CN1513994A - Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application - Google Patents
Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application Download PDFInfo
- Publication number
- CN1513994A CN1513994A CNA031104428A CN03110442A CN1513994A CN 1513994 A CN1513994 A CN 1513994A CN A031104428 A CNA031104428 A CN A031104428A CN 03110442 A CN03110442 A CN 03110442A CN 1513994 A CN1513994 A CN 1513994A
- Authority
- CN
- China
- Prior art keywords
- gene
- deriving
- mpp
- rice
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A proteinase deprssant gene promoter fragment cloned from paddy rice features pathogenic infection and injury and its induced expression to chemical substance. The binary expression carrier containing the chimeric gene driven by said promoter and its application in resisting diseases and pests are also disclosed.
Description
Technical field
The invention belongs to plant genetic engineering field.Relate to a kind of rice blast fungus that comes from paddy rice concretely and infect inducibility protease inhibitor gene 5 ' ending regulating sequence, infect and injure a kind of paddy rice BowmanBirk proteinase inhibitor gene promoter sequence of abduction delivering type more specifically to rice blast fungus, the Nucleotide of this sequence is formed shown in SEQ ID NO:1, the present invention also further relates to the above-mentioned promotor of use or by one of this promotor deutero-, several fragment or its combination (variant of deriving), starts the application that associated dna sequence is expressed the disease-resistant anti insect gene engineering of being carried out.
Technical background
Paddy rice is one of topmost food crop in the world.In China, the production and supply of rice is matters vital to national well-being and the people's livelihood, and the output and the quality that therefore improve paddy rice are very important.Disease is one of major reason of restriction increasing production of rice and stable yields, and the underproduction that is wherein caused by rice blast can be up to 30% (Baker B, Science such as Zambryski P, 1997.276:726～728), so the harm of control rice blast is the importance that improves rice yield and quality.Although some diseases can be successfully controlled in the application of sterilant, long-term and excessive use agricultural chemicals can influence human beings'health and bring environmental pollution; Though not ccontaining the doubting of traditional high yield and the breeding for disease resistance importance aspect raising rice yield and quality, but also there are problems such as disease-resistant perishability, be that establishing in large scale, popularization single variety often cause the selective pressure to pathogenic bacteria, popular (IanR.Crute etc., The Plant Cell, 1996 that can cause disease, 8:1747～1755, Baker B, Science such as Zambryski P, 1997.276:726～728).
Development along with molecule plant pathology and molecular biotechnology, utilize the gene in plant disease resistance genes, defence gene and signal conduction gene or other source, can obtain disease-resistant or anti-sick plant by the method that transforms plant, but these expression of gene adopt promotor (as 35S promoter) (the Rommens CM etc. of constitutive expression mostly, Curr.Opin.Biotechol., 2000,11:120～125; Bol, J.F etc., Annu.Rev.Phytopatholo.1990,28:113～138).Constitutive promoter can some gene of overexpression (as the defence gene), but the constitutive expression of these genes (as the HR gene) often has destructiveness (de Wit P.J.G.M. to plant, Annu.Rev.Phytopatholo., 1992,30:391～418).The disease-resistant molecule manipulation of ideal should be that plant is only expressed defense response fast when being subjected to pathogen infection harm, thereby stops the pathogenic bacteria expansion, even it is killed.Peng (Integrated Resource Management for SustainableAgriculture, 1994, pp450～453) imagination utilizes the rice blast fungus inducible promoter to drive the disease-resistant related gene expression, to alleviate the degree of hazard of plant in the disease-resistant expression process.Utilize above-mentioned strategy to carry out disease-resistant work up to now mostly only at experimental phase (P.Coutos-Th é venot etc., J.Exper.Bot., 2001,52:901～910), wherein but major cause is effectively start that lacks the pathogen infection abduction delivering that can supply usefulness, therefore, carry out one of molecule breeding for disease resistance mission critical is the promotor that obtains the non-special abduction delivering gene of infection process from plant.
Summary of the invention
The object of the present invention is to provide and a kind ofly infect the paddy rice BowmanBirk protease inhibitor gene 5 ' ending regulating sequence of abduction delivering by rice blast fungus, and this sequence or can be used for regulating and control goal gene or useful gene by its part, several part or combination and be damaged or the expression when stimulating of the harm of sick worm or chemical substance at rice leaf.
Another object of the present invention provides the binary vector of the relevant destination gene expression that is driven by protease inhibitor gene 5 ' ending regulating sequence or its variant of deriving, a kind of contain just like the nucleotide sequence shown in the SEQ ID NO:1 or by the part fragment of this dna sequence dna or fragment through disappearance, sequence change, the binary expression vector that base is added or an isolating once more part, a few part or its combination make up, to be a kind of fragment with promoter activity induce down at pathogen infection can the driving purposes gene transcription and the binary expression vector of expression.Be the sequence of derive variant or an isolating once more part, a few part or its combination added through disappearance, sequence change, base by the nucleotide sequence shown in the SEQ ID NO:1 or by the part fragment of this dna sequence dna or fragment concretely, optional one of them dna sequencing fragment is fitted to and removes the binary expression vector pCAMBIA1301 that 35S has relevant goal gene and go up a kind of binary expression vector that makes up.The present invention also provides a kind of and has transformed the recombinant microorganism that microorganism obtains by the binary expression vector that contains above-mentioned any dna sequence dna.Be specifically related to a kind of recombinant microorganism and be the agrobacterium tumefaciens that transformed by binary expression vector.And their these recombinant microorganisms application in the plant disease-resistant breeding for pest resistance.Make up by above-described dna sequencing fragment with promoter activity, the binary expression vector that contains the dna sequencing fragment of optional one transforms microorganism and obtains recombinant microorganism, and the technology of this acquisition recombinant microorganism is that persons skilled in the art can realize.
The invention provides the section of DNA fragment of from paddy rice, cloning, this fragment or its deutero-variant link to each other with reporter gene and constitute fusion gene, can start the pathogenic bacteria, injury of reporter gene and the chemical substance inducible expression under stimulating when importing paddy rice again, this sequence is included in the nucleotide sequence shown in the SEQ IDNO:1.First-selection is 1 to 2051bp fragment and the fragment with promoter activity that obtained by the gradual change disappearance on this sequence basis in rice protein enzyme inhibitors 5 ' ending regulating sequence according to the present invention, and what reporter gene was chosen is gus gene.
The regulating and controlling sequence that further provides of the present invention drive with the chimeric dna sequence dna of interested goal gene that will express, and the binary vector that contains this fusion sequence.In the goal gene gomphosis DNA array interested of the present invention, first-selected gene to be expressed is the gene of direct inhibition, destruction pathogenic bacteria and insect existence, resistant gene, defence gene, signal conduction gene and the heterologous gene that can effectively control disease and pest (as nontoxic gene, sense-rna etc.) that can in plants such as paddy rice, express.
The present invention also provides a kind of method of cultivating disease-resistant plant, make up a kind of recombinant microorganism that contains described binary expression vector according to the chimeric interested gene of binary vector provided by the present invention (as the above-mentioned gene of choosing), the microorganism of described reorganization wherein is the reorganization agrobacterium tumefaciens.Contain microorganism that binary expression vector transformed and import in the plant and obtain plant disease-resistant or anti-disease by described, the embodiment of a first-selection is to utilize the method rice transformation of Agrobacterium EHA105 mediation.This approach that utilizes recombinant microorganism to transform all is that persons skilled in the art can be accomplished.
The invention provides a kind of protease inhibitor gene 5 ' ending regulating sequence of cloning from paddy rice, being infected by rice blast fungus of the promoter activity first-selection of this sequence induced, and substantially at first at the leaf expression of being injured.The time of expressing dynamically is roughly: 4 hours blade of live body inoculation begins that transcribing of relevant mRNA arranged, and 8-12 hour begins to rise, reached the highest in 36 hours.In a preferred embodiment, this sequence is included among the SEQ ID NO:1.
Term 5 ' ending regulating sequence is 5 ' end upstream sequence from transcription initiation site (as base is A, and is designated as 1) beginning in this specification sheets, and this section sequence comprises the important cis-regulating element of controlling downstream gene expression.Comprise simultaneously from transcription initiation site A to the sequence the translation initiation site ATG of downstream, the change of its base is to the not obviously influence of function of promotor, for making things convenient for the kind and the number (as the design proper restriction site) that itself and being connected of genes involved can change the part base, in a preferred embodiment, the sequence between from A to ATG is among the ACCCCCCAGTACAACCATGGTGA ... the .. indicating section.The NcoI restriction enzyme site of rectangle frame indicating section for adding.
Among the present invention " clone " of dna fragmentation be meant from the natural rice genome of nature isolated, one section promoter sequence that can directly separately utilize without any change.According to sequence of the present invention, can design a pair of primer of upstream and downstream, obtain simply once more by round pcr, also can utilize its label probe from the rice genome library, to screen acquisition, even can synthesize acquisition with classical enzyme process or chemical process, these approach all are that persons skilled in the art can be accomplished.
" variant of deriving " of the protease inhibitor gene 5 ' ending regulating sequence among the present invention refers in SEQID NO:1 sequence between 1 to 2051bp to add or an isolating once more part, a few part or its combination through fragment deletion, sequence change, base on the basis of sequence.The present invention has provided the variant of deriving that MPP2026, MPP 1284, MPP 1131, MPP 1030, MPP 931, MPP 774, MPP 714, MPP 641, MPP 406 series have the promoter activity of different characteristics
The protease inhibitor gene 5 ' ending regulating sequence among the present invention and the promoter activity of the variant of deriving thereof can be confirmed with the expression of GUS by the chimeric reporter gene GUS in the promotor downstream.A preferred embodiment is to utilize the sophisticated method of (EMBO J., 1987,6:3901～3907) foundation such as Jerfferson.
A kind of binary expression vector provided by the invention, this carrier contain pathogen infection and injury inducible promoter, the promotor downstream can chimeric user the interested goal gene that will express.These genes can be both to deposit in the paddy rice according to the source, it also can be the effable heterologous gene (as nontoxic gene etc.) outside the paddy rice, or isolating disease-resistant gene in the plant, signal conduction gene, defence gene and genes involved thereof, crucial enzyme in the perhaps defence process or proteic gene, the plant protecting chemical synthetic gene or the key enzyme genoid that perhaps have direct or indirect germicidal action, also can be from rice blast fungus isolating nontoxic gene or and the sense-rna of the parasitic closely-related gene of rice blast fungus, further can be the gene or synthetic their gene of enzyme of isolating active substance with disease-resistant or insect-resistance in animal or the microorganism.According to function mainly be directly suppress the gene of the albumen of pathogenic bacteria or insect growth or resistance material and general experimenter all can from the related side to scientific and technical literature, database or handbook choose these interested goal gene.The expression vector technology that makes up among the present invention is that those of ordinary skill in the art grasps easily, can be according to (molecular cloning experiment guides such as Maniatis, second edition, cold spring harbor laboratory, 1990) or the associated viscera of documents such as (molecular cloning experiment guide, 1989) such as Sambrook operate.
The present invention also provides the roughly section scope at promotor cis element place, made up the variant of deriving that lacks step by step from its 5 end for this reason, and be fitted to before the gus gene of the binary vector pCAMBIA1301 (professor Jerfferson provides) that removes 35S, more than operation all is the basic skills that those skilled in the art use always, preferred scheme is the primer that the suitable convenient restriction enzyme site that connects is carried in design, with the round pcr acquisition of increasing from original series.
The method of the importing paddy rice of disease-resistant binary expression vector is simple in this area among the present invention, also is that persons skilled in the art can be accomplished.The activity of variant of deriving above-mentioned promotor or its detects and utilizes this promotor to carry out disease-resistant targetedly molecule manipulation, all inevitably in botanical system, carry out, an embodiment preferred is to adopt agrobacterium mediation method (Hiei etc., Plant J.1994,6:271～282; Hiei etc., Plant Mol.Biol., 1997,35:205～218) it is imported in the paddy rice; The experimenter also can select following method for transformation for use flexibly according to the skill level of oneself: (Horsch etc., Science, 1984,234:496 such as protoplastis fusion method, particle bombardment blast technique, electrization, PEG method, leaf dish method; Barton etc., Cell, 1983,32:1033; Acta Phytophysiol.Sin such as Liu, 21:195～205; Science such as Horsch, 227:1229)
Activated other of the promotor according to the present invention variant of deriving, after transgenosis is finished, during the tissue culture from kanamycin-resistant callus tissue to the back immigration physical environment (as the field) of taking root, transforming tissue or the individual activity that similar constitutive expression is arranged, this is because in the tissue culture medium (TCM) during stimulating activity composition or the group training due to its difference with natural plant (as similar damage), promptly loses substantially after recover in the field moving into.
Various sequence provided by the invention can be used as molecular mark probe, can also can be used for the relevant regulating and controlling sequence of other plant as separate this sequence again in paddy rice, and these all are scopes of the present invention.
According to the characteristics of 5 ' ending regulating sequence of the present invention, can cultivate disease-resistant pest-resistant plant with wide spectrum.
According to the characteristics of 5 ' ending regulating sequence of the present invention, can utilize among the SEQ ID NO:1-931 to-774 sequence to suppress the expression of goal gene, thereby targetedly goal gene be carried out functional development.
Below further specify the present invention by accompanying drawing
Description of drawings
Accompanying drawing 1, the DD-PCR result that the BowmanBirk protease inhibitor gene of rice leaf is expressed behind healthy rice leaf and the inoculation rice blast fungus.Illustrate: swimming lane the 1,3, the 5th is the DD-PCR result of material with healthy rice leaf, and swimming lane the 2,4, the 6th is the DD-PCR result of material with rice leaf behind the inoculation rice blast fungus.Arrow A is the difference band.
Accompanying drawing 2, the dynamic Northern of expression after paddy rice BowmanBirk protease inhibitor gene is infected by rice blast fungus analyzes.Illustrate: 0,4,8,12,36 are inoculation time, and unit is hour (h), and A expresses dynamically for the BowmanBirk protease inhibitor gene of inoculation rice blast fungus affinity microspecies 007 for the non-affinity microspecies 131 of inoculation rice blast fungus, B.
Accompanying drawing 3, paddy rice BowmanBirk protease inhibitor gene 5 ' ending regulating sequence and derive variant and the chimeric binary vector synoptic diagram of reporter gene GUS.
Accompanying drawing 4 makes up paddy rice BowmanBirk protease inhibitor gene 5 ' ending regulating sequence and right from the required PCR primer of the variant of deriving of 5 ' end gradual change disappearance.It is right that P135, p136, p137, p138, p139, p140 are respectively the primer of amplification MPP2026, MPP1030, MPP931, MPP774, MPP714, MPP641 BowmanBirk protease inhibitor gene 5 ' ending regulating sequence and gradual change deletant thereof.MPP2026～MPP406 represents the title of promotor or 5 ' ending regulating sequence, and wherein numeral is 5 ' end zero position.Derive variant or contain these segmental transfer-gen plants and all represent of promotor and 5 ' ending regulating sequence thereof in this manual with respective symbol.
Accompanying drawing 6, but infect that induction type BowmanBirk proteinase inhibitor gene promoter drives can chimeric gene of interest pathogenic bacteria, pest damage abduction delivering type binary vector structural representation.
Accompanying drawing 7, the transgenic paddy rice blade of pathogen infection and the genetic expression of injury inducible promoter driven GUS is at processing back GUS expression activity column synoptic diagram such as inoculation rice blast fungus.Illustrate: various zero-time processing and water, SA, JA, injury, the rice blast fungus of being treated to are handled back 12 hours blade and the top blade that is untreated.
Accompanying drawing 8, rice blast fungus infect the transgenic paddy rice blade tissue staining photo that GUS expresses behind the inoculation rice blast fungus of inducible promoter driven GUS genetic expression.Illustrate: MPP2026～MPP406 is transgenic paddy rice inoculation back 8 to 36 hours a GUS dyeing photo, and MPP-W is the transgenic paddy rice GUS dyeing photo of no promotor empty carrier.
Specific embodiments
In order to understand the present invention better, be explained below in conjunction with specific embodiment, but be not to be used for limiting the present invention.
Embodiment 1
Rice blast fungus infects the clone of inductive paddy rice BowmanBirk protease inhibitor gene and 5 ' end upstream regulation and control fragment
1. but rice blast fungus infects the clone of induction type paddy rice BowmanBirk proteinase inhibitor cDNA
Prepare to like to know rising sun kind paddy rice, when treating that the 4-5 leaf is extracted out, live body inoculation rice blast fungus, get incidence of leaf 0,4,8,12,36 respectively, preserve behind the liquid nitrogen freezing immediately, and do the Northern analysis confirmation and induce dynamically (accompanying drawing 2), according to the sample (being designated as the P sample) of dynamically leaving and taking 36 hours of inducing of Northern analysis.Simultaneously, getting nonvaccinated healthy plant blade (being designated as the H sample) preserves standby with quadrat method.
Extract total RNA of P and H respectively, behind dnase digestion miscellaneous DNA, with the synthetic cDNA of SuperscripII Kit, cDNA removes remaining RNA with RNAse H again, promptly can be as the template of pcr amplification.
Amplified production can press mold and radioautograph (accompanying drawing 1) behind the polypropylene electrophoresis, cut the differential expression cDNA band in the inoculation blade then, after the secondary PCR amplification, reclaim and be cloned on the T-easy carrier, sequencing result is made BLAST and is handled in the GenBank database, be speculated as a kind of part fragment of paddy rice BowmanBirk protease inhibitor gene, shown in sequence table SEQ IDNO:2
2.5 the clone of ' end upstream regulation and control fragment
With the above-mentioned clone's of radio isotope P32 mark proteinase inhibitor cDNA, Screening of Rice genomic library.Through subclone, enzyme is cut and is identified and the order-checking affirmation, and the clone has obtained 5 ' end upstream dna fragmentation, and the nucleotide sequence of this dna fragmentation is shown in sequence table SEQ ID NO:1.
Embodiment 2
But rice blast fungus infects the acquisition of a series of variants of deriving of induction type paddy rice BowmanBirk protease inhibitor gene 5 ' end upstream regulation and control fragment
Protease inhibitor gene 5 ' end upstream regulation and control fragment is put into database and is retrieved, and use software analysis, infer its potential cis element position, designing the PCR primer (accompanying drawing 4) that carries suitable restriction enzyme site then before these positions, is a series of variants of deriving (accompanying drawing 5) that lamina membranacea amplifies 5 ' end upstream regulation and control fragment with the original series of cloning
The binary vector structure chimeric of 5 ' end upstream regulation and control fragment and a series of variants of deriving thereof with gus gene
The PCR product of above-mentioned 5 ' end upstream regulation and control fragment and a series of variants of deriving thereof further is cloned in the T-easy carrier, respectively binary vector pCAMBIA1301 is carried out double digestion with the variant of deriving on being cloned into T-easy with identical restriction enzyme, the double enzyme site that the selection of restriction enzyme is carried according to design on the PCR primer carries out.Product behind two groups of double digestions through the dextrane gel electrophoresis separately after, cut the segmental gel piece of target dna, reclaim with reclaiming test kit respectively: (1) binary vector pCAMBIA1301 is the remainder that cuts original 35S, and (2) T-easy carrier is to reclaim promotor and its variant part of deriving that downcuts.Last (1) (2) two portions that will reclaim respectively by a certain percentage mix and connect with the T4 ligase enzyme, connect product transformed into escherichia coli DH5 α bacterial strain, and cut the affirmation of identifying and check order through enzyme.The promotor and the variant of deriving thereof that obtain are: and MPP2026 (2026bp, transcription initiation site A is designated as 1, first base of its upstream is-1 as follows), MPP 1030 (1030bp), (910bp), (774bp), (714bp) MPP 641 (641bp) for MPP 714 for MPP 774 for MPP 910.MPP 1284 (1284bp), MPP 1131 (1131bp) and MPP 406 (406bp) from MPP 2026, and respectively through EcoI, SalI and XbaI single endonuclease digestion, through from successively win (accompanying drawing 5).
Embodiment 4
Rice blast fungus infects the mosaic gene rice transformation that induction type rice protein enzyme inhibitor gene promoters driven GUS expresses
1. binary vector transforms Agrobacterium EHA105
Respectively above-mentioned binary vector plasmid DNA is imported the EHA105 competent cell with electrization, cultivate for 28 ℃ and form single bacterium colony.The single colony inoculation of the Agrobacterium that picking transforms is in the YM liquid nutrient medium that contains 50 μ g/mlKanamycin, and 28 ℃, 220rpm shakes training 16hr, directly bacterium liquid is carried out PCR and identifies.
2. Agrobacterium tumefaciens mediated rice conversion
Prepare the paddy rice immature seed, place on the solid inducing culture (NB), secretly cultivate evoked callus through extruding the paddy rice rataria after the surface sterilization.Peel callus after about 5-7 days, change on the freshly prepared subculture medium (NB), succeeding transfer culture is about 5 days under the same conditions; Perhaps prepare the paddy rice mature embryo callus, select succeeding transfer culture 5-7 days, the yellowish callus of color and luster cultivates altogether.Select state preferably callus cultivated altogether 15-20 minute with an amount of agrobacterium suspension (OD 0.3-0.5), change solid over to altogether on the substratum, 26 ℃ dark culturing 2-3 days.The callus that is total to after cultivating is placed on the screening culture medium that contains 50mg/lHygromycin, and 26 ℃ of dark cultivations 14 days forward to and continue on the freshly prepared screening culture medium to screen 14 days to growing resistant calli.From the resistant calli that after the two-wheeled screening, grows, the resistant calli of selecting the milk yellow densification goes on the division culture medium that contains 50mg/LHygromycin, and dark earlier the cultivation 3 days goes to then under the 15h/d illumination condition and cultivate, through about 15-25 days, grow green point.Further differentiate seedling after 30-40 days.When the bud of resistant calli differentiation grows to about 2cm, seedling is moved on on the root media, cultivate about two weeks, in the greenhouse, transplant and bury.
The evaluation and the analysis of 5 ' end upstream regulation and control fragment and a series of variant promoter activities of deriving thereof
The active detection of GUS adopts tissue staining method and expression amount to determine method: the transgenic line of choosing is carried out the sterilized water surface cleaning, blot the back with aseptic thieving paper and immerse GUS staining fluid (Jefferson, EMBO J., 1987,6:3901～3907), put 28 ℃ after bleeding 5 minutes, the rinsing of decolouring in 70% or 100% ethanol then was until colour developing to spending the night in 30 minutes in reaction on the 200rpm shaking table.
The preparation of material transgenic seedling, the three kinds of situations of immigration 7 to 15 days transgenic seedling of big Tanaka on kanamycin-resistant callus tissue, the root media of dividing are carried out respectively: the not treated substantive dyeing of preceding two kinds of situations; Big Tanaka's seedling adopts the rice blast fungus inoculation to handle, inoculation method one is that point connects rice blast fungus suspension on the young leaflet tablet of clip top, another is that a slice young leaflet tablet of choosing a part of individual plant is inoculated on live body (for to prevent the propagation of rice blast fungus or to cause transgenic seedling to put in order strain death, specific practice is: aseptic little filter paper is immersed in the rice blast fungus suspension, takes out germ-carrying filter paper then and be affixed on rice leaf immediately positive and seal with preservative film).The blade of inoculating 12 hours is carried out GUS dyeing, infect the relationship between expression of inducibility in GUS with what determine rice blast fungus.The result shows: the transgenic line of all structures all showed certain GUS and expresses before moving into the land for growing field crops, but then lose the expression of this similar composing type after moving into land for growing field crops 7-10 days, reason may be in due to some composition influence in dedifferentiation state or the substratum with kanamycin-resistant callus tissue.
In order accurately to understand the relation that induction factors such as each regulation and control fragment and pathogenic bacteria, Whitfield's ointment (SA), jasmonic (JA), injury are handled, choose the transgenic paddy rice seedling and handle (5 independent transformed plants are chosen in every processing at least) respectively, and carry out the GUS active level at 12 hours post-sampling extracting albumen of processing.The method (In:Gallagher SR (ed) GUS protocol Using the GUS gene as a reporter of gene expression.SanDiego:Academic Press, 23～43) of definite employing Martin T of GUS expression amount etc.Specific practice is: get 50mg blade sample, add 200 μ l extraction buffers, fully grind in the ice bath, centrifugal 10 minutes of 8000g leaves and takes supernatant liquor.A part is determined total protein content with the Bradford method then, and another part is got 10 μ l and added 90 μ l4MUG (2mM), 37 ℃ of reactions 2 hours on the 200rpm shaking table, adds sodium carbonate solution (0.2M) termination reaction at last and puts 4 ℃ and prepare against the GUS determination of activity.
The expression of comprehensive clone's paddy rice BowmanBirk protease inhibitor gene dynamically (Northern analysis) (Fig. 2) and GUS tissue staining and quantitative two aspect results can draw: in the blade of in vitro inoculation rice blast fungus, the blade that all generation GUS express all shows certain expression in 4 hours, expressing in 8 hours increases, 48 expression are the highest, show the GUS expression and infect epigamic relation with rice blast fungus, variant structure shows following different type but different bases is derived: the GUS of (1) MPP2026 and MPP1284 expresses not significantly difference, all show certain expression, but the transgenic seedling that expression amount lower (2) contains MPP1131 and MPP1030 structure its GUS when in vitro inoculation expresses a little less than the wanting of (1), illustrates that it has lacked with rice blast fungus to induce relevant cis-regulating element.(3) the GUS activity of MPP910 has dropped to the trace level, infects the inducibility high level expression but MPP774, MPP714, MPP641 but show the rice blast fungus of GUS, and just expressing has the trend that reduces.Here highlight two aspects, the one, may there be the sequence of inhibition of gene expression in the upstream zone of MPP910; The one, MPP774, MPP714 or MPP641 may contain the main component of promoter activity, obvious characteristics is that to infect the expression amount of inducing 12 hours MPP774 at rice blast fungus approximately be 3 times of 35S promoter, if analyze (accompanying drawing 2) according to the Northern analytical results, its expression amount at 36 hours is higher. and the expression of (4) MPP406 induces relation less for rice blast fungus, whether inoculate the expression that does not influence GUS substantially, illustrate with rice blast fungus and induce relevant controlling element, and have basic promoter regulation element (accompanying drawing 7 and accompanying drawing 8)-406 to-1 substantially in-406 upstream.
The structure of embodiment 6 disease-resistant binary vectors
This binary vector is to make up on the basis of embodiment 3.Be example with the building process of the disease-resistant binary vector that come by MPP2026 only, the variant of deriving of other a series of promotors all can obtain by this method herein.The MPP2026 plasmid was cut 6 hours with the BstEII enzyme, mended flatly then with T4 DNApolymerase, be dissolved in two the steaming in the sterilized waters after the imitative extracting of phenol and cut, be i.e. the binary vector that acquisition can chimeric disease-resistant related gene with the NcoI enzyme.Be about to chimeric gene and can have NcoI site joint existing or that increased afterwards at 5 ' end, its 3 ' end should be a smooth end.In addition, for can chimeric each genoid, can be flat with mending behind BstEII and the NcoI double digestion, be about to chimeric gene and should do not contain the ATG codon, and identify and be connected into direction (accompanying drawing 6).
Sequence table
＜110〉China Agricultural University
＜120〉a kind of pathogen infection and injury inducibility gene promoter and application thereof that comes from paddy rice
＜130〉Peng You good 2003
<160> 2
<170> PatentIn?version?3.1
<210> 1
<211> 2051
<212> DNA
<213> Oryza?sativa
<400> 1
cttgaggatg?cacgttgtgc?tattggcgat?gcacacaacg?agttctaccc?tgaccctctg 60
agcgaccaca?atttaagtta?taacacgtat?gtctcggacc?ggtccaacga?tgtgagtcaa 120
aatagtggcg?tgtctatgat?ggagcataat?tttgggaggg?tgcctacaat?ggcctccggt 180
cctgctgcac?gataaaaaga?ctttcttccc?atttggtgta?gagaccgttt?gatacgtcat 240
ccgtgtaaga?gatccataca?tctagcctgt?taattgagtt?tgtcttagtt?aaatcaatgc 300
aaatacacaa?attccagaca?ttcgatttct?ttactacttt?ttctaggttt?tagaatgaaa 360
tgcaaataaa?tgcacattat?tcacattatt?tttacaactc?ggaatgcagt?aattagatta 420
atttctaatt?tttcctgttc?ttcctccact?gtgaagtgct?atggtgccat?tgatgttgga 480
aatataaacc?cataatttga?actagcgcaa?aattaaggtc?aatgtttggc?acaactacaa 540
atcttaaata?gaaggtaggt?ttgaagttta?tacacgttaa?attatagtgg?tttaaaattt 600
taatttttat?ttaaaataaa?aacaaaatga?tttattgcat?atttatatca?tggatttgag 660
gcatgtcgaa?gagggccggt?gtacgttcat?gggacttcta?ctcatgacca?gacctacatg 720
agttgctcta?agcctctctg?aattcgctgg?ccgctcacct?ccaccatcgg?agattcctct 780
ccgacgaggc?gacgacgacg?tacgactcct?acccttagca?tgcggcgcgt?gcgtgcgtct 840
tgcgcgctgc?tgcgcgcgtg?cacgtgcttg?tgttgggcat?ccacttgtgc?tcgtcgacca 900
gaccgtacac?gcaccacgtg?cgcatgcgca?catgcgatgc?gtacagtaga?gaagagaggg 960
tacagagatc?agattccgac?gcactacgtg?tcatcgcagt?ctcacgtagt?tacaatgtgg 1020
ataacgtact?tctaaaatta?ataatgcgac?gtcaccatca?ccgatcacgg?ggtggaaatt 1080
agaaattgct?ccatgctttg?catgcatggc?aacccatgca?tgcatgtcac?tccagacgat 1140
cgagcaaacc?cagctaaatg?gatagtccca?ccgatcggtt?atcattataa?tagccttagc 1200
taaaaataaa?ttatgaaatt?ttaaaattag?ttttaatgtt?agtcgttaaa?agtttttatt 1260
tataaattaa?attttgtttt?taataagccg?ttttgtgttt?atcttttaag?ttaaattatc 1320
ctatgctttc?gagataataa?gttatcctaa?gtttaaccaa?gatttataga?gaaaattatt 1380
aacatctaac?catattaagg?agtaaattgt?taaaatatac?tactattata?taatggatct 1440
atctaatgac?actcatttaa?tatcataaat?attatttttt?aaacttatag?cagttagact 1500
taggacaaac?atatgatcga?tcacctgtat?tttggtggaa?tggagtagca?cacaatatat 1560
gttactccct?ccatttcaac?tggttatatg?acgttttgac?tttgatcaaa?gtcaaactac 1620
tctagattag?actaacatta?tagaaaaaat?aataatattt?acaacaccag?tatagtttta 1680
ttaaatctat?aattgaatat?tttttcataa?tatatttgta?ttaggttcaa?agtattacta 1740
ttacttttat?aaaattagtt?aaatttaaag?tcgtcttata?agattaatcg?atgaatcgga 1800
gggagtacgt?tatactagta?gtaccgtatt?agctgcgttg?cttgttgatt?aattaattcg 1860
tcctatatgt?gtgcatgcat?atatacgcgt?ggcaatggat?cggaggcctc?cacgtgctct 1920
tatcctcatg?caagtcagca?tttgtgattg?ggtaagggcg?cgctatacat?attagtcggt 1980
cgatctctat?ctataaatat?taaccactcg?acccatcact?aacacccaca?ccccccagta 2040
caaccaagat?g 2051
<210> 2
<211> 1050
<212> DNA
<213> Oryza?sativa
<400>?2
gctacttcca?ccatcctgct?cttcctcctc?gccggcctcg?ccgccgccca?cggcgacggc 60
gacaccacca?tccgtctccc?cagcgacggc?gccaaagcat?cacgaccacg?cgccgccaaa 120
ccatgggact?gctgcgacaa?catcgagatc?tcccggctaa?tgatctaccc?gccactgtac 180
cgctgcaacg?acgaggtgaa?gcagtgcgcc?gccgcctgca?aggagtgcgt?ggaggcgccc 240
ggcggcgact?tcaacggcgg?cgccttcgtc?tgcagtgact?ggttctcgac?ggtggacccc 300
ggccccaagt?gcacggcggc?gctggatggg?ctgtcgatgg?agaagccgtg?gaagtgctgc 360
gacaacatcg?agcggctgcc?gacgaagacc?aacccgccgc?agtggcgctg?caacgacgag 420
ctggagccca?gccagtgcac?cgccgcgtgc?aagtcgtgcc?gggaggcgcc?ggggccattc 480
ccggggaagc?tcatctgcga?ggacatctac?tggggcgccg?acccgggccc?cttctgcacg 540
ccgcggacat?ggggagattg?ctgcgacaag?gccttctgca?acaagatgaa?cccgccgacc 600
tgccgctgca?tggacgaggt?gaaggagtgc?gccgacgcgt?gcaaggattg?ccagcgcgtg 660
gagtcgtcgg?agccgcctcg?ctacgtctgc?aaggaccgct?tcaccggcca?tcccggcccc 720
gtgtgcaaac?cccgagcgga?gaactagcta?gctacagatg?atcgatgatc?gatctgtgtg 780
tccatcaata?aaactcgccc?tagcttgcag?ctagctgatc?gttcgttcga?tcattcagag 840
ttggtatagc?tagaggctag?agcttagctc?catccagatt?tttcagtgct?ctgcagcttt 900
tgtgcatctt?gcatgctttg?ttagtttgtg?tgctccatgt?gtgtgggtgt?gtttgtctct 960
gttcgcttgt?gtggaccatg?aggaaaaata?aaataaatat?gcaatgcaag?cgtggatatg 1020
taccccaaaa?aaaaaaaaaa?aaaaaaaaaa 1050
Claims (18)
1. regulating DNA sequence from paddy rice clone with pathogen infection and the active one section protease inhibitor gene of injury inducible promoter 5 ' end upstream, has the nucleotide sequence shown in SEQ ID NO:1, when plant tissue be subjected to pathogen infection or sick worm harm or physical injury, when chemical substance stimulates, this sequence or wherein the part fragment can regulate and control goal gene or useful gene transcription, expression.
2. one kind according to the described dna sequence dna of claim 1, by isolating one or several fragment in this sequence, and perhaps disappearance, replacement or the interpolation of one or several base in these fragment sequences, and the variant of deriving that reconfigures acquisition of above-mentioned sequence.
3. the variant of deriving according to claim 2, be meant from 5 ' different gradual changes disappearances that end carries out obtain, MPP 2026, MPP 1284, MPP 1131, MPP 1030, MPP 931, MPP 774, MPP 714, MPP 641, MPP 406 regulation and control fragment are wherein arranged, and they are the variants of deriving that have the promoter activity of different characteristics under induction pathogen infection and noxious stimulus.
4. according to the described MPP774 of claim 3 variant of deriving, it is characterized in that the MPP774 direct driving purposes gene of the variant infection process inducibility of deriving rapidly and efficiently expresses, its dna sequence dna in SEQ ID NO:1-774 to 1 between part.
5. according to the described MPP714 of claim 3 variant of deriving, the injury inducibility that it is characterized in that deriving MPP714 variant is directly used in the driving purposes gene is rapidly and efficiently expressed, its dna sequence dna in SEQ ID NO:1-714 to 1 between part.
6. according to the described MPP641 of claim 3 variant of deriving, it is characterized in that the inducibility that MPP641 is directly used in the driving purposes gene rapidly and efficiently expresses, its dna sequence dna in SEQ IDNO:1-641 to the part between the l.
7. according to the described MPP931 of claim 3 variant of deriving, it is characterized in that MPP931 has influence or suppresses the effect of promoter activity, it is distributed in the part between-931 to-774 among the SEQ ID NO:1.
8. the dna sequence dna of inhibition promoter activity according to claim 7, control deleterious gene or weaken application in the expression of goal gene in cultivating transgenic plant.
9. according to the described sequence of claim 1 to 3, its promoter activity and expressive site are limited to the damaged blade that infected or near the young tender and newborn blade it.
10. one kind contains by claim 1 or 2 or 3 described sequences optional one of them dna sequencing fragments and makes up, and this fragment with promoter activity is induced down at pathogen infection can the driving purposes gene transcription and the binary expression vector of expression.
11. binary expression vector according to claim 10 is to be fitted to by claim 1 or optional one of them dna sequencing fragment of 2 or 3 described sequences to remove the last a kind of binary expression vector that makes up of binary expression vector pCAMBIAl301 that 35S has relevant goal gene.
12. recombinant microorganism that contains claim 10 or 11 described binary expression vectors.
13., be a kind of agrobacterium tumefaciens that has transformed by claim 10 or 11 described binary expression vectors according to the described recombinant microorganism of claim 12.
14. according to claim 1,4,5,6,8,10,11 described goal gene, it is characterized in that it being by isolating disease-resistant gene in the plant, defence gene and genes involved thereof, crucial enzyme in the perhaps defence process or proteic gene, the plant protecting chemical synthetic gene or the key enzyme genoid that perhaps have direct or indirect germicidal action, also can be from rice blast fungus isolating nontoxic gene or and the sense-rna of the parasitic closely-related gene of rice blast fungus, further can be the gene or synthetic their gene of enzyme of isolating active substance with disease-resistant or insect-resistance in animal or the microorganism.
15. the breeding approach of anti-rice disease and insect pest, it is characterized in that by the described binary expression vector of claim 11 to 13, optional binary expression vector one of them or by the microbial transformation paddy rice that contains this binary expression vector, obtain genetically modified rice plant.
16. the breeding approach of anti-Plant diseases and insect pest is characterized in that transforming plant according to described binary expression vector of claim 12 to 14 or the recombinant microorganism that contains this binary expression vector, obtains genetically modified disease-resistant, pest-resistant cash crop.
17., be used for the variant and obtain the answering of relevant regulating and controlling sequence of plant of deriving that paddy rice separates promoter activity with different characteristics again in the preparation molecular mark probe according to claim l or 2 or 3 described dna sequence dnas.
18. according to the described dna sequence dna of claim 1 to 3, the application in the disease-resistant pest-resistant harm that cultivates plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031104428A CN100436582C (en) | 2003-04-15 | 2003-04-15 | Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031104428A CN100436582C (en) | 2003-04-15 | 2003-04-15 | Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1513994A true CN1513994A (en) | 2004-07-21 |
| CN100436582C CN100436582C (en) | 2008-11-26 |
Family
ID=34239203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031104428A Expired - Fee Related CN100436582C (en) | 2003-04-15 | 2003-04-15 | Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100436582C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100457906C (en) * | 2006-04-06 | 2009-02-04 | 北京凯拓迪恩生物技术研发中心有限责任公司 | Specificity start factor of paddy rice traumatic tissue and uses |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1268182A (en) * | 1997-09-15 | 2000-09-27 | 分子农业生物学院 | RANK1, an ankyrin-repeat containing peptide from rice associated with disease resistance |
-
2003
- 2003-04-15 CN CNB031104428A patent/CN100436582C/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100457906C (en) * | 2006-04-06 | 2009-02-04 | 北京凯拓迪恩生物技术研发中心有限责任公司 | Specificity start factor of paddy rice traumatic tissue and uses |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100436582C (en) | 2008-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1912126A (en) | Plant anther specific promoter and its application | |
| CN107099544A (en) | The PL LbCpf1 RVR genes of identification specific site and its application in paddy gene target practice | |
| CN107142271A (en) | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting | |
| CN109266650B (en) | Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter | |
| CN105087598A (en) | Rice waterlogging stress response RS1 gene and application thereof | |
| CN113151300B (en) | CAMTA3 gene and application thereof in plants | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN111635904B (en) | Gene CsWRKY10 for enhancing cucumber target spot disease resistance and application thereof | |
| CN1375005A (en) | Gene regulating plant branching, vector containing the gene, microorganism transformed by the vector, and method for regulating plant branching by using the microorganism | |
| CN101845445A (en) | Cre recombinase recombination gene and Cre/loxP-mediated transgenosis safe plant expression vector | |
| CN101063138A (en) | Plant flower organ specificity promoter and its application | |
| CN1888071A (en) | Chuancao-II Laomangmai wheat pest-resisting gene genetically modifying technology | |
| CN107058324B (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivation method | |
| CN1296383C (en) | Plant DREB transcription factor and its coding gene and uses | |
| CN1940072A (en) | Antiglyphosate gene and its use | |
| CN1429904A (en) | Method for gene conversion of corn | |
| CN1513994A (en) | Pathogenic bacteria infection from padly rice and injure induced gene promotor and its application | |
| CN110055263B (en) | Gene Cry1Ab-MR encoding Bt insecticidal protein, expression vector and application thereof | |
| CN1044385C (en) | Rice genus resisting rice genus leaf stripe virus with transformed behavious and its mfg. method | |
| CN100336904C (en) | Pathogen from rice, chemically inducible promoter and their use | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN102703450B (en) | Corn WUS1 gene promoter and application thereof | |
| CN1206354C (en) | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression | |
| CN112481264A (en) | Application of promoter GmLCLa1 in response to abscisic acid treatment and water stress of regulatory gene | |
| CN1821407B (en) | High efficiency stable expression system of transgene tomato |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20081126 Termination date: 20100415 |