CN1417338A - High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process - Google Patents
High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process Download PDFInfo
- Publication number
- CN1417338A CN1417338A CN 01132117 CN01132117A CN1417338A CN 1417338 A CN1417338 A CN 1417338A CN 01132117 CN01132117 CN 01132117 CN 01132117 A CN01132117 A CN 01132117A CN 1417338 A CN1417338 A CN 1417338A
- Authority
- CN
- China
- Prior art keywords
- high temperature
- dna polymerase
- polypeptide
- resisting
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates a technology to code separate DNA separating with activity and functional isomutant and to recombine DNA as well as the production of polypeptide with high temperature resistant DNA polymerase activity or its functional isomutant by the said separate DNA. Based on the sequencing and analysis of Tengchong thermophilic anaerobe whole genome, high temperature resistant DNA polymerase gene is cloned and separated. The gene is useful in preparing corresponding transgenic microbe, plant and animal and recovering the gene encoded enzyme. In addition, the present invention also provides the amino acid sequence of the polypeptide with high temperature resistant DNA polymerase activity and its functional identity. The present invention also provides the method of preparing, separating and purifying the polypeptide with high temperature resistant DNA polymerase activity.
Description
Technical field
The present invention relates to the microorganism hereditary field, be specifically related to belong to a kind of isolating high temperature-resisting DNA polymerase gene sequence and the encoded polypeptides and the preparation method of thermophilc anaerobe.High temperature-resisting DNA polymerase can be widely used in technical fields such as gene clone, gene diagnosis and gene therapy.
Background technology
Archaeal dna polymerase is to repair and the relevant enzyme family of reproduction process with DNA, archaeal dna polymerase separates from intestinal bacteria (as e. coli dna polymerase I and Klenow fragment), T4DNA polysaccharase and some high temperature-resisting DNA polymerases are separated recently, as archaeal dna polymerase (U.S. Patent number 4 from T.aquaticus, 889,818), and from the archaeal dna polymerase of T.litoralis, high temperature-resisting DNA polymerase is proposed and is used for increasing existing nucleotide sequence, and its quantity is more than original.Polymerase chain reaction (PCR) and strand displacement amplification (SDA) are two kinds of methods of amplification of nucleotide acid sequence.PCR is based on two chains that oligonucleotide primer hybridizes to the specific target dna molecular, and primer extension produces two new dna double chains under the archaeal dna polymerase effect subsequently, and its every chain can both be as lower whorl hybridization and the template of extending.SDA difference PCR is its constant-temperature amplification process, and promptly all are reflected under the same temperature and carry out, and need not elevated temperature and come the dissolving DNA two strands.Archaeal dna polymerase such as Sequenase, the Klenow enzyme, Taq enzyme etc. has been widely used in dna sequencing (U.S. Patent number 5,173,411).At present, high temperature-resisting DNA polymerase has been widely used in the gene clone technology field, mainly is the Taq DNA polymerase from the T.aquaticus thermophile bacteria, yet this enzyme easily produces certain error when work.
Tengchong thermophilc anaerobe (Thermoanaerobacter tangcongensis) is a kind of microorganism that lives in the hot spring of Yunnan Province of China province Tengchong County, it is a kind of thermophilic eubacterium (eubacteria), optimum growth temperature is 75 degrees centigrade, anaerobic growth, the gramstaining reaction is positive.It is at first found by Microbe Inst., Chinese Academy of Sciences and has carried out the analysis on the taxonomy.Bacterial classification is kept at Chinese microorganism and preserves center MB4
T(Chinese collection ofmicroorganisms AS 1.2430
T=JCM 11007
T).This thermophilc anaerobe is the distinctive species of China, and the high temperature-resisting DNA polymerase that is had in its body also has own its specific structure.
Summary of the invention
The technical problem to be solved in the present invention is: provide a kind of very practical, well behaved high temperature-resisting DNA polymerase gene sequence and encoded polypeptides and preparation method.The present invention utilizes predictive genes software to obtain one section sequence that contains 10,020 base pairs by to Tengchong thermophilc anaerobe genome sequencing, with this gene of pcr amplification, is cloned into then among the expression vector pBV220, and obtains high expression level in intestinal bacteria.Studies show that by base deletion and mutation research and protein function this gene is the gene order of a coding high temperature-resisting DNA polymerase, simultaneously, this high temperature-resisting DNA polymerase is with the activity of ThermoScript II.The high temperature-resisting DNA polymerase of transgenic microorganism or animals and plants this gene is used to produce to(for) preparation, and it is useful to reclaim the enzyme that obtains this genes encoding.
In addition, the present invention also provides and has had active amino acid sequence of polypeptide of high temperature-resisting DNA polymerase and functional equivalent body.Simultaneously, the present invention also provides preparation, separates, and purifying has the method for the active polypeptide of high temperature-resisting DNA polymerase.
The technical solution adopted in the present invention is: the present invention relates to a kind of separated DNA, it can be encoded and have the nucleotide sequence of the active polypeptide of high temperature-resisting DNA polymerase.
Above-mentioned separated DNA, it also has the nucleotide sequence of the modified forms of the polypeptide of the aminoacid sequence among the coding SEQ ID NO:2 or described polypeptide, on this modified forms function quite or relevant with high temperature-resisting DNA polymerase.
Above-mentioned separated DNA, it also has the polynucleotide sequence of SEQ ID NO:1 and its mutant form, and mutation type comprises disappearance, nonsense, insertion, missense.
The invention still further relates to a kind of polypeptide separated, it has the high temperature-resisting DNA polymerase activity.
Above-mentioned polypeptide separated, it has the polypeptide of the aminoacid sequence among the SEQ ID NO:2, or its conservative property variation polypeptide or its active fragments or its reactive derivative.
The invention still further relates to a kind of carrier, it contains the separated DNA of the nucleotide sequence with the active polypeptide of high temperature-resisting DNA polymerase of encoding.
The invention still further relates to the above-mentioned carrier transformed host cells of a kind of usefulness, comprise prokaryotic cell prokaryocyte or eukaryotic cell.
The invention still further relates to a kind of method of producing high temperature-resisting DNA polymerase, comprising:
1) isolates nucleotide sequence SEQ.ID NO.1 with coding high temperature-resisting DNA polymerase polypeptide;
2) make up the expression vector that contains SEQ.ID NO.1 nucleotide sequence;
3) with step 2) in expression vector change host cell over to, formation can be produced the reconstitution cell of high temperature-resisting DNA polymerase polypeptide;
4) culturing step 3) in reconstitution cell;
5) separation, purifying obtain the active polypeptide of high temperature-resisting DNA polymerase.
The invention has the beneficial effects as follows: the high temperature-resisting DNA polymerase of transgenic microorganism or animals and plants the present invention is used to produce to(for) preparation, and it is useful to reclaim the enzyme that obtains this genes encoding.
In the present invention, " isolating " DNA is meant that this DNA or segment have been arranged in its both sides under native state sequence separates, refer to that also this DNA or segment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, " high temperature-resisting DNA polymerase gene " refers to encode and has the nucleotide sequence of the active polypeptide of high temperature-resisting DNA polymerase, as nucleotide sequence and the degenerate sequence thereof of SEQ ID NO.1.This degenerate sequence be meant have one or more codons to be encoded in this sequence the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of known codon, so be low to moderate about 70% the degenerate sequence described aminoacid sequence of SEQ ID NO.2 of also encoding out with SEQ ID NO.1 nucleotide sequence homology.This term also comprises can be under the rigorous condition of moderate, more preferably under highly rigorous condition with the nucleotide sequence of the nucleotide sequence hybridization of SEQ ID NO.1.This term also comprises and SEQ ID NO.1 nucleotide sequence homology 70% at least, preferably at least 80%, more preferably at least 90%, and at least 95% nucleotide sequence best.
In the present invention, " isolating " proteic polypeptide is meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as uses column chromatography, and PAGE or HPLC method are measured the purity of polypeptide.Isolated polypeptide is substantially free of the component of following it under the native state.
In the present invention, " high temperature-resisting DNA polymerase albumen " refers to have the active SEQ IDNO.2 of high temperature-resisting DNA polymerase polypeptide of sequence.This term also comprises the varient of SEQ ID NO.2 sequence, and these varients have and natural high temperature-resisting DNA polymerase identical functions.These varients include, but is not limited to several amino acid whose disappearances, insert and/or replace, and add one or several amino acid at C latter end and/or N-terminal, also can be the difference that does not influence on the modified forms of sequence.For example, for known in the field, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C latter end and/or N-terminal and also can not change proteinic function usually.This term also comprises the active part and the reactive derivative of high temperature-resisting DNA polymerase.
In the present invention, can select various carrier known in the art for use, as commercially available various plasmids, clay, phage and retrovirus etc.When producing high temperature-resisting DNA polymerase of the present invention, high temperature-resisting DNA polymerase gene sequence operationally can be connected in expression regulation sequence, thereby form the high temperature-resisting DNA polymerase expression vector.Expression vector contains replication origin and expression regulation sequence, promotor, enhanser and necessary machining information site.Expression vector also must contain alternative marker gene, as a) providing to microbiotic or other toxicant (penbritins, the protein or the b of resistance kantlex, methotrexate etc.)) complementary auxotroph protein or c) protein of the essential nutritive ingredient that does not have in the complex medium is provided.Various different hosts' appropriate flags gene be well known in the art or production firm's specification sheets famous.These expression vectors can be with well known to a person skilled in the art recombinant DNA technology preparation, as can be with reference to people such as Sambrook, and 1989 or people such as Ausubel, 1992.
Recombinant expression vector can be introduced host cell with method well known in the art, and these methods comprise: electrotransformation, Calcium Chloride Method, particle bombardment etc.The process that the external source recombinant vectors is imported host cell is called " conversion ".By cultivating host cell, induce the expression of desirable proteins, and by protein separation technology known in the art, obtain required protein as column chromatography etc.Also can adopt these protein of synthetic such as solid phase technique.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic cell prokaryocyte such as intestinal bacteria commonly used, Bacillus subtilus etc.Eukaryotic cell such as yeast cell commonly used, or various animal and plant cells.
High temperature-resisting DNA polymerase full length gene sequence of the present invention or its segment can be used the pcr amplification method usually, recombination method, or the method for synthetic obtains.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence design primer, is template with the thermophilc anaerobe complete genome DNA of ordinary method preparation well known by persons skilled in the art, increases and obtains relevant sequence.In case obtained relevant sequence, just it can be cloned into relevant carrier, change host cell again over to, from the host cell after the propagation, separate obtaining large batch of relevant sequence then by ordinary method.
Description of drawings
Fig. 1 is an embodiment of the invention order-checking library construction block diagram.
Fig. 2 is embodiment of the invention order-checking and data analysis schema.
Embodiment
To be described in detail the present invention by embodiment below:
1) makes up the order-checking library
The structure in order-checking library adopts full genome shotgun approach (shotgun) to carry out.At first cultivate the Tengchong thermophilc anaerobe, cultural method is pressed Marmur (1961) method and is collected bacterium by (Yanfen Xue, 2000) improved MB substratum (Balch et al., 1979), extracts total DNA.For the randomness of the library construction that guarantees to check order, farthest avoid producing the problem of breakage hot spot, that adopts several different methods, different condition builds the storehouse principle.Adopt earlier physics cutting method (comprise supersonic method and shear with Hydroshear Machine), next is selected for use AluI to carry out the random partial enzyme according to this bacterium genome signature and cuts.Adopt varying strength to handle sample when physics is sheared, handle sample by enzyme amount gradient is set when enzyme is cut.Sample after the processing adopts electrophoresis fraction collection 1.5-4kb dna fragmentation after flat terminal the processing, be connected with the dephosphorylized pUC18 that cuts through the SmaI enzyme, connects product has made up random sequencing by electric Transformed E .coli DH5 α library.Simultaneously, (cut genomic dna in the order-checking library that has also made up long insertion fragment (about 10kb) for the ease of the later overlap joint of lengthy motion picture disconnected (contig) with Sau3AI random partial enzyme, electrophoresis is collected the fragment about 10kb, is connected, makes up the library with the dephosphorylized pUC18 that cuts through the BamHI enzyme).The order-checking of these two ends in library can obtain the relation between the contig in the process of finishing figure (finishing), and can solve the difficulty that bigger gap causes filling-up hole.Build the storehouse flow process as shown in Figure 1.
2) gene order-checking
When finishing the genomic order-checking of Tengchong thermophilc anaerobe, two kinds of full-automatic sequenator: ABI377 and MegaBACE 1000 have mainly been used.These two kinds of sequenators all are to utilize principle of electrophoresis to check order, and can finish 96 samples at every turn.ABI377 is the product of PE company, is a kind of of ABI series.It belongs to the plate gel electrophoresis sequenator.MegaBACE 1000 is products of Pharmacia Corp, belongs to the capillary gel electrophoresis sequenator.
3) Basecalling and sequencing quality monitoring
So-called Basecalling is meant the process that obtains correct base sequence from the raw data file that sequenator obtains.Because that obtain on the sequenator is A, T, G, the light intensity variation track (trace) of the different wave length that four kinds of base pairs of C are answered need take certain algorithm therefrom correctly to identify the base of different track correspondences with computer.What we used here is Phred software (Ewing B, Hillier L, 1998), and reason is that its result is more reliable, and other programs that its result exports in the same software package of being more convenient for are further analyzed.
Phred carries out the algorithm principle of Basecalling, is the shape according to each peak in the track, and spacing, and factor such as signal to noise ratio are judged the base type, simultaneously this base are provided reliability information, i.e. the sequencing quality of base.In large scale sequencing, the monitoring of sequencing quality is crucial, and it directly influences the decision-making to order-checking, comprises the structure in library, the size of fraction of coverage.Can in time feed back the error that may occur in the order-checking experiment simultaneously.
4) sequence assembly
So-called sequence assembly is exactly full genome shotgun approach, and the sample sequence that claims the shotgun random sequencing to obtain again is assembled into successive lengthy motion picture disconnected (contig), mainly utilizes the overlap between them for referencial use.Consider the influence that has carrier in the order-checking, need earlier sample sequence to be unloaded body and handle.Here used software cross_match and the back used software Phrap of splicing are the software (Gordon D, Abajian c, 1998) of U.S. Washington university, and its ultimate principle is Swith-Waterman algorithm (Waterman MS, 1990).This is a kind of dynamic algorithm, after having considered the comparison between the sequence in twos, can obtain the publicly-owned sequence (consensus sequence) of one group of sequence.Sample sequence behind the removal carrier splices with Phrap again.In when splicing, the sequencing quality of base also has been considered, and the confidence level of resulting publicly-owned each base of sequence is calculated by the sequencing quality of the sample of forming this publicly-owned sequence.
5) gene annotation
After obtaining genomic most of sequence (frame diagram of finishing the work) substantially, just need carry out note to genome, comprise out frame frame (Open Reading Frame, prediction ORF), the prediction of gene function, and the pulsating analysis of special RNA etc.
The first step adopts the GLIMMER2.0 (Delcher of default parameter, A.L., Harmon, D.1999) and ORPHEUS (Frishman, D.1998) software prediction gene coded sequence, open frame and the non-coding region (intergenicregion) of all predictions all use BLAST software (Altschul, S.F.et al.1997) and the irredundant albumen database (non-redundant protein database) of NCBI relatively to find the gene that may miss then.When judging the starting point of a gene, will be with reference to various relevant informations, as sequence homology, ribosome bind site, possible signal peptide sequence and promoter sequence etc.If open in the frame when a plurality of promotor occurring at one, generally adopt the starting point of first promotor as gene.(Ermolaeva M.D.2000) predicts the transcription terminator that does not rely on Rho (ρ) factor at non-coding region to adopt TransTerm software.If this terminator be positioned at a gene the catchment too at a distance, then may hint a minigene lose or the mistake that checks order has shortened this gene artificially, can be used as the reference of further analysis.When determining to move frame sudden change and point mutation, main basis is judged with the proteinic similarity in the database.If protein is corresponding to the situation of two encoding sequences adjacent one another are, then be considered to a non-activity gene (pseudogene pseudogenes), produce the abort phenomenon because this illustrates between these two encoding sequences owing to suddenling change, and then gene is lost activity.All analytical resultss use Artemis sequence viewer software (Rutherford, K.et al.2000) to carry out manual analysis again.Some are obviously shown eclipsed with other code sequence and open frame, and length does not have homology and wherein do not have tangible promotor or termination is regional opens frame and will be removed less than 150 base pairs and in the data with existing storehouse.
Proteinic functional fragment (motif) and functional area (domain) employing and Pfam, PRINTS, PROSITE, ProDom and SMART database respectively compare, the result uses InterPro database (Apweiler, R.et al.2001) to carry out Macro or mass analysis again.According to the COGs database (Tatusov, R.L.et al.2001) of NCBI and with reference to other result of querying database determine protein in the COGs classification functional classification and possible pathways metabolism.Confirm membranin, abc transport albumen and stride the film functional domain with TMHMM software (Krogh, A.et al.2001).The employing Gram-negative bacteria is a parameter, with SIGNALP2.0 software (Nielsen, H.et al.1999) analytical signal peptide zone.
6. the preparation of high temperature-resisting DNA polymerase and purification
According to the high temperature-resisting DNA polymerase complete encoding sequence that arrives (SEQ IDNO.1) of gene annotation among the embodiment, design can amplify the primer that complete coding is read frame, and introduces restriction endonuclease sites respectively on positive anti-primer, so that construction of expression vector.According to the predictive genes result,,, increased Xbal I site at upstream primer for ease of the clone at this upstream region of gene and downstream design primer.
For obtaining to have the gene mutation body of part base deletion, design primer again in the both sides of required disappearance part.All primers are responsible for synthetic by Beijing AudioCodes biotech firm.
With the 1st) plasmid DNA in the order-checking library that obtains in the part is template, behind pcr amplification, guarantee to read recombinate under the correct prerequisite of frame to the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Again recombinant vectors is transformed into that (method for transformation is CaCL in the bacillus coli DH 5 alpha
2Method or electrotransformation).Screening and Identification to the engineering bacteria DH5 α-pGEX-2T-Dna that contains expression vector.
The engineering bacteria DH5 α-pGEX-2T-Dna of picking list bacterium colony contains in the LB substratum of 100 μ g/ml penbritins jolting in 3ml and cultivates 37 ℃ and spend the night, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD
600After reaching 0.5, add IPTG, continue at 37 ℃ and cultivated respectively 0,1,2,3 hours to final concentration 1mmol/L.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing desirable proteins.
As stated above behind the engineering bacteria of abduction delivering desirable proteins, with bacterium centrifugation, add 50% saturated Triptide Sepharose 4B of 20mlPBS by every 400ml bacterium, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the Triptide Sepharose 4B that combines desirable proteins in centrifugal 10 minutes, abandoned supernatant.Add 100 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, and supernatant is the albumen of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.? the protein band at Kda place is high temperature-resisting DNA polymerase.
Fidelity to high temperature-resisting DNA polymerase is identified:
10 pairs of PCR primers of step 1 design, with Tengchong thermophilc anaerobe thermostability DNA polymerase 10 target DNA fragments of known array are carried out pcr amplification, the amplification cycles condition is as follows: 95 degree sex change 5 minutes, and------72 degree extend 3 minutes (35 circulations)--72 degree extended 10 minutes--, and-4 degree finish 52 degree renaturation 30 seconds in 95 degree sex change 30 seconds
Step 2 PCR product purification and order-checking: PCR product purification QIANQEN company purification kit, sequencing primer PCR primer, two-way order-checking is carried out on the ABI-377 of PE company sequenator.
The analysis of step 3 sequence results: 10 target DNA series of sequencing result and known array are compared, and the result fits like a glove.
Sum up
The present invention has introduced a kind of high temperature-resisting DNA polymerase or fragment and gene thereof of purifying.It has the activity of Tengchong thermophilc anaerobe (T.tengcongensis) high temperature-resisting DNA polymerase.The molecular weight of pure enzyme under SDS-PAGE is about 90 among the present invention, and 000D has 5 '--and 3 ' 5 prime excision enzyme activity, DNA synthetic optimum temperuture is 75 degree under the experiment condition, Mg
2+, Mn
2+Concentration be respectively 1mM and 0.5mM.This enzyme is applicable to that strand displacement synthetic DNA, dna sequencing reaction and DNA reverse transcription are synthetic.The various sudden changes (as disappearance or replacement) that have identical dna replication dna efficient with Tengchong thermophilc anaerobe high temperature-resisting DNA polymerase also are included in the current invention.
Sequence table
1.SEQ?ID?NO.1
(1) sequence signature:
A. length: 10020 base pairs
B. type: DNA/RNA
C. chain: two strands
D. geometry: linearity
(2) molecule type: Nucleotide
( 3 ) SEQUENCE DESCRIPTION:
atgaaatttgtgtgtgataaaaattcattgttggaaggcgtcaatatagccataaggggg
gtatcctcccgtaccacccttcccatattgcaaggaataaaaataacagcaagaggcaat
gtcataaagctttcaggtactgacctcgagatagggatagagtgtcaaatacccgcagtt
attgaagaagagggggagacagttgttccagcaaggatttttagtgacctcgtaaaaaaa
ttgcctgaaggagaagtggaagtaaaaagcgattcacagaatactgtaaatgtggtttca
ggagacataaacttctcaattgcaggaagcaatccagaagaatttcctgaaatacctgaa
gtatcaagagaaaagtcatttaaacttccccaatcaatcctcaaagacttgataaaaaag
acagttttttgcgtctcagaagagcagactaggccaattctaacaggggtactttttgaa
gtatttccaaatgagcttaaagcagtggcattggacggatttagaatggccatatactct
tataagtcggaaaagtccttttttgacgaagaagcggagaagtactctcttgtcattccg
ggagataccatcgatgaaatttcaaggatattggaagatgaagagacagaggtaataata
taccacacttccaaccaggtgcttttccagattgataacactaaagtcatctcaaggctt
cttgaagggagttttataaactacaacgctgtgctccctaaagattttaagacagagatc
actataaataaagatgtgtttatggaaagccttgaaagggcatctctaattgctgagagc
aagaacaatttagtaaaatttgaaataggagatagctttattgtgatttcttcaagttcg
gaaaaaggaagtatgtcagaaaagttggaagtggaagttaaaggaatgcttctagagatt
gcttttaactctagatatttacttgatgcgctcaaggcaattaatgaagaagaagtaaat
ctttacttcataaacagcataaatccgctaataataaaaccagtgggggaaaaggaatac
ctctacatgatactgccggtgaagcttaactaaatgtatcagtctttgtacaggaaatacaggccaaaaagttt
cagtgaagttgtggggcaggaccacattgtgaggactctgaggaatcaaataaaaatgggaaggataggg
catgcatatctttttacaggcacaagggggacagggaaaactagtgtagcaaaaatttttgcaaaggcggta
aactgtttaaatccaaaagacggtgagccctgcaattcctgtgaggtgtgtcaggcgataaacactggtact
actatggatgtcttggaaatagatgctgcatctaataacagcgtgaatgacgtgagagaacttagagagtctg
taatctactctccttctctgacaaagtacaaagtatatataatagatgaagtgcatatgctttctacaggagctttt
aacgcccttttaaaaacacttgaagagccccctcgccatgtgattttcattcttgctaccactgaacctgagaa
actgcctgacactatcctctcgcgttgccagaggttcgattttaaaaagataccgacaaagcagattgcaca
gaatctagaaaggatttgccaagatagcggtatacagattgaacaaaacgggataagagctatcgctctttat
ggaaatggttcaatgagagatgcgataagtcttttagagcaatgcgcttcttacaaggaaggattaataacct
atgaagatgtttgtgaaatattgggagttgcgaatgaagaaatgcttttttcacttttagatcatatttacgagaa
ggatgcggtagcttctttacagcaactggataaaatattgtcctatggaatagatttaggaaattttctaaggtc
ctttacttatatgctaagagatatggttatatacaaaactgggggagatgagctaatagagattttgtacggag
atcaagagaccataaaagcaaagtcgcagaaatacagcataggatttttgacaaatgctttggagaagttta
ctgctttgcagagagagataagatatgctgtttcacctgttacattgcttgaattgacgattttaagacttattag
gccggaaatttcttacgatatgggaagcttgatagctagaatagaagagctagaggaaaaaataaataaag
ggtatgtggtaacaaaagaagagagtgcgaaaacacatgaaaaagatgagctagaaaaaaaggttgatgc
tacaaaagaggcaaaaaaagaaagggaggaaattgatttaggaagagtttggcttgaagtaaagggaattc
tcaaaaaggaaaggatgatgctctatactttcctagagaagggtgttccccatttaaaggatggcaaaattgtt
gtggagtattccgaagaagacgctcttttggtggaacagcttggtaggccagagaataaagactttattgaa
ggagtagtagaaaaagtagtgaagaaaagaattccaatagagtttgctctaaaaaaaagcgaagaggacct
tttaattaagcaggtaaaggaattttttggggatggaattgacatagaaataatatag
atgaactatagggaatttgtagaaagcataaaaaagggacagatagctcctttatacctt
ttttacggagaagagagatttttgcttttagatgctgttaagaggttgaaggcaaggctc
ttggtgccagagtttgaggatatgaattacattgtaattgagagggaaaatccggaggaa
tacgtagaagccatcattgagaattgcgagactctcccttttttttcaaattataaaatt
gtagtggtgaaaaatgaagaagaacagctttccaagataggtgataaagagttaaaaagg
cttactgattattttaaaaacagggtgctaggaaatactagtcttgttgttgtagttgta
agtggtgaaaaaatagattcgagaaaaaaattgtacaagtttatggaaaaagaagctgct
gtggtggagtttaaaaagctcactccggaagaggcagttaattatgccggctatttctta
aaaaaacacggtaaaaaggctgcaaaaaaggatgtagaatctcttgtgaaaaacatagga
actgacctttactcaattgtgaacgagctggagaaagtgatagcctattcagaaggggaa
acgcttgatttggaggaagcaagagaggtgctttcagttactctccagcagaacgtgttt
caccttgtgaatgcaatagggatgaaaaaagagaaagaggcttatagagctctttatgcg
cttctttcaaaaggggaagtgccgcttataatcttaacgatgattgcaaggcagataagg
cttattgcaaagttgaaatctctagaaggaaaggctttcgataaaaagtctatagccagt
tacttaggcattcctttctttgctgtagatgatatcgtaaggcagagcaagctttttaca
agagaagatttgtataaggcgtacaaagagtgtttgaggtgcgacatagcattaaaaagc
ggaacagagccttcatttgcgctggaaaatctcataaaaaaattatgcaagcaataaatg
gttccagcgactttcttggaaaacatgcaaataaaaaaagtaagagttgaaaaaaagagc
cgaaaactcactgtggttgtctcctctttctcatcaaatgcacaaaagctctcagaattt
cagtcttttttggaggaaagctttccttctctaaaggagataaagattgtggtggaa
agcccttctttatcaacagtagaagaggttttggaaaactgggagaaagtagtattagag
cttagcgaagagtacccttcttccttaagttttttaaagacctgtgatgtcgcaaaagag
ggacagaataggataactgtaaaggctccaacttacgcaatttacgaaatggctaaaagc
agcaaattagattttgcaataagagaatttttaaggaacaggtatgaacttaatttagat
gtagaacttattttttcagaagaaggggaagaaattgcagaaaaaataatcgaagaagac
ataaaagcaattgaggaagttatccaaaaagatgagaagtctaaaaaggagaagagtagg
tctgaagaaaatagagttctccttggcaaagaaatgaaagctaaacctatctctattaag
gatgtaagtgcagaaaccgatgaggtagtgattgaaggagaaatattttctattgatttt
aaagagttgaagtcaaaagttctcatggtgtttgacattacagattatactagttcaata
cttgtcaaaacctttttgacagaagaaaaatatgaaattttgaaagatgaaatagatgta
ggaacttttgtcaggttaagaggaaatgtgatatacgataagtacgaaggagaccttgta
attgatttgaaagacttagagctcattcctccaaaaaagagaatggatttgtccgaagaa
aagagagtggagcttcaccttcacacccagatgagcactttagatgccgtcccttctgct
actgaagtgataaagagagcggcagaatggggacacaaggctgttgcaataacagaccac
gcagtggttcaagcttttccagaggcaatggaagcatctcgagagtatggggttaaggtt
atatacggaatggaagggtatatggtggatgacggaataccaattgtcactggagaatcc
gaagctagtttggaaggcgaatttgtggtatttgatatcgaaaccacaggcctttcaaac
ataaatgacgagataatagagattggtgctgtcaagatcaaaaacaagaaaatagtagat
acttttgaaacttttgtaaatcctcaaatacccatttcttctttcatcacaaaactcaca
ggaatcgatgaatcaatggttaaagatgctcctttaatagaagaggtgttgcctaaattt
ttggaatttgcaaaaggagcagttctggtagcacacaatgccaattttgatgtgtccttt
attaaatcaaaggctaagaaactaggtttgactgttgaaaacactgtcttagatacgctt
gagttgagcaggcatctgtaccaagatcttaaaaattacaaactcgacactcttgctgaa
ttttttgaagtaaagcttttgcatcaccacagggccgtggaagacgcgaaggctacagca
gaaattttcattaagatgctagaaaagctgcaagaaataggcataaagagtgtaagcgaa
atcaactcggttttgatggaaagggaagtggacgtaaaaaaattgcctgtataccatgtg
acaattttggtaaaggaccagaagggtttaaggaatttatacgagataatatctaggtca
aacctggagtttttccaccgcacccccagaataccaaagagtctgttggtgaaaatgaga
gaagggctgatcatagggtctgcctgtgagcagggagaagtgttcagagccttggtttct
aacttggaggaaaagaagctcgaagatataatcaacttttacgactatttggaaattcag
cctgtggggaacaacgaatttttgattgaaagaggagaggtaagaagcgtagaagaactt
aaagaaataaacagaaagatatacgaacttgggaaaaagtacaacaagctggtagtagca
acaggagatgtgcattttttagacccgtgggacgatgtgtacagaaaaatattaatggcg
ggcaaagggtataaggatgcggacagacagcctcctctttactttaggacaactgaagaa
atgcttatggagtttgaatatctaggagaagaagctgccagagaggtagtcattgaaaat
ccaaataaaattgcggaaattgtggaagatgtaaagcctattcctgagggaacttttccg
cctgtcatcgaaggggcagaagaagaattaagaaggattacccttgaaaaagctcatgag
atatacggtgacccattgcctccaattgtgcaggaaaggcttgacagagagctaaacgcc
ataataaacaacggttacgctgtaatgtacgtaatagctcagaagctagtatcaaagtcg
ctgcaggatggatatttggttggttcaagaggctctgtagggtcttctctggtagctact
atgagcggcattacagaggtaaatccgctgcctcctcattacgtgtgtccaaaatgcaaa
cactcagagtttgtgacggacgggtcttttggctgcggagttgacatgcctgacaagtac
tgccctaactgcggcactttgatgaaaaaagacggctttgacataccttttgaagtgttt
atgggctttgaaggagataaggagccggatatagacctaaacttttctggagaatatcag
cccatagctcacaggtacactgaagaactttttggaaaaggccatgttttcagggcaggt
actattggaacgctggcggataagactgcttacggatatgtgaaaaaatactttgaagag
aggaatttaactgtacacaagtcagaaataaaaaggctgacaatgggatgtacaggcata
aagagaaccacaggacagcatcccggaggagtcatggtggttccaaaggacaaaagcatt
tacgactttactccaattcaaaggcctgcagatgcggaagataccgatgtcataactacc
cattttgattaccattctttgagtggaaagcttctaaaattggacatactggggcatgat
gaccctactgtaataaggatgctggaggatttgacaggtgtaaatgccagaaaaatacct
ctggacgacaaaaagaccatgagcctttttacaagcgtagaagctttgggaatagaccct
gaggaacttggcactcccgttggaacgctagggcttcctgagtttggaacaaagtttgtg
agacagatgctaattgagacccgtcccacaacttttgatgagcttgtcaggataagtggg
ctttctcatggaacagatgtatggttaaataatgcgcaggatataataagagaagggatc
gctactttaaaggaagtaattgctgcaagagacgacataatgctttacttaataagcaaa
ggaatggataaaaagctttcctttaagataatggaaaatgttagaaaaggaaaaggcgtt
acacaggaagaaattgaagagatgaaaaaacacggcgtgcccgactggtttatacagtcc
tgccagaagataaaatacatgttcccaaaagctcacgctgtagcctatgtgatcatggca
tttagaattgcgtattttaaggtgtattatcctgaagctttctatgctacctattttact
gtgagagcagatgactttaacttagacatagttttagggggcaaagagagcataaaaagg
gcaataaaagaaattgaagcgaagggcaacaacgctacaccaaaagagaaaaacttgttg
acagtattagaggtagcacttgagatgtacttaaggggcatcaaattcacaaatgtggac
ctatacaggtccgatgccgagaagtttttaattacagaagaaggacttttgcctccacta
aattctcttgaaggagtgggaatacaggccgcaaaggcaattgcccaggagagagaaaat
ggcaaatttatatccattgaagatttcaggaaccgaaccagggtaagtaaaactgttatt
gaaatattaaaacagtatggatgtttagaagatttgccagaatctaatcaattaagttta
ttttga
gtgagagctatgtttgtacatcttcacgtgcatacggaatatagcttgttggatgggtcc
tgcaggataaaggatttgattgcaaaaactaaagagttgggaatgaaagcaatagctatt
acggaccacggggcaatgtatggagtaatagatttttataaggaagctgtagcccaaggg
ataaagcctatcataggatgtgagatatacgtagcaccgaggagaatgcaggatagagaa
tatggaattgacgatgaaaattatcatttggtgttactggcaaaggatatgacagggtat
aaaaatttgatgaaaatagtgactgctgcatctttagaaggattttactataagccccgt
gtggacaaagaatttctgaaaaatcacagtgaaggattaattgctttaagcgcctgcctt
gccggtgaggtcccttccttgatcttacggggagattatgaaaaggcgaaagaggtagcc
ctcttttacgattccatttttggaaggggcaatttttatttagaacttcaagaccatggc
attttagagcagaagaaagtgaatagagagcttgtcagaatgtctaaagaaacgggaata
ccgctagttgctacaaatgatgtccactatttggaaaagaaagatgcaagagctcatgag
gtgttattgtgcattcaaacaggaaaaacaattgaagatgaggacaggatgcttttccct
acagatgagttttaccttaaatctcctgaagaaatggaagagctttttgcatgctgtaaa
gaggctattgaaaataccgaaaaaattgccgagatgtgcaatattgagtttgagtttaat
aagactaagctgcctaaatacgacttgccagaaggagtggactcatacgagtatttgaga
aatttatgctatgaaggcctttataagaggtataaaagcccaagccaggaagtcatagat
aggttagagtacgagctttcagtgataaagcagatgggatatgtggattattttttaata
gtgtgggactttataaagtttgcaaaagacaatggaatcatgacagggccaggaagaggt
tctgctgccggaagtttggtcgcatatactctagggatcactaatgtagatcctataaag
tacaatcttctgtttgagaggtttttaaaccctgaaagggtcagcatgcctgacatcgat
tcggatttttgctatgagagaaggcaagaggttatagactacgtcgtccgaaagtatggc
aaagacaatgtggctcagattataacctttggtactatggcagccagagctgtgataagg
gatgtaggtagagctcttaactacccttatgcagaagtggacgaaatagccaagatgata
ccttttgaattaggcatgactattgacagagctttggagctaaatcctgagcttaaggag
aggtacgaaaaggacgaaagagtaaaacagctaatagatatatcaaaagccttagaagga
ctccccaggcatgcttctacccatgctgcaggggtggtcatatcaaaggagcctcttgtg
aactatgtgccgctgcagaaaaatgatgattctgtagtcacccagtttccaatgaccacc
ttggaagagcttggacttttaaaaatggattttctggggctgaggactctcactgtcata
agagatacaattgaaatggtaaagaaaaacaaagggattatcatagatttggattcttta
aactacgatgatccaaaagtgtatgaacttatttcaaaaggagagacagaaggagttttc
cagcttgaatctcctggaatgaggcagtttatgacagagcttaagcctaaaaacctagaa
gatataatcgcaggaatttccctttacaggccgggtcctatggaccagataccgaagtac
cttgccaacagaaataatcctgaaaaaatagagtacgaacaccccattttaaagcctata
ttagaggtgacgtacggctctttggtgtatcaggaacaggtcatgcagattgtaagggat
gtggcgggttactctcttggtagggcagacctagtaaggcgtgcaatggcgaaaaagaaa
atggatgtgatggaacaagaaaggaagaactttatctacggaatagtggatgaggaagga
aatgtagtggtacctggcgctttgaggaacggccttgatgaggagacagcaaataggctt
tttgaccagatgttagagtttgccaactatgcttttaacaaatctcacgctgcagcttac
gcagtcatagcttaccagacagcctatttgaagagatattttccagtggagtttatggcg
gctcttttgaatagctttgtagataatttggacaagatagctttttacgtgcaggtatgt
aagaaaatggggataaaagtgctgccgcctgacatcaatgaaagcgactcctatttcact
gtggtaggagacaagataaggtttgggctgagtgctgtgaagaatgtaggaattaatgtg
acagaagagattgtaagggaaagagaggcgaggggaaaatttaagtctgtaatagacttt
tttgagaggatgcaggacagccagctcaacaaaaaggcgatagaaagcctcattaaggcg
ggagcttttgcatctttgggagtaaaaaggtcccagctccttcagtcttacgataagctt
atagaaagcgtgaaaaaagcaaaaagcagtgcgatcgaaggacagatttctctctttgaa
gtgtcagaagaacataaggaaattgattttagatttcctgatgtagaagagtaccccaaa
aacaggattctctcaatggaaaaagagacattggggctttatataagcgggcatccatta
gaagaataccttgaagatataccgaagattacaaatgtcactacattggattttaagata
aatccagaggatgaaatgttcacatccaaattggaagacaatcaagaggttactatagca
ggagtgatagtggctaaaaaggtgaagtttacgcgaaatagcaatataatggcttttgtc
actcttgaggatatgtacggcactgtagaagtgatagtgttccctgctgtgtatgagaga
tattcttctctgataaaggaagacaatgctgttttgataaaaggtaaagtgagcgtaaaa
gaagaggaggagccaaagattttatgcgatgacataaagcttttgtcacaggtcgttgta
aagaagttgtatataaacatggaagattcttcaaagatagaagaggtaaaagaggtgctt
aagaaatgcccgggcaatatgcctgtagtgttgaaggtaaacagcaaacttcttgctgca
aagagagatttatgggttaatggcagcaaagaactcataaagaagttagaggacatagta
gggaaggaaaatgtgaaagtggtctga
2.SEQ?ID?NO.2
(1) sequence signature:
A. length: 3754 amino acid
B. type: polypeptide
C. chain: strand
D. geometry: solid
(2) molecule type: protein
( 3 ) SEQUENCE DESCRIPTION
Claims (8)
1. separated DNA is characterized in that: it is the nucleotide sequence that coding has the active polypeptide of high temperature-resisting DNA polymerase.
2. separated DNA according to claim 1, it is characterized in that: its coding has the nucleotide sequence of the modified forms of the polypeptide of the aminoacid sequence among the SEQ ID NO:2 or described polypeptide, on this modified forms function quite or relevant with high temperature-resisting DNA polymerase.
3. separated DNA according to claim 1 is characterized in that: it has the polynucleotide sequence of SEQID NO:1 and its mutant form, and mutation type comprises disappearance, nonsense, insertion, missense.
4. polypeptide separated, it is characterized in that: it has the high temperature-resisting DNA polymerase activity.
5. polypeptide separated according to claim 4 is characterized in that: it has the polypeptide of the aminoacid sequence among the SEQ ID NO:2, or its conservative property variation polypeptide or its active fragments or its reactive derivative.
6. carrier, it is characterized in that: it contains the DNA in the claim 1.
7. host cell is characterized in that: it is prokaryotic cell prokaryocyte or the eukaryotic cell that transforms with the described carrier of claim 6.
8. one kind prepares the proteic method of high temperature-resisting DNA polymerase, it is characterized in that this method comprises:
1) isolates the proteic nucleotide sequence SEQ of coding high temperature-resisting DNA polymerase IDNO.1;
2) make up the expression vector that contains SEQ ID NO.1 nucleotide sequence;
3) with step 2) in expression vector change host cell over to, formation can be produced the proteic reconstitution cell of high temperature-resisting DNA polymerase;
4) culturing step 3) in reconstitution cell;
5) separation, purifying obtain high temperature-resisting DNA polymerase albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01132117 CN1417338A (en) | 2001-11-06 | 2001-11-06 | High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01132117 CN1417338A (en) | 2001-11-06 | 2001-11-06 | High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1417338A true CN1417338A (en) | 2003-05-14 |
Family
ID=4671160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01132117 Pending CN1417338A (en) | 2001-11-06 | 2001-11-06 | High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1417338A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948853A (en) * | 2010-09-07 | 2011-01-19 | 广州华峰生物科技有限公司 | Thermophilic fat bacillus DNA polymerase |
| CN103898131A (en) * | 2012-12-31 | 2014-07-02 | 思洛生物技术股份有限公司 | DNA of coded DNA polymerase separated from thermophilic bacteria |
| CN104250641A (en) * | 2013-06-28 | 2014-12-31 | 思洛生物技术股份有限公司 | High fidelity DNA polymerase and preparation and application thereof |
-
2001
- 2001-11-06 CN CN 01132117 patent/CN1417338A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948853A (en) * | 2010-09-07 | 2011-01-19 | 广州华峰生物科技有限公司 | Thermophilic fat bacillus DNA polymerase |
| CN101948853B (en) * | 2010-09-07 | 2012-01-11 | 广州华峰生物科技有限公司 | Thermophilic fat bacillus DNA polymerase |
| CN103898131A (en) * | 2012-12-31 | 2014-07-02 | 思洛生物技术股份有限公司 | DNA of coded DNA polymerase separated from thermophilic bacteria |
| CN104250641A (en) * | 2013-06-28 | 2014-12-31 | 思洛生物技术股份有限公司 | High fidelity DNA polymerase and preparation and application thereof |
| CN104250641B (en) * | 2013-06-28 | 2017-09-01 | 北京福安华生物科技有限公司 | A kind of high-fidelity DNA polymerase and its preparation and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1417338A (en) | High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process | |
| CN1418954A (en) | High temp. resistant HSP 70 molecular chaperone and coded polypeptide and preparation process thereof | |
| CN1198928C (en) | High-temperature resistant ribosomal protein L15 gene and its coded polypeptide and preparing process | |
| CN1420172A (en) | High-temp resistant CTP synthetase gene, polypeptide coded therewith and preparing method thereof | |
| CN1164750C (en) | High-temperature resistant transaldolase gene, polypeptide coded by same and preparation method of polypeptide | |
| CN1371996A (en) | High-temperature resistant spermidine synthase gene sequence, polypeptide coded by same and method for preparing polypeptide | |
| CN1366059A (en) | Refractory phosphomannose isomerase gene and its polypeptide coded by it and preparing process | |
| CN1390943A (en) | High-temp. resistant 6-phosphoglucose isomerase gene and its coded polypeptide and preparing process | |
| CN1379101A (en) | Refractory thymidine phosphorylase gene and its polypeptide coded by it and preparing process | |
| CN1379103A (en) | High-temperature resistant glucan phosphorylase gene and polypeptide coded by same and preparation method | |
| CN1379094A (en) | High-temperature-resistant tyrosyl tRNA synthetase gene, polypeptide coded by same and preparation method | |
| CN1367249A (en) | High-temp. resistant chorismate synthase gene and its coded polypeptide and preparation method | |
| CN1420179A (en) | High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof | |
| CN1366054A (en) | Refractory glutaminic acid imine methyltransferase gene and its polypeptide coded by it and preparing process | |
| CN1379100A (en) | High-temp. resistant dihydroorotate synthase gene and its coded polypeptide and preparing method | |
| CN1364908A (en) | High-temperature resistant enolase gene and its coded polypeptide and preparation method | |
| CN1420175A (en) | High-tamp. resistant threonine synthetase gene, polypeptide coded therewith and preparing method thereof | |
| CN1379102A (en) | Refractory S-adenosylmethionine synthetase gene and its polypeptide coded by it and preparing process | |
| CN1366058A (en) | Refractory triosephosphate isomerase gene and its polypeptide coded by it and preparing process | |
| CN1379108A (en) | Refractory phosphoheptose isomerase gene and its polypeptide coded by it and preparing process | |
| CN1379097A (en) | Refractory phosphoglyceromutase 1 gene and its polypeptide coded by it and preparing process | |
| CN1420173A (en) | High-temp. resistant biotin synthetase gene, polypeptide coded therewith and preparing method thereof | |
| CN1371998A (en) | High-temp. resistant guanosine triphosphate cyclic hydrolase gene sequence and its coded polypeptide and preparation method | |
| CN1379105A (en) | High-temperature-resistant selenophosphoester synthase gene and polypeptide coded by same and preparation method | |
| CN1367251A (en) | High-temperature-resistant spermine succinic lyase gene and polypeptide coded by same and preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |