations
The Tm values and the suitable reaction temperature of Bst enzymes of the primer according to design, the present invention are placed in 60 DEG C to 65 DEG C to reaction
Reaction environment in and with 1 DEG C be incremented by optimize, from be repeated several times experiment in determine optimal reaction temperature.Finally in fluorescence
Reaction condition is adjusted to 63 DEG C of 1min of holding stage in PCR instrument；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；In 63 DEG C
Fluorescence signal is collected at 45s, fluorescence channel elects FAM as.
1.1.2.5 fluorescence LAMP sensitivity techniques
Using recombinant plasmid as positive criteria product.Plasmid concentration is determined with ultraviolet specrophotometer, according to Avogadro
Constant is scaled the copy number of genes of interest, and with 10 times of gradient dilutions, it is 10 to obtain concentration9To 10 9 moulds of concentration gradient
Plate, LAMP amplifications are carried out using above-mentioned reaction system and reaction condition, to verify the sensitive of designed primer and institute's method for building up
Degree.
1.1.2.6 fluorescence LAMP specific detections
10 parts of shrimp samples with laboratory reservation carry out LAMP expansions as template using above-mentioned reaction system and reaction condition
Increase, to verify the specificity of designed primer and institute's method for building up.
1.2.2.7 fluorescence LMAP stability tests
Take 105The positive control plasmid of concentration, interval is tested for 1 month twice, and 20 repetitions are done every time.Statistic mixed-state
Difference between result.
1.1.2.8 sample detection
After by 10 parts of shrimp sample extraction nucleic acid purchased from market, detected using the method set up.
1.1.3 result and analysis
1.1.3.1 sample the result
All 10 parts of laboratories are preserved sample and are detected using the method provided in OIE handbooks, are not detected by yellow head
Sick virus-positive, is shown in Fig. 2.
1.1.3.2 fluorescence LAMP detection YHV methods are set up
This experiment utilizes fluorescence method, and experiment is seen in real time using ABI ViiA7Real-Time PCR System
Examine.Result shows that positive control amplification curve occurs in 12min or so, and fluorescence increases obvious, and negative control fluorescent value does not show
Write change.See Fig. 3.
1.1.3.3 fluorescence LAMP specific tests
The nucleic acid of shrimp sample extraction is carried out into real-time fluorescence LAMP detections, is as a result shown, except positive control has significantly
Outside amplification curve, 5 parts of Leucoplakia virus-positive samples and 5 parts addition Taura syndrome NS full genome synthetic plasmids the equal nothings of shrimp sample
Amplification, curve is in smooth shape substantially, sees Fig. 4.
1.1.3.4 fluorescence LAMP sensitivity tests
The positive plasmid that will have been diluted according to above-mentioned reaction system and reaction condition, with ABI 7500Fast Real-
Time PCR System carry out result observation, it is found that the minimal detectable concentration of YHV detections has reached 10 orders of magnitude of copy,
See Fig. 5.
1.1.3.5 fluorescence LAMP stability tests
The time point for occurring fluorescence growth in criticizing and between criticizing carries out statistical analysis, variation within batch coefficient is tested twice and is distinguished
It is 2.80% and 2.88%, interassay coefficient of variation is 4.80%, all coefficient of variation are respectively less than 5.00%.Therefore, criticize interior and criticize
Between test stability preferably, see Fig. 6 and Fig. 7.
1.1.3.6 sample detection
10 parts of samples detect that assay does not detect YHV using fluorescence LAMP method, see Fig. 8.
Presently preferred embodiments of the present invention is the foregoing is only, is not intended to limit the invention, it is all in essence of the invention
Any modification, equivalent and improvement made within god and principle etc., should be included within the scope of the present invention.
<110>Inspection ＆ Quarantine Technology Center of Zhuhai Entry-Exit Inspection ＆ Quarantine Bureau
<120>Fluorescent primer and its detection method for detecting shrimp cream head disease virus
<160> 6
<210> 1
<211> 43
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
TCATAGACGCCTTCTGGACAGACACAGTCATTCGCATTACAAG
<210> 2
<211> 40
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
TATCGTCCCGGCAATTGTGATCAACCAGTGACGTTCGATG
<210> 3
<211> 21
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
CAACATCCTCAAGATGGACAT
<210> 4
<211> 22
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
GAATTGTCATGTCTTCATGTGG
<210>5
<211> 20
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
TGTTGTCTGGAGTGATGTCG
<210> 3
<211> 18
<212>DNA
<213>Artificial sequence
<400>Nucleotide sequence
CAACGCCGTCACGTATTG
Claims (4)
1. it is a kind of for detect shrimp cream head disease virus fluorescence LAMP primer, it is characterised in that it is described for detect shrimp cream head disease
The sequence of fluorescent primer of virus is：SEQ ID NO：1、SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID
NO：5、SEQ ID NO：6.
2. a kind of synthetic method of the as claimed in claim 1 fluorescence LAMP primer for being used to detect shrimp cream head disease virus, it is special
Levy and be, the synthetic method is comprised the following steps：
According to LAMP primer design principle, according to the genome sequence of the YHV-1 types-YHV-6 types of YHV in GenBank databases
Row, through Multiple Sequence Alignment, using ORF1 genes as amplification object, then by molecular biology software LAMP
Dsigner1.1.4 designs primer；Using HPLC way of purification；It is molten that primer ultra-pure water after synthesis is diluted to 100 μm of ol/L
Liquid, -20 DEG C save backup.
3. it is a kind of to utilize the detection method for being used for detecting shrimp cream head disease virus described in claim 1, it is characterised in that described to be used for
The detection method of detection shrimp cream head disease virus includes：
Step one, the nucleic acid extraction of sample：According to nucleic acid extraction kit Mag-BindViral DNA/RNA Kit200 explanations
Book extracts sample nucleic；
Step 2, into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein the μ of 2 × Taq reaction solutions RM 12.5
L, inner primer FIP, BIP40 μm ol/L each 1.0 μ L, ring primer LF and LB each 1.0 μ L of each 1.0 μ L, outer primer F3, B35 μm ol/L,
The μ L of Bst DNApolymerase 0.8, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of viral nucleic acid template 2.0, moisturizing is extremely
25.0μL；Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
Step 3, instrument detection：Reaction is placed in 60 DEG C to 65 DEG C of reaction environment and is incremented by with 1 DEG C and optimized, from many
It is secondary to repeat to determine optimal reaction temperature in testing；Reaction condition is adjusted to holding stage 63 DEG C of 1min, 1 on fluorescent PCR instrument
Circulation；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel is elected as
FAM。
4. it is as claimed in claim 3 to be used to detect the detection method that shrimp cream head disease is viral, it is characterised in that 60 are placed in reaction
DEG C to being incremented by 65 DEG C of reaction environment and with 1 DEG C and optimizing, optimal reaction temperature is determined from being repeated several times in experiment；Glimmering
Reaction condition is adjusted to 63 DEG C of 1min of holding stage in light PCR instrument；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 circulations；In 63
Fluorescence signal is collected at DEG C 45s, fluorescence channel elects FAM as.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100714.3A CN106755598A (en) | 2017-02-23 | 2017-02-23 | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100714.3A CN106755598A (en) | 2017-02-23 | 2017-02-23 | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755598A true CN106755598A (en) | 2017-05-31 |
Family
ID=58960290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710100714.3A Pending CN106755598A (en) | 2017-02-23 | 2017-02-23 | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755598A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106283A (en) * | 2019-01-30 | 2019-08-09 | 宁波大学 | A kind of high-throughput quantification detection kit of aquiculture animal virus |
| CN110872638A (en) * | 2019-12-20 | 2020-03-10 | 浙江省淡水水产研究所 | Specific primer, probe and rapid detection kit for detecting macrobrachium rosenbergii sheath virus-1 |
| CN116179763A (en) * | 2023-01-04 | 2023-05-30 | 中国海洋大学三亚海洋研究院 | ERA technology-based multiplex rapid detection method for gene I type and gene II type yellow head viruses, and primers and probes for detection |
-
2017
- 2017-02-23 CN CN201710100714.3A patent/CN106755598A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106283A (en) * | 2019-01-30 | 2019-08-09 | 宁波大学 | A kind of high-throughput quantification detection kit of aquiculture animal virus |
| CN110106283B (en) * | 2019-01-30 | 2022-12-09 | 浙江正合谷生物科技有限公司 | High-flux quantitative detection kit for aquaculture animal viruses |
| CN110872638A (en) * | 2019-12-20 | 2020-03-10 | 浙江省淡水水产研究所 | Specific primer, probe and rapid detection kit for detecting macrobrachium rosenbergii sheath virus-1 |
| CN110872638B (en) * | 2019-12-20 | 2023-06-27 | 浙江省淡水水产研究所 | Specific primer, probe and rapid detection kit for detecting macrobrachium nipponense stem cover virus-1 |
| CN116179763A (en) * | 2023-01-04 | 2023-05-30 | 中国海洋大学三亚海洋研究院 | ERA technology-based multiplex rapid detection method for gene I type and gene II type yellow head viruses, and primers and probes for detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| CN103773895B (en) | Multiple fluorescence PCR (polymerase chain reaction) kit capable of detecting five DNA (deoxyribonucleic acid) viruses of aquatic animal simultaneously | |
| CN106811551A (en) | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method | |
| CN101624636B (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN106755598A (en) | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus | |
| CN111394515B (en) | LAMP primer group, fluorescence visualization rapid kit and method for detecting canine parvovirus | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| CN110699485B (en) | RPA primer pair, probe, kit and detection method for rapidly detecting Marek's disease virus | |
| CN101418351B (en) | Shrimp white spot syndrome virus detection reagent kit and detecting method | |
| CN106755572A (en) | I types DHV and duck plague virus double fluorescent quantitative PCR method | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN107190103B (en) | Multiplex PCR primer group, kit and method for simultaneously detecting three fish viruses | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN107254556A (en) | Method, RPA IAC primers and kit based on RPA IAC technology examination bean mosaic virus 4s | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN113430274B (en) | RPA primer, probe, kit and method for detecting liver enterocytozoon | |
| CN107937615A (en) | For distinguishing the primer and probe of Latex agglutination test street strain and vaccine strain | |
| CN108018377B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer group, kit and method for Luo lake virus | |
| CN111500773B (en) | Fluorescent quantitative RT-PCR primer, probe and kit for identification of serotype of epidemic hemorrhagic disease virus | |
| CN111500774B (en) | Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit | |
| CN109576394B (en) | SYBR Green fluorescent quantitative RT-PCR primer for detecting Nebovirus and application | |
| CN114381551A (en) | Real-time fluorescent RAA primer, probe and kit for detecting iridovirus of micropterus salmoides | |
| CN114395643A (en) | Double-channel digital PCR detection kit and method for African swine fever virus | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |