CN108977554A - Laying duck circular rna circ_13034 and its detection reagent, method and application - Google Patents
Laying duck circular rna circ_13034 and its detection reagent, method and application Download PDFInfo
- Publication number
- CN108977554A CN108977554A CN201811030827.1A CN201811030827A CN108977554A CN 108977554 A CN108977554 A CN 108977554A CN 201811030827 A CN201811030827 A CN 201811030827A CN 108977554 A CN108977554 A CN 108977554A
- Authority
- CN
- China
- Prior art keywords
- circular rna
- laying duck
- circ
- gene
- rna circ
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention belongs to gene engineering technology fields, provide laying duck circular rna circ_13034 and its detection reagent, method and application；The corresponding cDNA sequence of laying duck circular rna circ_13034 of the invention is as shown in SEQ ID NO:1；The fluorescence quantitative PCR detection primer pair and detection kit of laying duck circular rna of the present invention, the detection primer is to the nucleotide sequence as shown in SEQ ID NO:2 and SEQ ID NO:3；The present invention also provides the laying duck circular rna circ_13034 over-express vector and its construction methods；The laying duck circular rna and over-express vector is additionally provided to identify laying duck follicular development situation as molecular marker, detecting the application in laying duck follicular cell in cell proliferation and differentiation situation.Inheritance and raising laying duck reproductive capacity to research laying duck reproductive trait have great importance.
Description
Technical field
The present invention relates to gene engineering technology field more particularly to laying duck circular rna circ_13034 and its detection examinations
Agent, method and application.
Background technique
Circular rna (circular RNA, circRNA) is a kind of newfound endogenous non-coding RNA, altogether by one kind
Valence link forms the RNA molecule of closed loop configuration, is not influenced by RNA excision enzyme, expresses more stable, not degradable.Existing research shows
CircRNA largely belongs to non-coding RNA, is mainly derived by exon, and circRNAs has tissue special in animal
It is anisotropic.In recent years the study found that a variety of biological cells and tissue in, having more than 10% expressing gene can generate
circRNAs.Functionally, it recent studies indicate that circRNA is with higher rich, is rich in microRNA (miRNA)
Binding site, play the role of miRNA sponge in cell, absorption miRNA, Reverse transcriptase miRNA and target base can be passed through
Because of the ability of combination.
The egg laying performance of follicular development and laying duck is closely related, directly affects the egg production of laying duck.Existing research shows fowl
Class follicular development is extremely complex biological process, and people have centainly the follicular development mode of poultry at present
Solution, but as determine egg production an important factor for, the specific Regulation Mechanism of follicular development still needs to further investigate.Granular cell
Upgrowth situation directly influences the developmental state of ovarian follicle, and follicular cell can secrete gonadal hormone and growth factor regulation ovum
Growth, differentiation and the maturation of thecacells and egg mother cell, while the also accurately growth and development of regulation ovarian follicle.Therefore, it ensures
Good follicular development, the regulation rule for grasping follicular development help to further increase the reproductive capacity of laying duck, for improving egg
Duck production performance is of great significance.However at present about the research especially laying duck ovarian follicle of laying duck tissue specificity circular rna
There is not been reported for the research of circular rna and its regulatory mechanism.Therefore, there is an urgent need to improve laying duck ovarian follicle circular rna research level
And integrality, so that the research for laying duck genome and its non-coding RNA provides the theoretical foundation of science, so as to more deep
The regulatory mechanism of laying duck follicular development is solved, provides theory support to improve the reproductive performance of laying duck.
Summary of the invention
It is an object of the invention to overcome the defect of the prior art, laying duck circular rna circ_13034 and its inspection are provided
Test agent, method and application.
To achieve the above object, the present invention is implemented as follows:
In the first aspect of the present invention, a kind of laying duck circular rna circ_13034, the laying duck circular rna are provided
The corresponding cDNA sequence of circ_13034 is as shown in SEQ ID NO:1.
Laying duck circular rna circ_13034 of the invention is that applicant is turned entirely based on the laying duck ovarian follicle tissue completed early period
Record group sequencing result carries out a large amount of biological information credits by the sequencing result to two groups of ovarian follicle tissue samples of different development stage
The new circular RNA molecule that analysis screening obtains.Applicant is named as laying duck circular rna circ_13034, the egg
The length of the corresponding cDNA sequence of duck circular rna circ_13034 is 1068bp.
In the second aspect of the present invention, provides the laying duck circular rna circ_13034 and exist as molecular marker
For identifying the application in laying duck follicular development situation.
After study, it has been found that laying duck circular rna circ_13034 molecule of the invention is in the white ovarian follicle of laying duck
Expression quantity be significantly higher than the expression quantity in laying duck Huang ovarian follicle, thus laying duck circular rna circ_13034 of the invention can be used as
Molecular marker is used to identify the developmental state of laying duck ovarian follicle.Also, the circular rna has the cyclic structure of closure, it is not easy to
It is attacked by exonuclease, it is highly stable in vivo, it is ideal molecular marker.
In the third aspect of the present invention, provides the laying duck circular rna circ_13034 and exist as molecular marker
For detecting the application in laying duck follicular cell in cell proliferation and differentiation situation.
After study, it has been found that the overexpression of laying duck circular rna circ_13034 molecular composition of the invention carries
Body transfection enters in laying duck follicular cell, compared with empty carrier group, is overexpressed laying duck circular rna circ_13034 gene
Afterwards, the extremely significant increase (P < 0.01) of the expression quantity of cell proliferation marker gene C yclinD1, Apoptosis marker gene BCL2's
The extremely significant reduction (P < 0.01) of expression quantity is applied to detection laying duck so as to show that the circular rna can be used as molecular marker
Cell proliferation and differentiation situation in follicular cell.Also, the circular rna has the cyclic structure of closure, it is not easy to by nucleic acid
Excision enzyme attack, it is highly stable in vivo, it is ideal molecular marker.
In the fourth aspect of the present invention, the fluorescence quantitative PCR detection of laying duck circular rna circ_13034 gene is provided
Primer pair, comprising:
Upstream primer RNA circ_13034-F, the nucleotide sequence as shown in SEQ ID NO:2；
Downstream primer RNA circ_13034-R, the nucleotide sequence as shown in SEQ ID NO:3.
In the fifth aspect of the invention, the fluorescence quantitative PCR detection of laying duck circular rna circ_13034 gene is provided
Kit, including the fluorescence quantitative PCR detection primer pair.
As the preferred embodiment of kit of the present invention, the kit further includes that RNA extracts reagent, reverse transcription
Reaction system and quantitative fluorescent PCR reaction system, wherein the quantitative fluorescent PCR reaction system includes THUNDERBIRD SYBR
qPCR Mix、ddH2O, the cDNA and the detection primer pair that the reverse transcription reaction system reverse transcription obtains.
As the above specific embodiment, the quantitative fluorescent PCR reaction system is as follows: THUNDERBIRD SYBR
10 μ L, 10uM laying duck circular rna circ_13034 upstream primer of qPCR Mix, 0.4 μ L, 10uM laying duck circular rna circ_
13034 downstream primer 0.4 μ L, cDNA template 2.0 μ L, ddH to be detected27.2 μ L of O, 20 μ L of total volume.
In the sixth aspect of the present invention, the application method of the kit is provided, is included the following steps:
RNA in step 1, extraction sample to be tested, carries out the digestion (RNase R) of circular rna first, then carries out inverse
Transcription obtains cDNA；
Step 2, using the primer pair described in claim 4, quantitative fluorescent PCR expansion is carried out to sample to be tested cDNA
Increase, using 2-ΔΔCTMethod calculates and obtains the relative expression of circular rna circ_13034 gene in separate sources ovarian follicle sample
Amount；
Step 3 judges that sample to be detected is cyclic annular with the presence or absence of laying duck according to pcr amplification product and gene relative expression quantity
RNA circ_13034 gene and its expression.
As the above specific embodiment, the quantitative fluorescent PCR reaction condition in the step 2 is 98 DEG C, 10s；94
DEG C, 15s, 54 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C, 10s；65 DEG C, 60s, 97 DEG C, 1s, 1 circulations.
In the seventh aspect of the present invention, laying duck circular rna circ_13034 gene overexpression carrier, the load are provided
Body includes the corresponding cDNA sequence of the laying duck circular rna circ_13034.
The invention has the advantages that:
1, the fluorescence quantitative PCR detection primer pair and detection of a kind of laying duck circular rna circ_13034 provided by the invention
Kit designs specific Loop primer, utilizes quantitative fluorescent PCR according to laying duck circular rna circ_13034 gene order
The expression of the circular rna is detected, then judges that sample to be detected whether there is according to pcr amplification product and gene relative expression quantity
Laying duck circular rna circ_13034 gene and its expression.
2, the present invention provides a kind of laying duck circular rna circ_13034, (1) circular rna as molecular marker with
Application in identification laying duck follicular development situation: the present invention utilizes fluorescence quantitative PCR detection primer pair and detection kit, can
Accurately to detect the different expressions of different developmental phases ovarian follicle tissue middle ring shape RNA circ_13034, so that analysis is for the first time
It was found that laying duck circular rna circ_13034 gene is related to laying duck follicular development, the existing vacancy in this field is compensated for, for solution
The Genetic Mechanisms of analysis laying duck follicular development are provided fundamental basis and scientific basis, for studying the inheritance of laying duck reproductive trait
And it improves laying duck reproductive capacity and has great importance.(2) circular rna is thin in detection laying duck granulosa as molecular marker
Application in born of the same parents in cell proliferation and differentiation situation: can with laying duck circular rna circ_13034 gene overexpression carrier in the present invention
Laying duck circular rna circ_13034 gene is expressed to stablize, Testing index reflects laying duck circular rna circ_13034 gene
Expression quantity, compared with empty carrier group, after being overexpressed laying duck circular rna circ_13034 gene, cell proliferation marker gene
The extremely significant increase (P < 0.01) of the expression quantity of CyclinD1, the extremely significant reduction of the expression quantity of Apoptosis marker gene BCL2 (P <
0.01), it is applied to cell increasing in detection laying duck follicular cell so as to show that the circular rna can be used as molecular marker
Grow differentiation situation.
3, laying duck circular rna circ_13034 gene overexpression carrier provided by the invention, contains circular rna circ_
The full length sequence segment of 13034 genes, the carrier can stablize the circular rna circ_13034 of expression laying duck, can be by glimmering
Light quantitative detection reflects the expression quantity of laying duck circular rna circ_13034 gene, can be applied to correlative technology field；This hair
The construction method of the above-mentioned laying duck circular rna circ_13034 gene overexpression carrier of bright offer is easy to operate, is quickly easy to get,
The recombinant vector with target gene can be accurately obtained by screening, the recombinant vector being prepared can stablize expression purpose
Gene.
Detailed description of the invention
Fig. 1 is the laying duck circular rna circ_13034 full length gene segment PCR electrophoresis result figure in embodiment 1；Attached drawing
Description of symbols, swimming lane M is DL2000DNAmarker in figure, and swimming lane 1,2 is circular rna circ_13034 gene amplification fragment；
Fig. 2 is that the fluorescence quantitative PCR detection for the laying duck circular rna circ_13034 gene that the embodiment of the present invention 2 provides is drawn
The relative quantification expression of results of laying duck circular rna circ_13034 gene in object pair and its detection kit；
Fig. 3 is the pLCDH-ciR in the laying duck circular rna circ_13034 gene overexpression carrier provided in embodiment 3
The structural schematic diagram of carrier；
Fig. 4 is the bacterium colony PCR electrophoresis knot for the laying duck circular rna circ_13034 gene overexpression carrier that embodiment 3 provides
Fruit figure；Description of symbols, swimming lane M is DL2000DNA marker in figure, and swimming lane 1,2 is circular rna circ_013034 mistake
Expression vector bacterium solution amplified fragments；
Fig. 5 is after being overexpressed laying duck circular rna circ_13034 in embodiment 4, in over-express vector group and empty carrier group
Circular rna circ_13034 changes in gene expression situation；
Fig. 6 is after being overexpressed laying duck circular rna circ_13034 in embodiment 4, in over-express vector group and empty carrier group
Cell apoptosis and proliferation key gene expresses situation of change.
Specific embodiment
1 laying duck circular rna circ_13034 gene of embodiment
One, laying duck circular rna circ_13034
The corresponding cDNA sequence of laying duck circular rna circ_13034 described in the present embodiment is as shown in SEQ ID NO:1, originally
The laying duck circular rna circ_13034 of invention is applicant based on the full transcript profile sequencing knot of laying duck ovarian follicle tissue completed early period
Fruit carries out a large amount of bioinformatic analysis screenings by the sequencing result to two groups of ovarian follicle tissue samples of different development stage and obtains
A new circular RNA molecule.Applicant is named as laying duck circular rna circ_13034, the laying duck circular rna
The length of the corresponding cDNA sequence of circ_13034 is 1068bp.
Two, the preparation of laying duck circular rna circ_13034 full length gene sequence fragment
1, design of primers and synthesis
According to the full length fragment of circular rna circ_13034 gene order in full transcript profile sequencing result, use
5.0 software Design primers of Premier Premier, circular rna circ_13034 gene magnification primer sequence are as follows:
circ_13034-F:CACTAAAATAAAATCTGTTCAATTAACGAATTCGGAATATTCTATCACTCTGATGG
TAA (SEQ ID NO:4)；
circ_13034-R:GGCGTTATCATCCCAAATTAGTGGATCCTCAAAAAGGAAAATAAGCACCA(SEQ
ID NO:5)；
Above-mentioned primer is synthesized by Beijing AudioCodes Bioisystech Co., Ltd.Target patch segment DNA size is 1068bp.
2, sample collection
Acquire the white ovarian follicle of egg-laying peak laying duck and yellow each 3 parts of sample of ovarian follicle, PBS with syringe needle punctures ovarian follicle after cleaning up
Liquor folliculi is squeezed out, is put into the 1.5mL EP pipe of no enzyme, liquid nitrogen is put into after marking or -80 DEG C of refrigerators save.
3, sample Total RNAs extraction
Ovarian follicle total tissue RNA is extracted using traditional TRIzol, chloroform method, the specific steps are as follows:
1) liquid nitrogen grinding takes 50-100mg tissue sample to be put in mortar, and it is a little to pour into liquid nitrogen, grinds rapidly, to liquid nitrogen
Volatilization completely adds a small amount of liquid nitrogen, until tissue sample grinds as powder, tissue sample is transferred in 1.5mL centrifuge tube, is added
1mLTrizol tries temperature and places 5min, cracks it sufficiently；
2) 4 DEG C of 12000g are centrifuged 10min, supernatant are transferred in the 1.5mL centrifuge tube of clean no RNAase；
3) add 0.2ml chloroform according to every 1ml homogenate, violent 15s is placed at room temperature for 15min；
4) 4 DEG C of 12000g are centrifuged 10min；
5) upper layer colourless solution is carefully sucked out in centrifuge tube of another 1.5ml without RNAase, 0.5 times of isopropyl is added
Alcohol mixes, and tries temperature and stands 5-10min；
6) 4 DEG C of 12000g are centrifuged 10min, abandon supernatant, and RNA is sunken to tube bottom；
7) 1mL75% ethyl alcohol is added, mildly vibrates centrifuge tube, suspend precipitating；
8) 4 DEG C of 8000g are centrifuged 5min, abandon supernatant；
9) 1mL dehydrated alcohol is added, mildly vibrates centrifuge tube, suspend precipitating；
10) 4 DEG C of 8000g are centrifuged 5min, abandon supernatant, and room temperature is dried；
11) using 30-50 μ L without RNAase deionized water dissolving RNA, -80 DEG C are saved backup.
4, RNA sample quality testing is analyzed
It is solidifying using 1% agarose using 1000 micro-spectrophotometer of NanoDrop detection RNA sample concentration and OD value
The integrality of gel electrophoresis detection RNA.
5, the digestion (RNase R) of circular rna
Total serum IgE (5 μ g) is added in PCR pipe (sterilizing), according to addition RNase R in 3U/ug thereto pipe.It is put into PCR
37 DEG C of heating 30min, then carry out reverse transcription in instrument.
6, reverse transcription
Using the reverse transcription reagent box of Takara companyRT reagent Kit with gDNA
The specification step of Eraser carries out reverse transcription and obtains cDNA template.
1) genomic DNA remove dereaction
Table 1
Reaction condition is as follows:
42℃2min；
4 DEG C of preservations.
2) reverse transcription reaction
Reaction solution process for preparation carries out on ice.
Table 2
Reaction condition is as follows:
37℃ 15min
85℃ 5sec
4 DEG C of preservations
7, the acquisition and verifying of laying duck circular rna circ_13034
Tounchdown PCR is carried out, pcr amplification reaction system is following (50 μ L of total volume):
Table 3
Response procedures are as follows: 94 DEG C of initial denaturation 2min recycle interior 98 DEG C of denaturation 10s, from 65 DEG C of 0.5 DEG C of each cycle downs first
Anneal 30s, 68 DEG C of extension 1min, 30 circulations；98 DEG C of denaturation 10s, 50 DEG C of annealing 30s, 68 DEG C of extension 1min again carry out 30
Circulation；Last 68 DEG C of extensions 7min, 4 DEG C of preservations.
PCR takes 5 μ L PCR products to carry out agarose electrophoretic analysis after reaction, as a result as shown in Figure 1, M is indicated in Fig. 1
The full length sequence segment of 1,2 expression target fragment circular rna circ_13034 genes in DL2000DNA marker, Fig. 1.It will
The target fragment circular rna circ_13034PCR product of acquisition directly send sequencing, sequencing result with it is expected completely the same.By
This can be seen that this Success in Experiment PCR amplification and obtains the laying duck ring with EcoRI and BamHI restriction enzyme digestion sites
The full length sequence segment of shape RNA circ_13034 gene.
The fluorescence quantitative PCR detection primer pair and its detection reagent of 2 laying duck circular rna circ_13034 gene of embodiment
Box and method
The present embodiment design fluorescence quantitative PCR detection primer pair simultaneously identifies laying duck circular rna described in identification embodiment 1
Objective reality of the circ_13034 in laying duck follicular cell.The present embodiment identification identification method the following steps are included:
1, sample collection
With method in embodiment 1.
2, sample Total RNAs extraction
With RNA extraction method in embodiment 1.
3, RNA sample quality testing is analyzed
With method in embodiment 1.
4, the digestion (RNase R) of circular rna
With method in embodiment 1.
5, reverse transcription
With method in embodiment 1.
6, quantitative fluorescent PCR reacts
Circular rna circ_13034 gene by fluorescence quantitative detection primer nucleotide sequence such as SEQ ID NO:2 and SEQ ID
Shown in NO:3.
It is carried out using the Real time kit THUNDERBIRD SYBR qPCRMix specification step of Takara company
Quantitative fluorescent PCR, reaction system are following (20 μ L):
Table 4
Utilize Roche1.1 three-step approach of 96SW carries out quantitative fluorescent PCR, amplification condition are as follows: and 98 DEG C,
10s；94 DEG C, 15s, 54 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C of 10s, 65 DEG C of 60s, 97 DEG C of 1s, 1 circulation.
Data are exported after reaction, as a result utilize 2-ΔΔCTMethod is analyzed.Utilize Graphad Prism software pair
Analysis result is mapped.
White ovarian follicle and yellow ovarian follicle tissue middle ring shape RNA circ_13034 gene expression results are shown in Fig. 2, the results show that the
One, there are the expression of circular rna circ_13034 gene, the laying duck circular rna circ_ in white ovarian follicle and in yellow ovarian follicle
13034 objective reality in laying duck follicular cell.Second, the expression of circular rna circ_13034 gene in white ovarian follicle
Measure extremely significant be higher than in yellow ovarian follicle (P < 0.01).Thus, it will be seen that the development of circular rna circ_13034 gene and ovarian follicle
With important correlation.
3 laying duck circular rna circ_13034 gene overexpression vector construction of embodiment
The present embodiment provides laying duck circular rna circ_13034 gene overexpression carriers, and the carrier includes the laying duck
The corresponding cDNA sequence of circular rna circ_13034.Vector construction specifically comprises the following steps:
(1) the double digestion processing of pLCDH-ciR carrier
The structural schematic diagram of pLCDH-ciR carrier is as shown in figure 3, carrier contains restriction enzyme EcoRI and BamHI enzyme
Enzyme site.Double digestion is carried out to above-mentioned carrier with two kinds of digestion enzyme EcoRI and BamHI, endonuclease reaction system is as follows, and system is overall
Product is 50 μ L:
Table 5
Reaction condition are as follows: 37 DEG C of digestion 6h then carry out purification and recovery to digestion products.
(2) double digestion of laying duck circular rna circ_13034 full length gene segment
It purifies to correct PCR product is verified, is produced with above-mentioned PCR of two kinds of restriction endonuclease EcoRI and BamHI to recycling
Object carries out double digestion, and endonuclease reaction system is as follows, and the total volume of system is 50 μ L:
Table 6
Reaction condition are as follows: 37 DEG C of digestion 6h then carry out purification and recovery to digestion products.
(3) building of laying duck circular rna circ_13034 gene overexpression carrier
Circular rna circ_13034 genetic fragment by PCR amplification and after double digestion with also pass through the load after double digestion
Body is attached, and coupled reaction system is following (10 μ L of total volume):
Table 7
Reaction condition are as follows: 16 DEG C of connections overnight.
Connection product is transformed into competent cell, bacterium colony PCR identification is carried out to positive colony, as a result as shown in figure 4, figure
Middle M indicates DL2000DNA marker, and 1-2 indicates the bacterium colony PCR result of single colonie in figure；Further, to recombinant vector egg
Duck circular rna circ_13034 gene overexpression carrier carries out sequence verification, and sequencing result is as shown in SEQ ID NO:1；Bacterium colony
Correctly individual is the successful recombinant vector constructed for PCR and sequencing result, is named as circ_13034-pLCDH-ciR.
The detection of 4 circular rna circ_13034 gene overexpression result of embodiment and analysis
One, laying duck follicular cell separates
The separation of laying duck follicular cell uses following steps:
1, the laying ducks of egg-laying peak, jugular vein sacrificed by exsanguination are selected；Entire ovary tissue is taken out, is placed in equipped with pre-cooling
In the sterile petri dish of PBS；
2, blood stains are rinsed with added with dual anti-PBS buffer solution, rinsed 3 times；
3, the ovarian follicle of rinsed clean is moved into the plate equipped with pre-cooling PBS buffer solution, peels theca of follicle of von Baer, connective tissue off
And rete vasculosum；
4, yolk is discharged, is buffered with PBS in the notch (movement is fast) of the standardized road 1-2cm long in ovarian follicle surface with scalpel
Remaining yolk liquid rinsed clean, remaining membrana follicularis be by liquid are as follows: basement membrane and follicular cell layer；
5, the membrana follicularis of rinsed clean is shredded as far as possible, is placed in 15mL centrifuge tube, add 4mL culture medium, with 1mL liquid-transfering gun
1min is blown and beaten repeatedly, abandons supernatant after 4 DEG C of 1000rpm centrifugations；
6,0.2% II Collagenase Type of 4mL is added into precipitating, precipitating is resuspended, is placed in 37 DEG C of constant-temperature table 80rpm digestion
30min；
7, digestion terminates, and 4mL M199 complete medium (containing 10% serum) is added and terminates digestion；It is sieved with 200 mesh stainless steels
Filtering, and mesh screen is cleaned with 2mL M199 complete medium, filtrate is collected, 4 DEG C of 1000rpm are centrifuged 10min；
8, supernatant is abandoned, 10mL M199 complete medium is added, 4 DEG C of 1000rpm are centrifuged 10min；
9, supernatant is abandoned, after M199 complete medium (dual anti-containing 10%FBS and 1%) resuspension is added, cell density is measured, adjusts
Whole suspension cell density is 1 × 106A/mL is inoculated in 6 hole culture dishes, is placed in 37 DEG C, 5%CO2Stationary culture in incubator；
10, after granulosa cell culture 24 hours, renew the fresh M199 culture medium containing fetal calf serum, attached cell can be used for
Further in research.
Two, cell transfecting
1,125 μ L Opti-MEM culture mediums is taken to dilute the resulting circular rna circ_13034 gene mistake of embodiment 3 respectively
Expression vector circ_13034-pLCDH-ciR and empty carrier pLCDH-ciR, and 5 μ L P3000 are added thereto；
2,250 μ L Opti-MEM culture mediums is taken to dilute3000 reagents, mix well；
3, the mixture in 125 μ L (2) is added in two pipe mixtures in (1) respectively, is incubated at room temperature 5min；
4,250 μ L mixtures are transferred to cell.
3 repeating holes are arranged in each experimental group, and transfection cell is grouped as follows: 1. being transfected pLCDH-ciR (empty carrier group), is 2. turned
It contaminates circ_13034-pLCDH-ciR (circular rna circ_13034 gene overexpression vehicle group).Each transfection group transfects cell
After for 24 hours, using Trizol vitellophag, quantitative fluorescence analysis after overexpression is used for after extracting cell total rna.
Three, quantitative fluorescence analysis
1, in cell total serum IgE extraction
Total serum IgE in cell is extracted referring to the extracting method of total serum IgE in embodiment 1.
2, the digestion (RNase R) of circular rna
With RNA enzyme blanking method cyclic annular in embodiment 1.
3, reverse transcription
With the method for reverse transcription in embodiment 1.
4, quantitative fluorescent PCR reacts
(1) quantitative fluorescent PCR reaction condition and method be with embodiment 1, wherein circular rna circ_13034 gene by fluorescence
Quantitative primer nucleotide sequences are as shown in SEQ ID NO:2 and SEQ ID NO:3, amplification condition are as follows: and 98 DEG C, 10s；94 DEG C,
15s, 54 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C of 10s, 65 DEG C of 60s, 97 DEG C of 1s, 1 circulation；
(2) cell Proliferation marker gene cyclinD1 fluorescent quantitation primer nucleotide sequences such as SEQ ID NO:6 and SEQ
Shown in ID NO:7, amplification condition are as follows: 98 DEG C, 10s；94 DEG C, 15s, 56 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C of 10s,
65 DEG C of 60s, 97 DEG C of 1s, 1 circulation；
(3) Apoptosis marker gene BCL2 fluorescent quantitation primer nucleotide sequences such as SEQ ID NO:8 and SEQ ID
Shown in NO:9, amplification condition are as follows: 98 DEG C, 10s；94 DEG C, 15s, 54 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C of 10s, 65 DEG C
60s, 97 DEG C of 1s, 1 circulation.
4, interpretation of result
Data are exported after reaction, as a result utilize 2-ΔΔCTMethod is analyzed.Utilize Graphad Prism software pair
Analysis result is mapped.Circular rna circ_13034 gene after transfection laying duck circular rna circ_13034 over-express vector
Expression quantity and cell Proliferation, the expression analysis result of apoptosis marker gene see Fig. 5-6.
As seen from Figure 5, after being overexpressed laying duck circular rna circ_13034 gene, compared with empty carrier group, table is crossed
After up to laying duck circular rna circ_13034 gene the expression quantity of circular rna circ_13034 it is extremely significant be higher than empty carrier group (P <
0.01)；It follows that the laying duck circular rna circ_13034 gene overexpression carrier in the present invention can stablize expression laying duck
Circular rna circ_13034 gene.
As seen from Figure 6, after being overexpressed laying duck circular rna circ_13034 gene, compared with empty carrier group, table is crossed
Up to after laying duck circular rna circ_13034 gene, the extremely significant increase of the expression quantity of cell proliferation marker gene C yclinD1 (P <
0.01), the extremely significant reduction (P < 0.01) of the expression quantity of Apoptosis marker gene BCL2.So as to show that the circular rna can
It is applied to cell proliferation and differentiation situation in detection laying duck follicular cell as molecular marker.Also, the circular rna has
The cyclic structure of closure, it is not easy to it is attacked by exonuclease, it is highly stable in vivo, it is ideal molecular marker.
In conclusion the laying duck circular rna circ_13034 gene overexpression carrier in the present invention can stablize expression egg
Duck circular rna circ_13034 gene can be used as the expression of Testing index reflection laying duck circular rna circ_13034 gene
Amount can be applied to cell proliferation and differentiation situation in detection laying duck follicular cell.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Within mind and principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Sequence table
<110>Animal Husbandry and Veterinary Inst., Hubei Academy of Agricultural Sciences
<120>laying duck circular rna circ_13034 and its detection reagent, method and application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1068
<212> DNA
<213> cDNA(Artificial Sequence)
<400> 1
ggaatattct atcactctga tggtaacaga ccaggcagca gaaccactca ctggaatatg 60
tcagataaat gttatcattc tggatcaaaa tgacaatgat ctcaggtttg aaaacaacca 120
ctataaatgt aattgagagt cattggatag aatttcagtg ccttgagtgt gagcttaact 180
gatgtctaaa attattggat ttttgtcttt catagcagta aattctgtga ctaattgagt 240
gattgaagcc agaggtgcac ttatcttagt taattgcaga attgtatgta taatattcat 300
taaaaacctg gtatttctca gttagttata atatacaaat ccaagaaagt agttcctgat 360
tttgtgcaat aagctaaaat tccatttgct tatatttcat acaaagcaat tagtccttta 420
gtttaaaaaa aaaaaaaaaa aagcaaaacc agaaaactgg aaaaagtaat agactgaata 480
agaattccag tttatgaatg tgataataca aagttaaatg tgatccatag ctcagatatt 540
ctagagcctc aaaaataatc aagtctgtgc tacacttacc aaaattgacg tattctgtgt 600
agtattctcc ggaataacaa cttcatagct gtccctttcc cactgtggag gttggctttt 660
tgcactggta atagtaacag ctcttgaaac aactggtaat cataacagct cttgaaaaca 720
tcgtttgatt ttatgggcat tgttccaagg ggtaaaaagt ggtatcttcc atacattttt 780
actttagtat ttcttcatat ttcttagtaa gatgttcatg gtactttagt gaattaatga 840
tcagcttgaa ataaccttcc cttacgttag atttcctaag ggaagacaca atagttggga 900
ccagctttct tcgtgttgca gcccctgatg atgactacgg ctcaaatgct gtcattacat 960
actccatagc gaatgaagaa ccagattatt tacagattaa ccctactaca tgctggatgt 1020
ttgtcaacca acccatatct caggtatggt gcttattttc ctttttga 1068
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tgtttgtcaa ccaacccat 19
<210> 3
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ctgctgcctg gtctgttac 19
<210> 4
<211> 59
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cactaaaata aaatctgttc aattaacgaa ttcggaatat tctatcactc tgatggtaa 59
<210> 5
<211> 50
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggcgttatca tcccaaatta gtggatcctc aaaaaggaaa ataagcacca 50
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cttggatgct ggaggttt 18
<210> 7
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ggcttttctt gaggggtt 18
<210> 8
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
acggctctcg ctcctgct 18
<210> 9
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
cggttgacgc tctccacg 18
Claims (10)
1. a kind of laying duck circular rna circ_13034, which is characterized in that the laying duck circular rna circ_013034 is corresponding
CDNA sequence is as shown in SEQ ID NO:1.
2. laying duck circular rna circ_13034 described in claim 1 is identifying laying duck follicular development feelings as molecular marker
Application in condition.
3. laying duck circular rna circ_13034 as described in claim 1 is as molecular marker in detection laying duck granulosa
Application in cell in cell proliferation and differentiation situation.
4. a kind of fluorescence quantitative PCR detection primer pair of laying duck circular rna circ_13034 gene characterized by comprising
Upstream primer RNAcirc_13034-F, the nucleotide sequence as shown in SEQ ID NO:2；
Downstream primer RNAcirc_13034-R, the nucleotide sequence as shown in SEQ ID NO:3.
5. a kind of fluorescent quantificationally PCR detecting kit of laying duck circular rna circ_13034 gene characterized by comprising
Fluorescence quantitative PCR detection primer pair as claimed in claim 4.
6. detection kit as claimed in claim 5, which is characterized in that further include RNA extract reagent, reverse transcription reaction system and
Quantitative fluorescent PCR reaction system, wherein the quantitative fluorescent PCR reaction system includes THUNDERBIRD SYBR qPCR Mix,
ddH2O, the cDNA and detection primer pair as claimed in claim 4 that the reverse transcription reaction system reverse transcription obtains.
7. detection kit as claimed in claim 6, which is characterized in that the quantitative fluorescent PCR reaction system is as follows:
10 μ L, 10uM laying duck circular rna circ_13034 upstream primer of THUNDERBIRD SYBR qPCR Mix, 0.4 μ L, 10uM egg
Duck circular rna circ_13034 downstream primer 0.4 μ L, cDNA template 2.0 μ L, ddH to be detected27.2 μ L of O, 20 μ L of total volume.
8. a kind of application method of any kit of claim 5-7, which comprises the steps of:
RNA in step 1, extraction sample to be tested, carries out the digestion of circular rna first, then carries out reverse transcription and obtains cDNA；
Step 2 adopts sample to be tested cDNA progress fluorescent quantitative PCR using the primer pair described in claim 4
With 2-ΔΔCTMethod calculates and obtains the relative expression quantity of circular rna circ_13034 gene in separate sources ovarian follicle sample；
Step 3 judges sample to be detected with the presence or absence of laying duck circular rna according to pcr amplification product and gene relative expression quantity
Circ_13034 gene and its expression.
9. application method as claimed in claim 8, which is characterized in that the quantitative fluorescent PCR reaction condition in the step 2
For, 98 DEG C, 10s；94 DEG C, 15s, 54 DEG C, 15s, 60 DEG C, 15s, 40 circulations；95 DEG C, 10s；65 DEG C, 60s, 97 DEG C, 1s, 1
Circulation.
10. a kind of laying duck circular rna circ_13034 gene overexpression carrier, which is characterized in that the carrier includes that right is wanted
Seek the corresponding cDNA sequence of the 1 laying duck circular rna circ_13034.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811030827.1A CN108977554B (en) | 2018-09-05 | 2018-09-05 | Egg duck circular RNA circ _13034 and detection reagent, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811030827.1A CN108977554B (en) | 2018-09-05 | 2018-09-05 | Egg duck circular RNA circ _13034 and detection reagent, method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108977554A true CN108977554A (en) | 2018-12-11 |
| CN108977554B CN108977554B (en) | 2021-08-31 |
Family
ID=64545299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811030827.1A Active CN108977554B (en) | 2018-09-05 | 2018-09-05 | Egg duck circular RNA circ _13034 and detection reagent, method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108977554B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110982906A (en) * | 2019-12-31 | 2020-04-10 | 广西医科大学 | Primer pair for detecting hsa _ circ _0032969, application thereof and kit |
| CN113278635A (en) * | 2021-05-25 | 2021-08-20 | 广州艾基生物技术有限公司 | Sequence combination for promoting cyclic RNA cyclization and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1636012A (en) * | 2000-06-15 | 2005-07-06 | 农业研究有限公司 | Nucleotide and amino acid sequences of oocyte factors for altering ovarian follicular growth in vivo or in vitro |
| CN101668539A (en) * | 2007-04-24 | 2010-03-10 | 维涡里斯公司 | Duck embryonic derived stem cell lines for the production of viral vaccines |
| US20120207785A1 (en) * | 2009-10-30 | 2012-08-16 | Luc Gilbert Fabry | Process for preparing an influenza seed virus for vaccine manufacture |
-
2018
- 2018-09-05 CN CN201811030827.1A patent/CN108977554B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1636012A (en) * | 2000-06-15 | 2005-07-06 | 农业研究有限公司 | Nucleotide and amino acid sequences of oocyte factors for altering ovarian follicular growth in vivo or in vitro |
| CN101668539A (en) * | 2007-04-24 | 2010-03-10 | 维涡里斯公司 | Duck embryonic derived stem cell lines for the production of viral vaccines |
| US20120207785A1 (en) * | 2009-10-30 | 2012-08-16 | Luc Gilbert Fabry | Process for preparing an influenza seed virus for vaccine manufacture |
Non-Patent Citations (3)
| Title |
|---|
| CHEN XINGYONG等: "integrative analysis of the pekin duck（anas anas）microRNAome during feather follicle development", 《BMC DEVELOPMENTAL BIOLOGY》 * |
| ZHANG LI等: "microRNA profile analysis on duck feather follicle and skin with high-throughput sequencing", 《GENE》 * |
| 任晋东: "lncRNA对鸭产蛋性能关键基因调控机理及其多态性研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110982906A (en) * | 2019-12-31 | 2020-04-10 | 广西医科大学 | Primer pair for detecting hsa _ circ _0032969, application thereof and kit |
| CN113278635A (en) * | 2021-05-25 | 2021-08-20 | 广州艾基生物技术有限公司 | Sequence combination for promoting cyclic RNA cyclization and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108977554B (en) | 2021-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103205431B (en) | Nucleic acid aptamer and derivatives thereof, screening method of nucleic acid aptamer, application of nucleic acid aptamer and derivatives in detecting human biliary duct carcinoma cell line | |
| CN111154763B (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN108929873B (en) | Aptamer specifically binding to metastatic gastric cancer cells and application thereof | |
| CN104450920A (en) | MicroRNA trace detection method based on exponential order non-enzymatic amplification and electrochemical luminescence principle | |
| CN109182562B (en) | miRNA apla-mir-25-42 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| CN105463089A (en) | Assay for transposase accessible chromatin using sequencing (ATAC-seq) method applied to zebrafish embryos | |
| CN106591285B (en) | A method of constructing the library Hi-C of high availability data rate | |
| CN108977554A (en) | Laying duck circular rna circ_13034 and its detection reagent, method and application | |
| CN108977553A (en) | Laying duck circular rna circ_13267 and its detection reagent, method and application | |
| CN109402118B (en) | miRNA apla-mir-145-4 related to follicular development of laying ducks as well as detection primer, inhibitor and application thereof | |
| CN110885823A (en) | Long-chain non-coding RNA pig Lnc-000649 and application thereof | |
| KR101913735B1 (en) | Internal control substance searching for intersample crosscontamination of nextgeneration sequencing samples | |
| CN108531544A (en) | A kind of method of miR-181b target genes screening | |
| CN111118170B (en) | Application of chi-miR-450-5p as goat follicle maturation miRNA marker | |
| CN106591955B (en) | Construct high-resolution, the method in the unicellular library Hi-C of large information capacity | |
| CN110295170A (en) | It is a kind of regulate and control laying duck follicular development long-chain RNA Lnc-13814 and its application | |
| CN113444726B (en) | lncRNA ALDB-898 related to piglet bacterial diarrhea and application thereof | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
| CN110747230B (en) | Method for promoting bovine skeletal muscle satellite cell myogenic differentiation | |
| CN110317809A (en) | It is a kind of regulate and control laying duck follicular development long-chain RNA Lnc-30215 and its application | |
| CN105224824A (en) | Based on the duck tembusu virus nondiagnostic detection method of metagenomics | |
| CN104388541B (en) | The purposes of miR 1914* and miR 1915 | |
| CN111206034B (en) | New application of pig GADD45a gene and construction and application of high-expression cell line | |
| CN110564731B (en) | Aptamer and detection kit for detecting human drug-resistant hepatoma cell strain HepG2/ADM | |
| CN111454944B (en) | Method for synthesizing separated RNA and DNA template thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |