CN108977554B

CN108977554B - Egg duck circular RNA circ _13034 and detection reagent, method and application thereof

Info

Publication number: CN108977554B
Application number: CN201811030827.1A
Authority: CN
Inventors: 吴艳; 皮劲松; 梁振华; 潘爱銮; 张昊; 蒲跃进; 申杰; 杜金平; 孙静
Original assignee: Institute of Animal Science and Veterinary of Hubei Academy of Agricultural Sciences
Current assignee: Institute of Animal Science and Veterinary of Hubei Academy of Agricultural Sciences
Priority date: 2018-09-05
Filing date: 2018-09-05
Publication date: 2021-08-31
Anticipated expiration: 2038-09-05
Also published as: CN108977554A

Abstract

The invention belongs to the technical field of genetic engineering, and provides an egg duck circular RNA circ _13034, a detection reagent, a method and application thereof; the cDNA sequence corresponding to the egg duck circular RNA circ _13034 is shown as SEQ ID NO. 1; the invention relates to a fluorescent quantitative PCR detection primer pair and a detection kit of egg duck circular RNA, wherein the detection primer pair has a nucleotide sequence shown as SEQ ID NO. 2 and SEQ ID NO. 3; the invention also provides the laying duck circular RNA circ _13034 overexpression vector and a construction method thereof; also provides application of the egg-laying duck circular RNA and the over-expression vector as molecular markers in identifying the development condition of the egg-laying duck follicle and detecting the cell proliferation and differentiation condition in the egg-laying duck follicle granular cells. Has important significance for researching the genetic essence of the breeding character of the laying duck and improving the reproductive capacity of the laying duck.

Description

Egg duck circular RNA circ _13034 and detection reagent, method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an egg duck circular RNA circ _13034, and a detection reagent, a method and application thereof.

Background

Circular RNA (circular RNA) is a newly discovered endogenous non-coding RNA, and an RNA molecule with a closed loop structure formed by covalent bonds is not influenced by RNA exonuclease, is more stable in expression and is not easy to degrade. It has been shown that circRNAs are largely non-coding RNAs, mainly derived from exons, and that circRNAs are tissue specific in animals. Recent studies have found that over 10% of expressed genes are capable of producing circRNAs in a variety of biological cells and tissues. Functionally, recent researches show that circRNA has high richness, is rich in binding sites of microRNA (miRNA), plays the role of miRNA sponge in cells, and can competitively inhibit the capacity of combining miRNA with target genes by adsorbing miRNA.

The follicular development is closely related to the egg laying performance of the laying ducks, and directly influences the egg laying amount of the laying ducks. Research has shown that the follicular development of poultry is a very complex biological process, and people have already understood the follicular development pattern of poultry to some extent, but as an important factor for determining egg production, the specific regulation and control mechanism of follicular development still needs to be studied deeply. The growth condition of the granulosa cells directly influences the development condition of the follicles, and the follicular granulosa cells can secrete gonadal hormones and growth factors to regulate the growth, differentiation and maturation of the follicular membrane cells and oocytes and accurately regulate the growth and development of the follicles. Therefore, the method has the advantages that the good follicular development is guaranteed, the regulation rule of follicular development is mastered, the reproductive capacity of the laying ducks is further improved, and the method has important significance for improving the production performance of the laying ducks. However, no report is found on the research on the tissue-specific circular RNA of the laying duck, particularly the research on the follicle circular RNA of the laying duck and the regulation mechanism of the follicle circular RNA. Therefore, the research level and the integrity of the circular RNA of the laying duck follicle are urgently needed to be improved, so that a scientific theoretical basis is provided for the research of the laying duck genome and the non-coding RNA thereof, the regulation and control mechanism of the laying duck follicle development is further understood, and a theoretical support is provided for improving the reproductive performance of the laying duck.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an egg duck circular RNA circ _13034, a detection reagent, a method and application thereof.

To achieve the above object, the present invention is realized by:

in a first aspect of the invention, the circular RNA circ _13034 of the laying duck is provided, and the cDNA sequence corresponding to the circular RNA circ _13034 of the laying duck is shown as SEQ ID NO. 1.

The egg-laying duck circular RNA circ _13034 is a novel circular RNA molecule obtained by carrying out a large amount of bioinformatics analysis and screening on the sequencing results of two groups of follicle tissue samples at different development stages based on the sequencing results of the earlier-completed egg-laying duck follicle tissue complete transcriptome. The applicant named it as the laying duck circular RNA circ _13034, and the length of the cDNA sequence corresponding to the laying duck circular RNA circ _13034 is 1068 bp.

In a second aspect of the invention, the application of the circular RNA circ _13034 of the laying duck as a molecular marker in identifying the follicular development condition of the laying duck is provided.

Through research, the applicant finds that the expression level of the circular RNA circ _13034 molecule of the laying duck in the white follicles of the laying duck is significantly higher than that of the circular RNA circ _13034 molecule of the laying duck in the yellow follicles of the laying duck, so that the circular RNA circ _13034 of the laying duck can be used as a molecular marker for identifying the development condition of the follicles of the laying duck. In addition, the circular RNA has a closed circular structure, is not easy to be attacked by exonuclease, is very stable in an organism, and is an ideal molecular marker.

In a third aspect of the invention, the application of the egg-laying duck circular RNA circ _13034 as a molecular marker in detecting the proliferation and differentiation condition of cells in the egg-laying duck follicular granular cells is provided.

Through research, the applicant finds that after an overexpression vector consisting of the laying duck circular RNA circ _13034 molecule is transfected into the laying duck follicular granular cells, compared with an empty vector group, after the laying duck circular RNA circ _13034 gene is overexpressed, the expression level of a cell proliferation marker gene CyclinD1 is remarkably increased (P <0.01), and the expression level of an apoptosis marker gene BCL2 is remarkably reduced (P <0.01), so that the circular RNA can be used as a molecular marker to be applied to detecting the cell proliferation and differentiation conditions in the laying duck follicular granular cells. In addition, the circular RNA has a closed circular structure, is not easy to be attacked by exonuclease, is very stable in an organism, and is an ideal molecular marker.

In the fourth aspect of the invention, a fluorescent quantitative PCR detection primer pair of the circular RNA circ _13034 gene of the laying duck is provided, which comprises:

an upstream primer RNA circ _13034-F, a nucleotide sequence shown as SEQ ID NO. 2;

the downstream primer RNA circ _13034-R has the nucleotide sequence shown in SEQ ID NO. 3.

In the fifth aspect of the invention, the fluorescent quantitative PCR detection kit for the circular RNA circ _13034 gene of the laying duck is provided, and comprises the fluorescent quantitative PCR detection primer pair.

As a preferred embodiment of the kit, the kit also comprises an RNA extraction reagent, a reverse transcription reaction system and a fluorescent quantitative PCR reaction system, wherein the fluorescent quantitative PCR reaction system comprises THUNDERBIRD SYBR qPCR Mix, ddH₂O, cDNA obtained by reverse transcription of the reverse transcription reaction system and the detection primer pair.

As the above embodiment, the fluorescent quantitative PCR reaction system is as follows: THUNDERBIRD SYBR qPCR Mix 10 uL, 10uM egg duck circular RNA circ _13034 upstream primer 0.4 uL, 10uM egg duck circular RNA circ _13034 downstream primer 0.4 uL, cDNA template to be detected 2.0 uL, ddH₂O7.2. mu.L, total volume 20. mu.L.

In a sixth aspect of the invention, there is provided a method of using the kit, comprising the steps of:

step 1, extracting RNA in a sample to be detected, firstly performing enzyme digestion (RNase R) on circular RNA, and then performing reverse transcription to obtain cDNA;

step 2, utilizing the primer pair in claim 4 to perform fluorescence quantitative PCR amplification on the cDNA of a sample to be detected, and adopting 2^-ΔΔCTCalculating and obtaining the relative expression quantity of circular RNA circ _13034 genes in follicle samples from different sources;

and 3, judging whether the egg duck circular RNA circ _13034 gene and the expression condition of the egg duck circular RNA circ _13034 gene exist in the sample to be detected according to the PCR amplification product and the relative gene expression quantity.

As the above embodiment, the conditions of the fluorescent quantitative PCR reaction in step 2 are 98 ℃ and 10 s; 94 ℃, 15s, 54 ℃, 15s, 60 ℃, 15s, 40 cycles; 95 ℃ for 10 s; 65 ℃, 60s, 97 ℃, 1s, 1 cycle.

In a seventh aspect of the invention, an egg-laying duck circular RNA circ _13034 gene overexpression vector is provided, and the vector comprises a cDNA sequence corresponding to the egg-laying duck circular RNA circ _ 13034.

The invention has the beneficial effects that:

1. according to the fluorescent quantitative PCR detection primer pair and the detection kit of the egg-laying duck circular RNA circ _13034, a specific circular primer is designed according to the sequence of the egg-laying duck circular RNA circ _13034 gene, the expression of the circular RNA is detected by using fluorescent quantitative PCR, and then whether the egg-laying duck circular RNA circ _13034 gene and the expression condition of the sample to be detected exist or not are judged according to the PCR amplification product and the relative gene expression quantity.

2. The invention provides a laying duck circular RNA circ _13034, (1) the application of the circular RNA as a molecular marker in identifying the follicular development condition of the laying duck: the invention utilizes the fluorescent quantitative PCR detection primer pair and the detection kit, can accurately detect different expression conditions of the circular RNA circ _13034 in follicular tissues at different development stages, thereby analyzing and finding that the circular RNA circ _13034 gene of the laying duck is related to the development of the follicular of the laying duck for the first time, making up the existing vacancy in the field, providing theoretical basis and scientific basis for analyzing the genetic mechanism of the development of the follicular of the laying duck, and having important significance for researching the genetic essence of the reproductive traits of the laying duck and improving the reproductive capacity of the laying duck. (2) The application of the circular RNA as a molecular marker in detecting the proliferation and differentiation conditions of cells in the follicular granular cells of the laying duck: according to the invention, the laying duck circular RNA circ _13034 gene can be stably expressed by using the laying duck circular RNA circ _13034 gene overexpression vector, the detection index reflects the expression level of the laying duck circular RNA circ _13034 gene, and compared with an empty vector group, after the laying duck circular RNA circ _13034 gene is overexpressed, the expression level of a cell proliferation marker gene CyclinD1 is remarkably increased (P <0.01), and the expression level of an apoptosis marker gene BCL2 is remarkably reduced (P <0.01), so that the circular RNA can be used as a molecular marker to be applied to detecting the cell proliferation and differentiation conditions in the laying duck follicular granular cells.

3. The egg-laying duck circular RNA circ _13034 gene overexpression vector provided by the invention contains a full-length sequence fragment of a circular RNA circ _13034 gene, can stably express the circular RNA circ _13034 of an egg-laying duck, can reflect the expression quantity of the circular RNA circ _13034 gene of the egg-laying duck through fluorescent quantitative detection, and can be applied to the related technical field; the construction method of the egg-laying duck circular RNA circ _13034 gene overexpression vector provided by the invention is simple to operate, is quick and easy to obtain, the recombinant vector with the target gene can be accurately obtained through screening, and the prepared recombinant vector can stably express the target gene.

Drawings

FIG. 1 is a diagram showing the results of PCR electrophoresis of the full-length fragment of the circular RNA circ _13034 gene of laying duck in example 1; the reference numbers indicate that, lane M is DL2000 DNA marker, and

lanes

1 and 2 are amplified fragments of circular RNA circ _13034 gene;

FIG. 2 shows the relative quantitative expression result of the circular RNA circ _13034 gene of the laying duck in the fluorescent quantitative PCR detection primer pair and detection kit for the circular RNAcirc _13034 gene of the laying duck provided in embodiment 2 of the invention;

FIG. 3 is a schematic structural diagram of pLCDH-ciR vector in the laying duck circular RNA circ _13034 gene overexpression vector provided in example 3;

FIG. 4 is a diagram showing the result of colony PCR electrophoresis of the overexpression vector of circular RNA circ _13034 gene of laying duck provided in example 3; the reference numbers indicate that the lane M is DL2000 DNA marker, and the

lanes

1 and 2 are the amplified fragments of the circular RNA circ _013034 overexpression vector bacterial liquid;

FIG. 5 shows the change of the expression of the circular RNA circ _13034 gene in the over-expression vector group and the empty vector group after the egg-laying duck circular RNA circ _13034 is over-expressed in example 4;

FIG. 6 shows the changes in the expression of the key genes for cell proliferation and apoptosis in the over-expression vector group and the empty vector group after the egg-laying duck circular RNA circ _13034 was over-expressed in example 4.

Detailed Description

Example 1 Ring RNA circ _13034 Gene of laying Duck

First, egg duck circular RNA circ _13034

The cDNA sequence corresponding to the circular RNA circ _13034 of the laying duck is shown in SEQ ID NO 1, and the circular RNA circ _13034 of the laying duck is a new circular RNA molecule obtained by performing a large amount of bioinformatics analysis and screening on the sequencing results of two groups of follicle tissue samples at different development stages based on the sequencing result of the whole transcriptome of the follicle tissue of the laying duck completed earlier by the applicant. The applicant named it as the laying duck circular RNA circ _13034, and the length of the cDNA sequence corresponding to the laying duck circular RNA circ _13034 is 1068 bp.

Preparation of full-length sequence fragment of circular RNA circ _13034 gene of laying duck

1. Primer design and Synthesis

According to the full-length fragment of the sequence of the circular RNAcir _13034 gene in the sequencing result of the whole transcriptome, a primer is designed by adopting Premier Premier 5.0 software, and the sequence of the amplification primer of the circular RNA circ _13034 gene is as follows:

circ_13034-F:CACTAAAATAAAATCTGTTCAATTAACGAATTCGGAATATTCTATCACTCTGATGGTAA(SEQ ID NO：4)；

circ_13034-R:GGCGTTATCATCCCAAATTAGTGGATCCTCAAAAAGGAAAATAAGCACCA(SEQ ID NO：5)；

the above primers were synthesized by Beijing Olympic Biotechnology Ltd. The size of the target fragment DNA is 1068 bp.

2. Sample collection

Collecting 3 parts of each of white follicle and yellow follicle samples of laying ducks in the egg production peak period, cleaning the white follicle and the yellow follicle samples with PBS, puncturing the follicles with a needle to extrude follicular fluid, putting the follicular fluid into an EP (European patent) tube with 1.5mL without enzyme, marking, and then putting the follicular fluid into a liquid nitrogen or refrigerator at minus 80 ℃ for storage.

3. Sample total RNA extraction

Extracting total RNA of follicular tissue by using a traditional TRIzol and chloroform method, which comprises the following steps:

1) grinding by using liquid nitrogen, namely putting 50-100mg of tissue sample into a mortar, pouring a little liquid nitrogen, quickly grinding, adding a little liquid nitrogen when the liquid nitrogen is completely volatilized until the tissue sample is ground into powder, transferring the tissue sample into a 1.5mL centrifuge tube, adding 1mL Trizol, testing the temperature, and standing for 5min to fully crack the tissue sample;

2) centrifuging at 12000g at 4 deg.C for 10min, and transferring the supernatant into a clean 1.5mL centrifuge tube without RNAase;

3) adding 0.2ml chloroform into 1ml homogenate for 15s, and standing at room temperature for 15 min;

4) centrifuging at 12000g at 4 deg.C for 10 min;

5) carefully sucking the upper layer colorless solution out, adding 0.5 times of isopropanol into another 1.5ml centrifuge tube without RNAase, mixing uniformly, testing the temperature and standing for 5-10 min;

6) centrifuging at 12000g at 4 deg.C for 10min, removing supernatant, and precipitating RNA at the bottom of the tube;

7) adding 1mL of 75% ethanol, gently oscillating the centrifugal tube, and suspending and precipitating;

8) centrifuging at 8000g at 4 deg.C for 5min, and removing supernatant;

9) adding 1mL of absolute ethyl alcohol, gently oscillating the centrifugal tube, and suspending and precipitating;

10) centrifuging at 4 deg.C 8000g for 5min, discarding supernatant, and air drying at room temperature;

11) RNA was dissolved in 30-50. mu.L of RNAase-free deionized water and stored at-80 ℃ for further use.

4. RNA sample quality detection assay

RNA sample concentration and OD values were determined using a NanoDrop 1000 microspectrophotometer, and RNA integrity was checked using 1% agarose gel electrophoresis.

5. Cleavage of circular RNA (RNase R)

Total RNA (5. mu.g) was added to the PCR tubes (sterilized) and RNase R was added to the tubes at 3U/ug. The resulting mixture was heated at 37 ℃ for 30min in a PCR apparatus, followed by reverse transcription.

6. Reverse transcription

Reverse transcription kit using Takara

The RT reagent Kit with the instructions of gDNA Eraser reverse transcribes to obtain cDNA template.

1) Reaction for removing genomic DNA

TABLE 1

The reaction conditions were as follows:

42℃ 2min；

storing at 4 ℃.

2) Reverse transcription reaction

The reaction solution preparation process was performed on ice.

TABLE 2

The reaction conditions were as follows:

37℃ 15min

85℃ 5sec

storing at 4 deg.C

7. Acquisition and verification of egg duck circular RNA circ _13034

Tounchdown PCR was performed, and the PCR amplification reaction was as follows (total volume 50. mu.L):

TABLE 3

The reaction procedure is as follows: pre-denaturation at 94 deg.C for 2min, first performing cyclic denaturation at 98 deg.C for 10s, annealing at 65 deg.C for 30s at 0.5 deg.C, and extending at 68 deg.C for 1min for 30 cycles; denaturation at 98 deg.C for 10s, annealing at 50 deg.C for 30s, and extension at 68 deg.C for 1min for 30 cycles; finally, the extension is carried out for 7min at 68 ℃ and the product is stored at 4 ℃.

After the completion of the PCR reaction, 5. mu.L of the PCR product was subjected to agarose electrophoresis analysis, and the results are shown in FIG. 1, in which M in FIG. 1 represents DL2000 DNA marker, and 1 and 2 in FIG. 1 represent the full-length sequence fragment of the circular RNA circ-13034 gene of the target fragment. The obtained target fragment circular RNA circ _13034PCR product is directly sequenced, and the sequencing result is completely consistent with the expected result. Therefore, the experiment successfully carries out PCR amplification to obtain the full-length sequence fragment of the egg duck circular RNA circ _13034 gene with restriction sites of EcoRI and BamHI.

Example 2 fluorescent quantitative PCR detection primer pair for circular RNA circ _13034 gene of laying duck, and detection kit and method thereof

In the embodiment, a fluorescent quantitative PCR detection primer pair is designed, and the objective existence of the circular RNA circ _13034 of the laying duck in the follicular granular cells of the laying duck in the embodiment 1 is identified. The method for identifying and authenticating the mobile terminal comprises the following steps:

1. sample collection

The procedure is as in example 1.

2. Sample total RNA extraction

The same procedure as in example 1 was used to extract RNA.

3. RNA sample quality detection assay

The procedure is as in example 1.

4. Cleavage of circular RNA (RNase R)

The procedure is as in example 1.

5. Reverse transcription

The procedure is as in example 1.

6. Fluorescent quantitative PCR reaction

The nucleotide sequence of the circular RNA circ _13034 gene fluorescent quantitative detection primer is shown as SEQ ID NO:2 and SEQ ID NO:3, respectively.

Fluorescent quantitative PCR was performed using the procedure described in the Takara Real time kit THUNDERBIRD SYBR qPCR Mix, and the reaction system was as follows (20. mu.L):

TABLE 4

Using Roche

Carrying out fluorescent quantitative PCR by a 96SW 1.1 three-step method, wherein the amplification conditions are as follows: 10s at 98 ℃; 94 ℃, 15s, 54 ℃, 15s, 60 ℃, 15s, 40 cycles; 95 ℃ 10s, 65 ℃ 60s, 97 ℃ 1s, 1 cycle.

Data were derived after the reaction was complete and results were used 2^-ΔΔCTThe method is used for analysis. Results of the analysis were plotted using Graphad Prism software.

The results of the expression of the circular RNA circ _13034 gene in the white follicle and yellow follicle tissues are shown in FIG. 2, and the results show that, firstly, the circular RNA circ _13034 gene is expressed in the white follicle and the yellow follicle, and the circular RNA circ _13034 of the laying duck objectively exists in the granulosa cells of the laying duck follicle. Second, the expression level of circular RNA circ _13034 gene in white follicles was significantly higher than in yellow follicles (P < 0.01). Therefore, it can be seen that the circular RNA circ _13034 gene has an important correlation with the development of follicles.

Example 3 construction of circular RNA circ _13034 Gene overexpression vector for laying Duck

The embodiment provides an over-expression vector of an egg-laying duck circular RNA circ _13034 gene, wherein the vector comprises a cDNA sequence corresponding to the egg-laying duck circular RNA circ _ 13034. The vector construction specifically comprises the following steps:

(1) double enzyme digestion treatment of pLCDH-ciR vector

The structure of pLCDH-ciR vector is schematically shown in FIG. 3, and the vector contains restriction sites for EcoRI and BamHI. Carrying out double enzyme digestion on the vector by using two enzyme digestion enzymes EcoRI and BamHI, wherein the enzyme digestion reaction system is as follows, and the total volume of the system is 50 mu L:

TABLE 5

The reaction conditions are as follows: the enzyme is cut for 6h at 37 ℃, and then the cut product is purified and recovered.

(2) Double enzyme digestion of full-length fragment of egg duck circular RNA circ _13034 gene

Purifying the PCR product which is verified to be correct, and carrying out double enzyme digestion on the recovered PCR product by using two endonucleases, namely EcoRI and BamHI, wherein the enzyme digestion reaction system is as follows, and the total volume of the system is 50 mu L:

TABLE 6

(3) Construction of egg duck circular RNA circ _13034 gene overexpression vector

The circular RNA circ _13034 gene fragment amplified by PCR and double-digested is connected with a vector which is also double-digested, and the connection reaction system is as follows (the total volume is 10 mu L):

TABLE 7

The reaction conditions are as follows: ligation was performed overnight at 16 ℃.

Transforming the ligation product into competent cells, and performing colony PCR identification on positive clones, wherein the result is shown in FIG. 4, M in the figure represents DL2000 DNA marker, and 1-2 in the figure represents colony PCR result of single colony; further, sequencing verification is carried out on the recombinant vector laying duck circular RNA circ _13034 gene overexpression vector, and the sequencing result is shown as SEQ ID NO:1 is shown in the specification; the individual with correct colony PCR and sequencing result is the successfully constructed recombinant vector named as circ _ 13034-pLCDH-ciR.

Example 4 detection and analysis of the results of overexpression of circular RNA circ _13034 Gene

First, the separation of follicular granular cells of laying duck

The method for separating the follicular granular cells of the laying duck comprises the following steps:

1. selecting laying ducks in the egg laying peak period, and killing the ducks by jugular vein bloodletting; taking out the whole ovarian tissue, and placing the whole ovarian tissue in a sterile culture dish filled with precooled PBS;

2. washing blood stain with PBS buffer solution containing double antibody, and rinsing for 3 times;

3. transferring the rinsed follicles into a plate filled with precooled PBS buffer solution, and stripping the outer membranes, connective tissues and vascular networks of the follicles;

4. cutting a 1-2cm incision on the surface of the follicle by using a scalpel (the action is quick), releasing yolk, and rinsing the residual yolk solution by using a PBS buffer solution to obtain the remaining follicle membrane: a basement membrane and a follicular granular cell layer;

5. shearing the rinsed follicular membrane as much as possible, placing in a 15mL centrifuge tube, adding 4mL culture medium, repeatedly blowing with 1mL pipette for 1min, centrifuging at 4 deg.C and 1000rpm, and removing supernatant;

6. adding 4mL of 0.2% collagenase II into the precipitate, resuspending the precipitate, and digesting for 30min by placing the precipitate in a constant temperature shaker at 37 ℃ and 80 rpm;

7. at the end of digestion, 4mL of M199 complete medium (containing 10% serum) was added to stop digestion; filtering with 200 mesh stainless steel sieve, washing the mesh with 2mL M199 complete culture medium, collecting filtrate, and centrifuging at 4 deg.C 1000rpm for 10 min;

8. discarding the supernatant, adding 10mL of M199 complete medium, and centrifuging at 4 ℃ and 1000rpm for 10 min;

9. the supernatant was discarded, resuspended in M199 complete medium (containing 10% FBS and 1% double antibody), and the cell density was determined by adjusting the cell density of the suspension to 1X 10⁶one/mL of the cells were inoculated in 6-well plates and incubated at 37 ℃ with 5% CO₂Carrying out static culture in an incubator;

10. after the granulosa cells are cultured for 24 hours, the adherent cells can be used for further research by replacing fresh M199 culture medium containing fetal bovine serum.

Second, cell transfection

1. The circular RNA circ _13034 gene overexpression vector circ _13034-pLCDH-ciR and empty vector pLCDH-ciR obtained in example 3 were diluted in 125. mu.L of Opti-MEM medium, respectively, and 5. mu. L P3000 was added thereto;

2. diluting 250 μ L of Opti-MEM medium

3000 reagent, fully and uniformly mixing;

3. adding 125 μ L of the mixture in (2) to the two tubes of the mixture in (1), and incubating at room temperature for 5 min;

4. 250 μ L of the mixture was transferred to the cells.

Each experimental group was set with 3 replicate wells, and transfected cells were grouped as follows: the vector is transfected by pLCDH-ciR (empty vector group) and circ _13034-pLCDH-ciR (circular RNA circ _13034 gene overexpression vector group). After each transfection group transfects cells for 24h, the cells are digested by Trizol, and total RNA of the cells is extracted for quantitative analysis of fluorescence after overexpression.

Third, fluorescent quantitative analysis

1. Extraction of Total RNA from cells

Total RNA was extracted from the cells according to the method for extracting total RNA described in example 1.

2. Cleavage of circular RNA (RNase R)

The same procedure as in example 1 was used for the cleavage of circular RNA.

3. Reverse transcription

The reverse transcription was performed as in example 1.

4. Fluorescent quantitative PCR reaction

(1) The fluorescent quantitative PCR reaction conditions and method are the same as example 1, wherein the nucleotide sequence of the fluorescent quantitative primer of the circular RNAcirc _13034 gene is shown as SEQ ID NO:2 and SEQ ID NO:3, the amplification conditions were: 10s at 98 ℃; 94 ℃, 15s, 54 ℃, 15s, 60 ℃, 15s, 40 cycles; 1 cycle of 95 ℃ for 10s, 65 ℃ for 60s, 97 ℃ for 1 s;

(2) the nucleotide sequence of the fluorescent quantitative primer of the cell proliferation marker gene cyclinD1 is shown as SEQ ID NO: 6 and SEQ ID NO: 7, the amplification conditions were: 10s at 98 ℃; 94 ℃, 15s, 56 ℃, 15s, 60 ℃, 15s, 40 cycles; 1 cycle of 95 ℃ for 10s, 65 ℃ for 60s, 97 ℃ for 1 s;

(3) the apoptosis marker gene BCL2 fluorescent quantitative primer nucleotide sequence is shown as SEQ ID NO: 8 and SEQ ID NO: 9, the amplification conditions were: 10s at 98 ℃; 94 ℃, 15s, 54 ℃, 15s, 60 ℃, 15s, 40 cycles; 95 ℃ 10s, 65 ℃ 60s, 97 ℃ 1s, 1 cycle.

4. Analysis of results

Data were derived after the reaction was complete and results were used 2^-ΔΔCTThe method is used for analysis. Results of the analysis were plotted using Graphad Prism software. The results of the analysis of the expression level of the circular RNA circ _13034 gene and the expression level of the marker genes for cell proliferation and apoptosis after transfection of the circular RNA circ _13034 overexpression vector of the laying duck are shown in FIGS. 5-6.

As can be seen from fig. 5, after the laying duck circular RNA circ _13034 gene is overexpressed, compared with the empty vector group, the expression level of the circular RNA circ _13034 after the laying duck circular RNA circ _13034 gene is overexpressed is significantly higher than that of the empty vector group (P < 0.01); therefore, the laying duck circular RNA circ _13034 gene overexpression vector can stably express the laying duck circular RNA circ _13034 gene.

As can be seen from fig. 6, when the laying duck circular RNA circ _13034 gene was overexpressed, the expression level of the cell proliferation marker gene CyclinD1 was significantly increased (P <0.01) and the expression level of the apoptosis marker gene BCL2 was significantly decreased (P <0.01) compared to the empty vector group when the laying duck circular RNA circ _13034 gene was overexpressed. Therefore, the circular RNA can be used as a molecular marker for detecting the cell proliferation and differentiation condition in the follicular granular cells of the laying ducks. In addition, the circular RNA has a closed circular structure, is not easy to be attacked by exonuclease, is very stable in an organism, and is an ideal molecular marker.

In conclusion, the laying duck circular RNA circ _13034 gene overexpression vector can stably express the laying duck circular RNA circ _13034 gene, can be used as a detection index to reflect the expression level of the laying duck circular RNA circ _13034 gene, and can be applied to detection of cell proliferation and differentiation conditions in laying duck follicular granular cells.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> institute of zootechnics of academy of agricultural sciences of Hubei province

<120> egg duck circular RNA circ _13034, and detection reagent, method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1068

<212> DNA

<213> cDNA(Artificial Sequence)

<400> 1

ggaatattct atcactctga tggtaacaga ccaggcagca gaaccactca ctggaatatg 60

tcagataaat gttatcattc tggatcaaaa tgacaatgat ctcaggtttg aaaacaacca 120

ctataaatgt aattgagagt cattggatag aatttcagtg ccttgagtgt gagcttaact 180

gatgtctaaa attattggat ttttgtcttt catagcagta aattctgtga ctaattgagt 240

gattgaagcc agaggtgcac ttatcttagt taattgcaga attgtatgta taatattcat 300

taaaaacctg gtatttctca gttagttata atatacaaat ccaagaaagt agttcctgat 360

tttgtgcaat aagctaaaat tccatttgct tatatttcat acaaagcaat tagtccttta 420

gtttaaaaaa aaaaaaaaaa aagcaaaacc agaaaactgg aaaaagtaat agactgaata 480

agaattccag tttatgaatg tgataataca aagttaaatg tgatccatag ctcagatatt 540

ctagagcctc aaaaataatc aagtctgtgc tacacttacc aaaattgacg tattctgtgt 600

agtattctcc ggaataacaa cttcatagct gtccctttcc cactgtggag gttggctttt 660

tgcactggta atagtaacag ctcttgaaac aactggtaat cataacagct cttgaaaaca 720

tcgtttgatt ttatgggcat tgttccaagg ggtaaaaagt ggtatcttcc atacattttt 780

actttagtat ttcttcatat ttcttagtaa gatgttcatg gtactttagt gaattaatga 840

tcagcttgaa ataaccttcc cttacgttag atttcctaag ggaagacaca atagttggga 900

ccagctttct tcgtgttgca gcccctgatg atgactacgg ctcaaatgct gtcattacat 960

actccatagc gaatgaagaa ccagattatt tacagattaa ccctactaca tgctggatgt 1020

ttgtcaacca acccatatct caggtatggt gcttattttc ctttttga 1068

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgtttgtcaa ccaacccat 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctgctgcctg gtctgttac 19

<210> 4

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cactaaaata aaatctgttc aattaacgaa ttcggaatat tctatcactc tgatggtaa 59

<210> 5

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcgttatca tcccaaatta gtggatcctc aaaaaggaaa ataagcacca 50

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cttggatgct ggaggttt 18

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggcttttctt gaggggtt 18

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acggctctcg ctcctgct 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cggttgacgc tctccacg 18

Claims

1. The laying duck circular RNA circ _13034 is characterized in that the cDNA sequence corresponding to the laying duck circular RNA circ _013034 is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein said cyclic RNAcirc 13034 is used as a molecular marker for identifying follicular development of laying ducks.

3. The application of the cyclic RNAcirc 13034 of the laying duck as the molecular marker in detecting the proliferation and differentiation condition of cells in follicular granulosa cells of the laying duck as claimed in claim 1.

4. The primer pair for the fluorescent quantitative PCR detection of the circular RNA circ _13034 gene of the laying duck as claimed in claim 1, which comprises:

5. The fluorescent quantitative PCR detection kit for the circular RNA circ _13034 gene of the laying duck as claimed in claim 1, which comprises: the fluorescent quantitative PCR detection primer pair of claim 4.

6. The assay kit of claim 5, further comprising an RNA extraction reagent, a reverse transcription reaction system, and a fluorescent quantitative PCR reaction system, wherein the fluorescent quantitative PCR reaction system comprises THUNDERBIRD SYBR qPCR Mix, ddH₂O, cDNA reverse-transcribed from the reverse transcription reaction system, and the detection primer set according to claim 4.

7. The detection kit of claim 6, wherein the fluorescent quantitative PCR reaction system comprises: THUNDERBIRD SYBR qPCR Mix 10 uL, 10uM egg duck circular RNA circ _13034 upstream primer 0.4 uL, 10uM egg duck circular RNA circ _13034 downstream primer 0.4 uL, cDNA template to be detected 2.0 uL, ddH₂O7.2. mu.L, total volume 20. mu.L.

8. A method of using the kit of any one of claims 5 to 7, comprising the steps of:

step 1, extracting RNA in a sample to be detected, firstly performing enzyme digestion on circular RNA, and then performing reverse transcription to obtain cDNA;

9. The use of claim 8, wherein the fluorescent quantitative PCR reaction conditions in step 2 are 98 ℃,10 s; 94 ℃, 15s, 54 ℃, 15s, 60 ℃, 15s, 40 cycles; 95 ℃ for 10 s; 65 ℃, 60s, 97 ℃, 1s, 1 cycle.

10. An over-expression vector of the laying duck circular RNA circ _13034 gene, which is characterized by comprising a cDNA sequence corresponding to the laying duck circular RNA circ _13034 of claim 1.