CN1513990A - Plant gene promotor for quickly inducing defect stimulation and high efficienly expression - Google Patents
Plant gene promotor for quickly inducing defect stimulation and high efficienly expression Download PDFInfo
- Publication number
- CN1513990A CN1513990A CNA031310516A CN03131051A CN1513990A CN 1513990 A CN1513990 A CN 1513990A CN A031310516 A CNA031310516 A CN A031310516A CN 03131051 A CN03131051 A CN 03131051A CN 1513990 A CN1513990 A CN 1513990A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- dna
- plant
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A plant gene promotor able to quickly sense external traumatic irritation and promote efficient expression of its downstream gene is prepared from the gene promoter of rice. It can be used for the gene engineering to resist the diseases and pests of plant and the stress-resistant gene engineering of plant.
Description
Technical field
The dna sequence dna and the application approach thereof of the plant gene promoter that the present invention relates to a kind of quick induction destructive stimulus and efficiently express belong to plant genetic engineering field.Specifically, the quick expression that can produce a kind of Bowman-Birk protease inhibitor gene through the damaging paddy rice of inducing processing, utilize the sequence of this expressing gene can from paddy rice, separate this quick induction destructive stimulus and the dna sequence dna of the paddy gene promotor that efficiently expresses, the present invention also is included in a series of dna fragmentation or combinations with promoter activity of can deriving on the basis of this promotor, and the resistant gene engineering and the molecular breeding approach that utilize pest-resistant, the disease-resistant or degeneration-resistant border injury of their chimeric goal gene.
Technical background
Paddy rice is one of most important farm crop in the world.Because but rice has high nutrition regulating body function and diversified characteristics, paddy rice has become the most valued now cereal class grain.Therefore how to improve the quality of rice, improve the diseases and insect pests resistance of paddy rice, increase yield of brown rice etc. has become the common issue of breeding scholar and phytopathologist's research.Paddy rice will be stood the threat of multiple disease and pest in process of growth: China 1991 is only because one of the big generation of planthopper just causes paddy to lose about 1,660,000 tons; With rice blast be in addition the disease of representative cause the paddy rice underproduction can be up to 30% (Baker BP., etc., Science, 1997,276:736～728).Therefore to make rice reach high yield and the just necessary control rice pest of stable yields.
As everyone knows, the position is a fixed behind the plant fixing, shows conforming of its all one's life " passive ", and the situation of the infringement of can't escaping.The rows of plants main mode of removing injurious factors such as sick worm is the help that relies on manpower for a long time for this reason, as using agricultural chemicals etc.But the use of agricultural chemicals can cause the accidental injury of the injury of non-target organism factor, particularly beneficial organism, and brings bad consequence such as environmental pollution, so people more pay attention to itself seeking effective means and approach carries out the control of disease and pest from biological.In fact, " passive " of plant be surface phenomena just, has formed protection mechanism one defense response that similar animal escapes in the long-term evolution process of plant, is between the different plants, there are differences between the plant individual.Crop breeding is exactly to select good kind or concentrate good character selection by hybridization according to its difference.Not ccontaining doubtful traditional disease-resistant worm breeding measure has made certain contribution for the high crop yield stable yields, and will play an important role in one period.But also day by day expose the one side of its fragility, long as the cycle, hold effect weak point and resistance and mostly be vertical resistance, thereby can cause selective pressure, promote pathogenic bacteria or the accelerated evolutionary of insect and the appearance of dominant races.Along with development of molecular biology, molecular breeding is that traditional breeding method has injected new vitality, from routine transgenic plant appearance of nineteen eighty-three first, just reaches its maturity by genetically modified molecular breeding now.
Realize that plant wide spectrum and permanent disease-resistant insect pest are that the dreamboat that people pursue utilizes the molecular breeding means always, the realization of this target is become a reality.Monsanto Company imports cotton with the Bt gene of CaMV35s promoters driven, has realized the effective control of cotton to insects such as bollworms.In addition, also there is the successfully report of test disease-resistant aspect, as driving disease-resistant with CaMV35s or other constitutive promoters or defending the effective control (Anne Simon Moffat, Science, 2001,292:2270～2273) of genetic expression to pathogenic.But it should be noted that: CaMV35s is the promotor of constitutive expression, long-term expression in the plant survival time not only can cause powerful selective pressure to causing harmful biotic factor, and also may cause physiological effect (Aulbert SH. etc. to plant itself, Annu.Rev.Phytopathol, 2001,39:285～312).Therefore, thus the disease-resistant strategy of ideal should be a plant only to be produced resistance material or the protection material of self fast and makes plant avoid infringement when being subjected to the harm of factor such as disease worm.Peng (Integrated ResourceManagement for Sustainable Agriculture, Ed.by Shi and Cheng.Beijing Agricultural University Press, 1994, PP 450～453) imagination is utilized the chimeric resistant gene of promotor of inducible expression's gene, thus the conversion plant reaches the purpose that wide spectrum is held the effect resistance.Clearly to realize this imagination, must possess two conditions: the one, the resistant gene that can Gong select for use is arranged, the one, the infringement inducible promoter should be arranged.At present, relevant resistance, the gene report of aspects such as defence or signal conduction is more, this provides abundant goal gene material for effectively carrying out disease-resistant worm molecular breeding, but the infringement inducible promoter, particularly can be effective to broad-spectrum disease resistance worm purpose and sick worm to encroach on the promotor of non-special abduction delivering less.The invention provides a kind of section of DNA sequence of from paddy rice, cloning, have the promoter activity of the abduction delivering of damaging infringement: have the characteristics of the non-special infringement abduction delivering that is subjected to pathogenic bacterias such as rice blast fungus on the one hand, thereby can be used for disease-resistant; On the other hand owing to have quick expression characteristic behind the injury equivalent damage sexual stimulus, and the damage that causes according to the insect feeding plant and the damage of other nocuity all are nonspecific characteristics (Andr é Kessler and Ian T.Baldwin, 2002, Annu.Rev.Plant Biol.53:299～328), so can also be used to promotor as anti-insect.
Summary of the invention
The plant gene promoter that the invention provides a kind of quick induction destructive stimulus and efficiently express, this promotor is to separate to obtain from paddy rice, have rice blast fungus and contaminate epigamic characteristics, the upstream regulatory sequence that belongs to paddy rice Bowman-Birk protease inhibitor gene is the nucleotide sequence shown in the SEQ ID NO:1; When this promotor or its variant of deriving import in the paddy rice again, can respond to destructive stimulus, and start the expression of its downstream mosaic gene.This promotor or its are derived in the variant, and at the expression activity that drives reporter gene GUS, PIPA has the strongest expression characteristic.
The present invention provide simultaneously obtain promotor derive variant approach and analyze the process of promoter activity section, can find the functional section of promotor by derive characteristics that variant drives the GUS expression activity of promotor.
The present invention also provides the binary expression vector of the disease-resistant worm of broad spectrum durable, utilizes this expression vector to be used for disease and insect resistance by the interested goal gene of chimeric user.
According to content of the present invention, purpose is to provide the breeding approach of broad spectrum durable disease and insect resistance, utilizes the binary expression vector of the disease-resistant worm of broad spectrum durable of the present invention specifically, with agrobacterium-mediated transformation mosaic gene is imported in the plant.
Following content will make an explanation to the Essential Terms among the present invention, and the embodiment that is described in detail with reference to the accompanying drawings:
Term among the present invention " separation " is for independently obtaining by certain means from the paddy rice that exists naturally.Obtaining means among the present invention is: at first show that by difference PCR method (DDRT-PCR) finds rice blast fungus to infect the band of abduction delivering, with the difference band is probe Screening of Rice cDNA library, to the positive colony sequential analysis, as probe Screening of Rice genomic library, obtain the upstream DNA regulating and controlling sequence of differential gene at last.
Promoter region or 5 ' ending regulating sequence among the present invention refer to from transcription initiation site
The part of beginning (being designated as 1) its upstream.UTR partly for from A, extends to the downstream translation initiation site
Between part, the part base of this partial sequence or the non-intrinsically safe of number change not obvious to the change of promoter activity.This partial sequence is
TCACAAGCACCCACACCAACCAAAG
Promoter activity among the present invention detects the foundation that is expressed as with reporter gene GUS, and by the binary expression vector of the chimeric GUS of structure promotor, and the expression that makes it in paddy rice realizes.The present invention adopts the method for Jefferson etc. (EMBOJ., 1987,6:3901～3907), and improves a little.
Quick induction destructive stimulus among the present invention and efficiently express the binary vector of goal gene obtains for transforming on the basis of pCAMBIA301 (professor Jefferson provides)." destructive stimulus " refers to cause rice leaf destructive influence mode (as the destruction behind the inoculation rice blast fungus in the invention process, tool marks damage etc.).The gene of the resistance aspect that " goal gene " will be selected for use for the user can be the dna sequence dna that obtains in the genome, also can be the cDNA sequence, and all are all decided according to user's purpose.Making up binary vector and selecting goal gene for use all is molecular biological method commonly used, can be with reference to (molecular cloning experiment guide, second edition, cold spring harbor laboratories such as Maniatis, 1990) or the associated viscera of documents such as (molecular cloning experiment guide, 1989) such as Sambrook operate.
The checking of promoter activity is carried out in the rice conversion system among the present invention, and method therefor is an agrobacterium mediation method.Certainly do not get rid of additive method: as (Horsch etc., Science, 1984,234:496 such as protoplastis fusion method, particle bombardment blast technique, electrization, PEG method, leaf dish methods yet; Barton etc., Cell, 1983,32:1033).
Promotor among the present invention transfer-gen plant have seedling stage whole strain, systematicness, constitutive expression phenomenon, this may to immature plant better resist damaging infringement and healthy growth and development favourable.
A main purpose of the present invention provides quick induction destructive stimulus and efficiently expresses a kind of plant gene promoter of goal gene and the binary expression vector of this promoters driven; and the sequence among the present invention all can be used as and touches the separation once more that plate or probe are implemented this sequence, also is protection scope of the present invention certainly.
According to above content, this promotor may have the engineered application potential of disease-resistant worm that wide spectrum is held effect.
The following drawings is for clearer and vivid explanation cause of the present invention:
Description of drawings
Accompanying drawing 1, paddy rice is transcribed the time dynamic schematic diagram (Northern analysis) of Bowman-Birk proteinase inhibitor behind the inoculation rice blast fungus different time.Illustrate: 0,4,8,12,36 are inoculation time, and unit is hour (h).
Accompanying drawing 4, PIPA, PIPH, PIPX drive tissue staining and the fluorometric analysis that GUS expresses in rice leaf.Processing in each structure is followed successively by water from left to right, cutter damage, processing such as inoculation rice blast fungus.Top is divided into GUS fluorometric analysis histogram, and the longitudinal axis is the GUS expression amount, and unit is 4-MU nmol/min/mg total proteins; The bottom is divided into the tissue staining photo of GUS, and PIPW is the carrier that removes the pCAMBIA1301 of 35s promotor, and PIPK is the carrier of primary pCAMBIA1301.
Specific embodiments
Following examples just as example explanation contriver's implementation process, do not limit
Practical range of the present invention is not got rid of the user yet and can be used other effective scheme.
Rice blast fungus infects the inductive paddy rice Bowman-Birk protease inhibitor gene 5 ' clone of end upstream regulation and control fragment and the acquisition of the variant of deriving thereof
The love of live body inoculation rice blast fungus when 4 leaves are extracted out is known rising sun kind paddy rice, gets incidence of leaf, and preserves behind the liquid nitrogen freezing immediately in 36 hours; Simultaneously, get nonvaccinated healthy plant blade in contrast, preserve standby with quadrat method.Obtain purified total RNA respectively, with the synthetic cDNA of SuperscripII Kit, as the template of pcr amplification.Amplified production can press mold and radioautograph (accompanying drawing 2) behind the polypropylene electrophoresis, cut the differential expression cDNA band in the inoculation blade then, after the secondary PCR amplification, reclaim and be cloned on the T-easy carrier, sequencing result is made BLAST and is handled in Gen Bank database, be speculated as a kind of part fragment (SEQID NO:2) of paddy rice Bowman-Birk protease inhibitor gene.With this cDNA is the template synthesising probing needle, the Screening of Rice genomic library.Through subclone, enzyme is cut and is identified and the order-checking affirmation, and the clone has obtained the dna fragmentation of 5 ' end about 2000bp in upstream.
The sequence homology comparison is finished by software DNASTAR, the TATA box of promoter region and transcribing opens the beginning site and is inferred by software, the upstream plant gene cis element scope of cis element retrieval in the TRANSFAC database carried out (http://transfac.gbf.de/cgi-bin/mat Search/matesearch.pl), by the core sequence (coresequence) of MatInspector V2.2 software contrast cis element and the sequence of both sides thereof, obtain the similarity data by matrix operation.Being set to of search argument of the present invention: the core sequence similarity is 1.0, and promptly search sequence is consistent with the core sequence of known cis element; Matrix operation similarity (matrix similarity) is 0.9 0, i.e. the sequence of core sequence both sides similar to known cis element on 0.90 level (this parameter maximum value is 1.00).The cis element of promoter region retrieval gained should satisfy above parameter setting.Based on above analysis, before these positions, look for suitable restriction enzyme site enzyme to cut and obtain its variant of deriving.
Rice blast fungus infects the structure of the chimeric binary vector of inductive paddy rice Bowman-Birk protease inhibitor gene 5 ' end upstream regulation and control fragment and gus gene
For touching plate, carry out pcr amplification with the regulation and control fragment that is cloned in the prediction on the T-easy carrier, reclaim and expand in order to a pair of primer (dash area is the restriction enzyme site that adds) down
5-ACT
GGGTGATACCCGTA-3(SalI)
5-AAT
TTGGTGTGGGTGCT-3 (NcoI) increases fragment and uses SalI, NcoI double digestion 6 hours, precipitate 10 minutes fast on ice behind the dehydrated alcohol of 3 times of volumes of adding, then the precipitation of 13000g after centrifugal 10 minutes under the 4 degree low temperature is connected (using the T4 ligase enzyme) with the distilled water dissolving and with the pCAMBIA1301 residue carrier of cutting with same enzyme, get a certain amount of connection product electric shocking method and import in the XLI-Blue intestinal bacteria, also check order after enzyme is cut and identified and confirm.This carrier is designated as PIPA (all hosts of containing this carrier remember with this that also other is same).
On the basis of carrier PIPA, cut with HpaI and SmaI enzyme, reclaim the residue carrier then and import intestinal bacteria by above-mentioned with quadrat method, and order-checking is confirmed from connecting the back.The gained carrier is designated as PIPH.The acquisition of PIPX is used XbaI enzyme cutting equally based on PIPA, reclaims the residue carrier then from connecting, and exactness is confirmed in order-checking.
Rice blast fungus infects the analysis of induction type rice protein enzyme inhibitor gene promoter activity
Respectively above-mentioned binary vector plasmid DNA is imported the EHA105 competent cell with electrization, and confirm the exactness of conversion.Use Agrobacterium tumefaciens mediated method rice transformation then, carry out the promoter activity analysis.Specific practice is: prepare the paddy rice immature seed, place on the solid inducing culture (NB) through extruding the paddy rice rataria after the surface sterilization, secretly cultivate evoked callus.Certain hour peels callus, changes on the freshly prepared subculture medium (NB), under the same conditions the identical time of succeeding transfer culture.Select state preferably callus cultivated altogether 20 minutes on the substratum altogether at liquid with an amount of agrobacterium suspension (OD 0.3-0.5), change solid over to altogether on the substratum, 26 ℃ of dark culturing 3 days.Relay then on the screening culture medium that contains the 50mg/l Totomycin, 26 ℃ of dark cultivations 14 days are continued screening again to growing resistant calli after on identical screening culture medium.The resistant calli of selecting the milk yellow densification goes on the division culture medium that contains the 50mg/L Totomycin, and earlier dark the cultivation 3 days goes to then the 15h/d illumination condition under and cultivate, until breaking up and growing seedling.Seedling moved on on the root media be transplanted in the greenhouse after the rejuvenation.Promptly supply the promoter activity analysis about 10 days as transgenic line.
The analysis of promoter activity is a standard with the expression activity of GUS.Tissue staining method and fluorescent quantitation (Jefferson, EMBOJ., 1987,6:3901～3907) are adopted in the active detection of GUS.The independent transfer-gen plant of choosing certain number and strain shape unanimity scratches with inoculation rice blast fungus, metal cutter respectively, and control treatment is spray cloth distilled water.Peng (Can.J.Bot.1988, method 66:730-735) are pressed in preparation of rice blast fungus spore suspension and inoculation.The time of drawing materials all carried out in processing in back 12 hours, and a material part is used for the GUS tissue staining, and another part is used for the fluorescent quantitation of GUS.The result shows (seeing accompanying drawing 4): rice blast fungus or cutter scuffing etc. were handled after 12 hours, the paddy rice that changes PIPA, PIPH, PIPX three structures is with comparing all active characteristics of tool expression GUS, wherein the promoter activity of PIPA is the highest, not only have higher rice blast fungus and infect induced activity, and it is responsive especially to damage (cutter scuffing), and expression amount approximately is 3 times of CaMV35s promotor.What need to remark additionally is herein, the restriction that will be subject to processing intensity, scope and time length is handled in inoculation and damage, it is partial and expression certain hour, dynamically (Northern analysis of time according to this protease inhibitor gene transcribe rna, accompanying drawing 1) result can infer, rice blast fungus induces the expression amount of GUS after 36 hours will be higher than 12 hours expression far away.PIPA is infected by rice blast fungus and damages the characteristics that inducement efficient expresses to illustrate that it may be as the desirable promotor of pest-resistant evil and disease.PIPH, PIPX be because of having lacked the part fragment, and reduced expression activity, illustrates that the disappearance part may contain and the relevant controlling element of damage stimulation.
The quick binary vector structure of responding to destructive stimulus and efficiently expressing goal gene
Can on the basis of PIPA binary vector, carry out by following route.The PIPA plasmid was cut 6 hours with the BstEII enzyme, mend flat with T4 DNA polymerase then, be dissolved in after the imitative extracting of phenol and twoly steam in the sterilized waters gus gene that promptly removes the PIPA downstream after cutting with the NcoI enzyme, thus the binary vector (linear) that acquisition can chimeric disease-resistant related gene.Chimeric goal gene can be had NcoI site joint existing or that increased afterwards at 5 ' end, and its 3 ' end should be a smooth end.In addition, for can chimeric each genoid, can be flat with mending behind BstEII and the NeoI double digestion, be about to chimeric gene and should do not contain the ATG codon, and identify and be connected into direction (accompanying drawing 3).
Sequence table
＜110〉China Agricultural University
＜120〉a kind of plant gene promoter of responding to destructive stimulus fast and efficiently expressing
＜130〉PIPA promotor patent application
<160>2
<170>PatentIn?version?3.1
<210>1
<211>1520
<212>DNA
<213>Oryza?sativa
<400>SEQ?ID?NO：1
caatacgata?cgtcgacgat?ccagttctat?ccgagaagga?ctcttcccat?ctgtagattt 60
cgtgaaaggt?ttccttagga?tatgtagaaa?acatccgcgt?gcgcgtgggt?atgccatatc 120
gatatgtaac?gtatatcgaa?gggtagaggg?tatgcctgac?ccgtaaccct?gacacgaacg 180
cccaccccta?ttcctgcata?catccatgca?tatatatcag?catatcctct?tacttctaac 240
gtacgttgaa?ccatcctcct?ctcatgtctc?acgtaccgga?acacatatgc?ttgcacaggt 300
atgaacatat?gcttgcacag?tatgtgaaag?ggatacgtac?tttctttttt?ttctctctcc 360
ttccattaca?tgaaagattt?atacgtaacg?cgcgcgaaga?tggattctaa?tatctcgggt 420
agacgtctac?cagttttttg?catgttaact?aaataattat?tgaaaaattt?caaaaaaact 480
ttacaacata?gattaatatg?taatatatca?cttaacaaac?atgcaagttc?aaattcgact 540
tctacaagtt?ttaacaaaaa?taacaaatta?aagtctaact?agtatataca?tatattcaga 600
gtcaaatttg?ttatttttgt?tacaactagt?agaagtcgaa?tttgaacttg?catgtttgtg 660
aagtgatata?ctccctccat?ctacaaaagt?tacacatatt?actttttaca?tcaagaccaa 720
tgagaaatta?aatcaccttg?gatgttacaa?aatcaaagaa?tgaatgcaag?catgcaacta 780
atgagtatct?agatgactcc?ttgagttcta?ataaaacatt?tagtttgtct?cttcatttaa 840
gtcttaaata?cataaagatt?acaaatagga?acaggttatt?tggaaaaact?caaatgtgaa 900
attggtgtaa?cttttgtgga?tggagggagt?attacatatt?aacctatcat?gccaattttt 960
ttgaaaaatt?tttataatta?tttagataac?atgtaagaaa?catgtggacg?ttcacccgag 1020
tatttaaaac?agtttccgtg?tgcgcacaca?tataaataca?tgcaacacca?ccctcatagg 1080
taaggtaaga?atccgaccac?caaaaacatg?ttaaaaaaaa?acaaaaccaa?caacaaatct 1140
ttaatgtcac?taaaatcaaa?ctactcgagt?attattgaaa?acatactcga?gtacttgtgt 1200
atgtgtaaat?attcgagcgc?acctagtttt?aaaccacctt?gtaatttgtg?catagtcaca 1260
tttgtgtcaa?ttaaattcca?ctgtgagtat?gcatatggaa?gaaagcgtca?aattaattaa 1320
tcagcactga?tatagtagtg?gcaaagccag?gaagaaggga?atcagagtag?acagatgcgt 1380
ggcaaatggg?gcctccacgt?gctcttatcc?tcatgcaagt?cagcatttgt?gattgggtag 1440
tatgggttgc?tcgatctttc?tataaataat?aacgctactc?agtactcacc?catcacaagc 1500
acccacacca?accaaagatg 1520
<210>2
<211>1520
<212>DNA
<213>0rvza?sativa
<400>SEQ?ID?NO：2
atgagcaaca?ccaccatggc?tatttccacc?atccttctct?tcctcctcgc?cggcctcgtc 60
gccgcccacg?gcgacggcga?caccatgatc?cgtctcccaa?gcgacggcgc?cgaagcacca 120
ccacgcccgc?ccaaaccctg?ggactgctgc?gacaacatcg?agatgtcccc?gctcgagatc 180
ttcccgccgc?tgtaccgctg?caacgacgag?gtgaagcagt?gctccgccgc?ctgcaaggag 240
tgcgtggagg?cgcccggcga?cttcccccgc?ggcgccttcg?tgtgccgcga?ctggtactcg 300
acggtggacc?cgggccacat?gtgcacggcg?ccggatcagc?cgacgacgaa?gaggccgtgg 360
aagtgctgtg?acagcatcgt?gcagctgccg?cagaggatct?tcccgccgtt?ctggcgctgc 420
gacgacgagc?tggagcccgg?caagtgcacc?gccgcgtgca?agtcgtgcag?ggaggcgccg 480
gggccgttcc?cggggccgct?catctgcgag?gacgtctact?ggggcgccga?cccgggcccc 540
ttgtgcacgc?cgcggccatg?ggggaaatgc?tgcgacaagg?ccttctgcaa?caagatgaac 600
ccgccgacct?gccgctgcat?ggacgaggtg?aacaagtgcg?ccgacgcgtg?caaggattgc 660
cagcgcgtgg?agtcgtcgga?gccgcctcgc?tacgtctgca?aggaccgctt?caccggccat 720
cccggccccg?tgtgcaaacc?ccgagcggag?aactag 756
Claims (16)
1. derive from a plant and a therefrom isolating dna fragmentation, it belongs to a kind of upstream regulatory sequence of paddy rice Bowman-Birk protease inhibitor gene, promoter activity with abduction delivering behind the damaged sexual stimulus, its obvious characteristics is can respond to the destructive stimulus signal fast after utilizing the chimeric goal gene of this regulating and controlling sequence to import plant once more, and the efficiently expressing of driving purposes gene, this promoter sequence is the sequence of SEQ IDNO:1.
2. on the basis of SEQ ID NO:1, can obtain the variant of deriving of a series of tool promoter activities, it is characterized in that each variant of deriving can get up to be used for the startup of goal gene alone or in combination.
3. according to the dna sequence dna of claim 1 and 2, can process, transform them or the modification of base.
4. according to claim 1,2 and 3 dna sequence dna, it is characterized in that comprising all core sequences relevant with destructive stimulus, or the sequence change of the non-intrinsically safe of core sequence or combination.
5. according to the content of claim 4, destructive stimulus is meant that plant is subjected to extraneous stimulation, particularly the factor that the normal growth of plant is affected.
6. according to the content of claim 5, these stimulations can be that the food of getting of insect causes, and can be that pathogen infection causes, and also can be that adverse circumstance or other factors cause.
7. according to the dna sequence dna of claim 4, it is characterized in that this sequence and reporter gene import plant again after chimeric and have damaged, pathogenic bacteria, chemical substance inductive promoter activity.
8. according to the dna sequence dna of claim 7, it is characterized in that the promoter activity of PIPA is higher than PIPH and PIPX.
9. dna sequence dna according to Claim 8 is characterized in that comprising the important cis element relevant with destructive stimulus between-1500 to 1.
10. dna sequence dna according to Claim 8, PIPA can be directly used in the genetically engineered that chimeric goal gene carries out pest-resistant, disease-resistant even degeneration-resistant border.
11. dna sequence dna according to Claim 8, PIPA can be used for efficiently expressing of driving purposes gene, thus the research purpose expression of gene to the influence of plant, and this expression can be controlled with destructive stimulus.
12. according to claim 6,7,8,9,10,11 sequence, can make up the binary expression vector of damaging abduction delivering, it is characterized in that having the above-mentioned dna sequence dna driving purposes gene transcription and the expression of promoter activity.
13. according to the sequence of claim 12, the goal gene in the binary vector is to be used for pest-resistant goal gene.
14. according to the sequence of claim 12, the goal gene in the binary vector is to be used for disease-resistant goal gene.
15. with the Agrobacterium that contains the described binary expression vector of claim 12 can mediated plant conversion.
16. according to claim 13,14,15, a kind of genetically modified plant or cell of containing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031310516A CN1206354C (en) | 2003-05-16 | 2003-05-16 | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031310516A CN1206354C (en) | 2003-05-16 | 2003-05-16 | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1513990A true CN1513990A (en) | 2004-07-21 |
| CN1206354C CN1206354C (en) | 2005-06-15 |
Family
ID=34239782
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031310516A Expired - Fee Related CN1206354C (en) | 2003-05-16 | 2003-05-16 | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1206354C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517333A (en) * | 2018-04-16 | 2018-09-11 | 中国农业科学院植物保护研究所 | Application of the rice Os BBTI4 protein gene on improving rice anti-rice blast |
| CN116606855A (en) * | 2023-07-14 | 2023-08-18 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsRBBI3 and application thereof |
-
2003
- 2003-05-16 CN CNB031310516A patent/CN1206354C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517333A (en) * | 2018-04-16 | 2018-09-11 | 中国农业科学院植物保护研究所 | Application of the rice Os BBTI4 protein gene on improving rice anti-rice blast |
| CN108517333B (en) * | 2018-04-16 | 2020-06-02 | 中国农业科学院植物保护研究所 | Application of rice OsBBTI4 protein gene in improving rice blast resistance |
| CN116606855A (en) * | 2023-07-14 | 2023-08-18 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsRBBI3 and application thereof |
| CN116606855B (en) * | 2023-07-14 | 2023-09-12 | 隆平生物技术(海南)有限公司 | Rice green tissue specific promoter pOsRBBI3 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1206354C (en) | 2005-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102220277B (en) | Method for building high-efficiency regenerating and transforming system of Oryza sativaL. subsp. japonica 11 | |
| CN110734482B (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN104988140B (en) | A kind of promoter and its application from paddy rice | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN105838723B (en) | A kind of alfalfa Cold resistant genes MsZFP and its coding albumen and application | |
| CN107142271A (en) | The PL LbCpf1 RR genes with high mutation efficiency and its application in gene targeting | |
| CN108558992B (en) | Transcription factor PDD1 for regulating and controlling growth of needle mushroom fruiting body and coding gene and application thereof | |
| CN1375005A (en) | Gene regulating plant branching, vector containing the gene, microorganism transformed by the vector, and method for regulating plant branching by using the microorganism | |
| CN116064586B (en) | Papaya CpWRKY50 gene and application thereof in improving papaya anthracnose resistance | |
| CN1206354C (en) | Plant gene promotor for quickly inducing defect stimulation and high efficienly expression | |
| CN1296383C (en) | Plant DREB transcription factor and its coding gene and uses | |
| CN1888071A (en) | Chuancao-II Laomangmai wheat pest-resisting gene genetically modifying technology | |
| CN107058324B (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivation method | |
| CN110195065A (en) | A kind of PuPLA2 gene of anti-zinc components, PuPLA2 albumen, recombinant expression carrier and its application | |
| CN102286527A (en) | Genetic transformation method for DREB (Dehydration Responsive Element Binding) gene transformation Anthurium | |
| CN1429904A (en) | Method for gene conversion of corn | |
| CN105112423B (en) | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application | |
| CN103789312A (en) | Corn endosperm tissue specificity promoter and application thereof | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN102703450B (en) | Corn WUS1 gene promoter and application thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN100336904C (en) | Pathogen from rice, chemically inducible promoter and their use | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN107267508A (en) | A kind of plant jasmonate acid methyl esters induced expression promoter PosMeJ1 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |