CN1379094A - High-temperature-resistant tyrosyl tRNA synthetase gene, polypeptide coded by same and preparation method - Google Patents

Abstract

The invention discloses a high-temperature-resistant tyrosyl tRNA synthetase gene, a coded polypeptide and a preparation method thereof. It relates to a method for coding separated DNA with activity or its functional equivalent variant and utilizing recombinant DNA technique to produce polypeptide with high-temp. resistant tyrosyl tRNA synthetase activity or its functional equivalent variant by using the described separated DNA. Based on sequencing and analysis of Tengchong thermophilic anaerobe whole genome, the high temperature resistant tyrosyl tRNA synthetase gene is cloned and separated. The gene is useful for preparing transgenic microorganisms or animals and plants for producing high-temperature-resistant tyrosyl tRNA synthetase, and recovering the enzyme coded by the gene. In addition, the invention also provides an amino acid sequence and a functional equivalent of the polypeptide with the high-temperature resistant tyrosyl tRNA synthetase activity. Meanwhile, the invention also provides a method for preparing, separating and purifying the polypeptide with the activity of the high-temperature resistant tyrosyl tRNA synthetase.

Description

High temperature resistant tyrosyl-t RNA synthetase gene and encoded polypeptides and preparation method

Technical field

The present invention relates to sudden change or genetic engineering, relate in particular to a kind of high temperature resistant tyrosyl-t RNA synthetase gene and encoded polypeptides and preparation method.

Background technology

Tyrosyl-t RNA synthetase (tyrosyl-tRNA synthetase) is a typical half site activator enzyme (half-of-the-sites activity).This proteolytic enzyme is a symmetric dipolymer, and it is made up of identifiable subunit, and each all has one to activate the site completely.The function of tyrosyl-t RNA synthetase is tyrosine to be connected activation with corresponding tRNA become tyrosyl tRNA.

The aminoacylation of tyrosyl tRNA comprises two steps: at first, tyrosine and ATP reaction generate a mediator protein enzyme--tyrosyl thuja acid when discharging pyrophosphate salt; Then, under the effect of enzyme, the reaction of tyrosyl thuja acid generates tyrosyl tRNA and an AMP.

According to the difference of short signal sequence, the tRNA synthetic enzyme can be divided into two different types: Class I and Class II.CLASS I is monomeric enzyme normally, is made up of 10 amino acid in 20 primary amino acids.Their alpha-carboxyl group is attached on 2 ' hydroxy of VITAMIN B4 in the tRNA molecule; CLASS II normally dimerization or four poly-proteolytic enzyme, and form by other 10 in 20 amino acid, they are attached to amino acid on 3 ' hydroxy of tRNA molecule.Two types also is different on the amino acid activation zone.CLASS I has a parallel beta zone, and CLASS II is then opposite.

Tyrosyl-t RNA synthetase belongs to Class I and is a dimer that 47 subunits are arranged.N-terminal has 320 residues to be used for priming reaction, however C-terminal, and 99 residues are used for the qualification of tRNA and the formation of tyrosyl tRNA.The synthetic enzyme crystalline structure that has comprised restricted tyrosine-AMP is accurately measured.This active mediator protein enzyme is still stable under the shortage situation of coupling tRNA, and is limited by 12 hydrogen bonds.

The monomer of each proteolytic enzyme has three zones: one comprises the folding alphs/beta zone (residue 1-220) of 6 beta; The zone of an alpha-spiral (residue 248-318); An irregular c ' stub area (residue 319-418).319 residues of this n-end have primary effect at activating reaction, and irregular c ' stub area then has effect in tRNA limits.The structures shape of tyrosyl-t RNA synthetase is in the association of tyrosine and tyrosyl thuja acid.This structure has comprised a typical R ossmanFold nucleosides binding zone, and this zone has comprised that the parallel beta-of the 5-strand of axis is folding, and tyrosyl-t RNA synthetase is the binding of this longitudinal folded ends.

The tyrosyl-t RNA synthetase of bacterium has a C ' stub area that connects flexibly, about 80 residues, and these make the crystalline structure confusion of proteolytic enzyme.Under the absolute condition of 2.0 , after measured the structure of the hot tyrosyl-t RNA synthetase of thermophilic happiness of crystal habit, wherein the c-stub area is sorted and finds that the c-stub area of part of the folding and ribosome protein S 4-9 of 50 residues is the same.Also identified the crystalline structure that having a liking under the absolute condition of 2.8 invited the hot tyrosyl-t RNA synthetase of happiness and transported the combination of tyrosine.In this structure, the c-stub area is defined in long-armed and DNA unstable long-armed of anticodon.And the tRNA intersection is defined in two subunits of dimerization enzyme, significantly defines the similar tRNA resemblance classII synthetic enzyme of the model of cognition of class I tyrosyl-t RNA synthetase in it simultaneously.

The structure of the intestinal bacteria tyrosyl-t RNA synthetase gene of forming by 1269 base pairs, order-checking fully.This gene has a codon transhipment model, and this model is typical height expressing protein and identical with the gene of amino acid transport synthetic enzyme in other intestinal bacteria.The purifying of peptide and arrange has been applied to locate the definite of terminal and 95% the translocator sequence of N-.The intestinal bacteria tyrosyl-t RNA synthetase of latter's output 47,403 megarads (Mr of 47,403), and disclose and the primary structure that comes from the analogy proteolytic enzyme of rod bacterium staerothermophilus has high similarity.The basic structure of tyrosyl-t RNA synthetase is from the nucleotide sequences of clone gene among the rod bacterium staerothermophilus, and infers in the amino acid peptide chain-ordering of purifying protein enzyme.This enzyme have molecular weight be 47316 molecule and with intestinal bacteria in tyrosyl-t RNA synthetase have 56% identical.The adhesion area of tyrosine acyl glycosides can be positioned the N-end of part of polypeptide chain, and can be two kinds of medium-altitude preservations of proteolytic enzyme.

Tengchong thermophilc anaerobe (Thermoanaerobacter tangcongensis), it is a kind of microorganism that lives in the hot spring of Yunnan Province of China province Tengchong County, it is a kind of thermophilic eubacterium (eubacteria), optimum growth temperature is 75 degrees centigrade, anaerobic growth, the gramstaining reaction is positive.It is at first found by Microbe Inst., Chinese Academy of Sciences and has carried out the analysis on the taxonomy.Bacterial classification is kept at Chinese microorganism and preserves center MB4 ^T(Chinese collection of microorganisms AS l.2430 ^T=JCM 11007 ^T).This thermophilc anaerobe is the distinctive species of China, and the high temperature resistant tyrosyl-t RNA synthetase that is had in its body also has own its specific structure.

Summary of the invention

One of purpose of the present invention provides a kind of isolating, and coding has the nucleotide sequence of the active polypeptide of high temperature resistant tyrosyl-t RNA synthetase.

Two of purpose of the present invention provides a kind of isolating high temperature resistant tyrosyl-t RNA synthetase active polypeptide that has.

Another object of the present invention also provide thermophilc anaerobe the tyrosyl-t RNA synthetase recombinant vectors, contain the host cell of recombinant vectors, and prepare proteic method.

One aspect of the present invention provides a kind of can the coding to have the nucleotide sequence of the active polypeptide of high temperature resistant tyrosyl-t RNA synthetase.Said nucleotide sequence coded the have polypeptide of the aminoacid sequence among the SEQ ID NO.2 or the modified forms of described polypeptide, on this modified forms function quite or relevant with tyrosyl-t RNA synthetase.Nucleotide sequence has the polynucleotide sequence of SEQ ID NO.1 and its mutant form, and mutation type comprises: disappearance, nonsense, insertion, missense.

The present invention provides a kind of high temperature resistant tyrosyl-t RNA synthetase active polypeptide on the other hand.This polypeptide has polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence among the SEQ ID No.2.

The present invention also provides a kind of method for preparing high temperature resistant tyrosyl-t RNA synthetase, and it may further comprise the steps:

1) isolate the coding high temperature resistant tyrosyl-t RNA synthetase nucleotide sequence SEQ ID NO.1;

2) make up the expression vector that contains SEQ ID NO.1 nucleotide sequence;

3) with step 2) in expression vector change host cell over to, form the reconstitution cell can produce high temperature resistant tyrosyl-t RNA synthetase;

4) culturing step 3) in reconstitution cell;

5) separation, purifying obtain high temperature resistant tyrosyl-t RNA synthetase.

The present invention relates to the separation and the expression of the high temperature resistant tyrosyl-t RNA synthetase gene of thermophilc anaerobe.Based on Tengchong thermophilc anaerobe genome sequencing and analysis, clone and separate high temperature resistant tyrosyl-t RNA synthetase gene.The high temperature resistant tyrosyl-t RNA synthetase of transgenic microorganism or animals and plants this gene is used to produce to(for) preparation, and it is useful to reclaim the enzyme that obtains this genes encoding.In addition, the present invention also provides and has had active amino acid sequence of polypeptide of high temperature resistant tyrosyl-t RNA synthetase and functional equivalent body.Simultaneously, the present invention also provides preparation, separates, and purifying has the method for the active polypeptide of high temperature resistant tyrosyl-t RNA synthetase.

Description of drawings

Fig. 1 is an order-checking library construction flow chart of steps;

Fig. 2 is order-checking and data analysis schema.

Embodiment

The invention provides isolating, the encode polynucleotide molecule of the active polypeptide of high temperature resistant tyrosyl-t RNA synthetase, this nucleic acid molecule is by obtaining Tengchong thermophilc anaerobe genome sequencing and analysis, nucleotide sequence with SEQ.ID NO.1, its coding has 406 amino acid whose polypeptide, and this polypeptide infers that molecular weight is 46684 dalton.

The present invention also provides a kind of recombinant vectors, and this carrier comprises isolating nucleic acid molecule of the present invention, and the host cell that includes recombinant vectors.Simultaneously, the present invention includes the method that makes up this recombinant vectors and host cell, and the method for producing high temperature resistant tyrosyl-t RNA synthetase with the recombined engineering technology.

The present invention provides a kind of isolating high temperature resistant tyrosyl-t RNA synthetase or polypeptide further, and it has SEQ.ID NO.2 aminoacid sequence, or at least 70% is similar, more preferably, have at least 90%, 95%, 99% identical.

In the present invention, " isolating " DNA is meant that this DNA or fragment have been arranged in its both sides under native state sequence separates, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, " high temperature resistant tyrosyl-t RNA synthetase gene " refers to encode and has the nucleotide sequence of the active polypeptide of high temperature resistant tyrosyl-t RNA synthetase, as nucleotide sequence and the degenerate sequence thereof of SEQ.ID NO.1.This degenerate sequence be meant have one or more codons to be encoded in this sequence the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of known codon, so be low to moderate about 70% the degenerate sequence described aminoacid sequence of SEQ ID NO.2 of also encoding out with SEQ IDNO.1 nucleotide sequence homology.This term also comprises can be under the rigorous condition of moderate, more preferably under highly rigorous condition with the nucleotide sequence of the nucleotide sequence hybridization of SEQ ID NO.1.This term also comprises and SEQ ID NO.1 nucleotide sequence homology 70% at least, preferably at least 80%, more preferably at least 90%, and at least 95% nucleotide sequence best.

In the present invention, " isolating " proteic polypeptide is meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as uses column chromatography, and PAGE or HPLC method are measured the purity of polypeptide.Isolated polypeptide is substantially free of the component of following it under the native state.

In the present invention, " high temperature resistant tyrosyl-t RNA synthetase " refers to have the active SEQ ID of high temperature resistant tyrosyl-t RNA synthetase NO.2 polypeptide of sequence.This term also comprises the varient of SEQ ID NO.2 sequence, and these varients have and natural high temperature resistant tyrosyl-t RNA synthetase identical functions.These varients include, but is not limited to several amino acid whose disappearances, insert and/or replace, and add one or several amino acid at C latter end and/or N-terminal, also can be the difference that does not influence on the modified forms of sequence.For example, for known in the field, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C latter end and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of high temperature resistant tyrosyl-t RNA synthetase.

In the present invention, can select various carrier known in the art for use, as commercially available various plasmids, clay, phage and retrovirus etc.When producing high temperature resistant tyrosyl-t RNA synthetase of the present invention, high temperature resistant tyrosyl-t RNA synthetase gene order can be linked to each other with expression regulation sequence, thereby form high temperature resistant tyrosyl-t RNA synthetase expression vector.Expression vector contains replication origin and expression regulation sequence, promotor, enhanser and necessary machining information site.Expression vector also must contain alternative marker gene, as a) providing to microbiotic or other toxicant (penbritin, the protein or the b of resistance kantlex, methotrexate etc.)) complementary auxotroph protein or c) protein of the essential nutritive ingredient that does not have in the complex medium is provided.Various different hosts' appropriate flags gene is well known in the art or production firm's specification sheets indicates.These expression vectors can be with well known to a person skilled in the art recombinant DNA technology preparation, as can be with reference to people such as Sambrook, and 1989 or people such as Ausubel, 1992.

Recombinant expression vector can be introduced host cell with method well known in the art, and these methods comprise: electrotransformation, Calcium Chloride Method, particle bombardment etc.The process that the external source recombinant vectors is imported host cell is called " conversion ".By cultivating host cell, induce the expression of desirable proteins, and by protein separation technology known in the art, obtain required protein as column chromatography etc.Also can adopt these protein of synthetic such as solid phase technique.

In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic cell prokaryocyte such as intestinal bacteria commonly used, Bacillus subtilus etc.Eukaryotic cell such as yeast cell commonly used, or various animal and plant cells.High temperature resistant tyrosyl-t RNA synthetase full length gene sequence of the present invention or its fragment can be used polymerase chain reaction (PCR) TRAP usually, recombination method, or the method for synthetic obtains.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence design primer, is template with the thermophilc anaerobe complete genome DNA of ordinary method preparation well known by persons skilled in the art, increases and obtains relevant sequence.In case obtained relevant sequence, just it can be cloned into relevant carrier, change host cell again over to, from the host cell after the propagation, separate obtaining large batch of relevant sequence then by ordinary method.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (NewYork:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1: make up the order-checking library

The structure in order-checking library adopts full genome shotgun approach (shotgun) to carry out.At first cultivate the Tengchong thermophilc anaerobe, cultural method is pressed Marmur (1961) method and is collected bacterium by (Yanfen Xue, 2000) improved MB substratum (Balch et al., 1979), extracts total DNA.For the randomness of the library construction that guarantees to check order, farthest avoid producing the problem of breakage hot spot, that adopts several different methods, different condition builds the storehouse principle.Adopt earlier physics cutting method (comprise supersonic method and shear with Hydroshear Machine), next is selected for use AluI to carry out the random partial enzyme according to this bacterium genome signature and cuts.Adopt varying strength to handle sample when physics is sheared, handle sample by enzyme amount gradient is set when enzyme is cut.Sample after the processing adopts electrophoresis fraction collection 1.5-4kb dna fragmentation after flat terminal the processing, be connected with the dephosphorylized pUC18 that cuts through the SmaI enzyme, connects product has made up random sequencing by electric Transformed E .coli DH5 α library.Simultaneously, (cut genomic dna in the order-checking library that has also made up long insertion fragment (about 10kb) for the ease of the later overlap joint of contig (contig) with Sau3AI random partial enzyme, electrophoresis is collected the fragment about 10kb, is connected, makes up the library with the dephosphorylized pUC18 that cuts through the BamHI enzyme).The order-checking of these two ends in library can obtain the relation between the contig in the process of finishing figure (finishing), and can solve the difficulty that cause filling-up hole in bigger hole (gap).Build storehouse flow process such as (see figure 1).

Embodiment 2: gene order-checking

When finishing the genomic order-checking of Tengchong thermophilc anaerobe, two kinds of full-automatic sequenator: ABI377 and MegaBACE 1000 have mainly been used.These two kinds of sequenators all are to utilize the principle of electrophoresis (see figure 2) that checks order, and can finish 96 samples at every turn.ABI377 is the product of PE company, is a kind of of ABI series.It belongs to the plate gel electrophoresis sequenator.MegaBACE 1000 is products of Pharmacia Corp, belongs to the capillary gel electrophoresis sequenator.

Embodiment 3:Basecalling and sequencing quality monitoring

So-called Basecalling is meant the process that obtains correct base sequence from the raw data file that sequenator obtains.Because that obtain on the sequenator is A, T, G, the light intensity variation track (trace) of the different wave length that four kinds of base pairs of C are answered need take certain algorithm therefrom correctly to identify the base of different track correspondences with computer.What we used is Phred software (Ewing B, Hillier L, 1998), and reason is that its result is more reliable, and other programs that its result exports in the same software package of being more convenient for are further analyzed.

Phred carries out the algorithm principle of Basecalling, is the shape according to each peak in the track, and spacing, and factor such as signal to noise ratio are judged the base type, simultaneously this base are provided reliability information, i.e. the sequencing quality of base.In large scale sequencing, the monitoring of sequencing quality is crucial, and it directly influences the decision-making to order-checking, comprises the structure in library, the size of fraction of coverage.Can in time feed back the error that may occur in the order-checking experiment simultaneously.

Embodiment 4: sequence assembly

So-called sequence assembly is exactly full genome shotgun approach, and the sample sequence that claims the shotgun random sequencing to obtain again is assembled into successive contig (contig), mainly utilizes the overlap between them for referencial use.Consider the influence that has carrier in the order-checking, need earlier sample sequence to be unloaded body and handle.Here used software cross_match and the back used software Phrap of splicing are the software (Gordon D, Abajian C, 1998) of U.S. Washington university, and its ultimate principle is Swith-Waterman algorithm (Waterman MS, 1990).This is a kind of dynamic algorithm, after having considered the comparison between the sequence in twos, can obtain the publicly-owned sequence (consensus sequence) of one group of sequence.Sample sequence behind the removal carrier splices with Phrap again.In when splicing, the sequencing quality of base also has been considered, and the confidence level of resulting publicly-owned each base of sequence is calculated by the sequencing quality of the sample of forming this publicly-owned sequence.

Embodiment 5: gene annotation

After obtaining genomic most of sequence (frame diagram of finishing the work) substantially, just need carry out note to genome, comprise out frame frame (Open Reading Frame, prediction ORF), the prediction of gene function, and the segmental analysis of special RNA etc.

The first step adopts the GLIMMER2.0 (Delcher of default parameter, A.L., Harmon, D.1999) and ORPHEUS (Frishman, D.1998) software prediction gene coded sequence, open frame and the non-coding region (intergenic region) of all predictions all use BLAST software (Altschul, S.F.et al.1997) and the irredundant albumen database (non-redundant protein database) of NCBI relatively to find the gene that may miss then.When judging the starting point of a gene, will be with reference to various relevant informations, as sequence homology, ribosome bind site, possible signal peptide sequence and promoter sequence etc.If open in the frame when a plurality of promotor occurring at one, generally adopt the starting point of first promotor as gene.(Ermolaeva M.D.2000) predicts the transcription terminator that does not rely on Rho (ρ) factor at non-coding region to adopt TransTerm software.If this terminator be positioned at a gene the catchment too at a distance, then may hint a minigene lose or the mistake that checks order has shortened this gene artificially, can be used as the reference of further analysis.When determining to move frame sudden change and point mutation, main basis is judged with the proteinic similarity in the database.If protein is corresponding to the situation of two encoding sequences adjacent one another are, then be considered to a non-activity gene (pseudogene pseudogenes), produce the abort phenomenon because this illustrates between these two encoding sequences owing to suddenling change, and then gene is lost activity.All analytical resultss use Artemis sequence viewer software (Rutherford, K.et al.2000) to carry out manual analysis again.Some are obviously shown eclipsed with other code sequence and open frame, and length does not have homology and wherein do not have tangible promotor or termination is regional opens frame and will be removed less than 150 base pairs and in the data with existing storehouse.

Proteinic function fragment (motif) and functional area (domain) employing and Pfam, PRINTS, PROSITE, ProDom and SMART database respectively compare, the result uses InterPro database (Apweiler, R.et al.2001) to carry out Macro or mass analysis again.According to the COGs database (Tatusov, R.L.et al.2001) of NCBI and with reference to other result of querying database determine protein in the COGs classification functional classification and possible pathways metabolism.Confirm membranin, abc transport albumen and stride the film functional domain with TMHMM software (Krogh, A.et al.2001).The employing Gram-negative bacteria is a parameter, with SIGNALP2.0 software (Nielsen, H.et al.1999) analytical signal peptide zone.(4) filling-up hole

After finishing genomic work frame chart, will carry out the filling-up hole work of difficulty more, promptly finish the order-checking of whole genome 100%, obtain an annular genome.Groundwork is exactly that the contig that obtains is previously coupled together.Main method comprises:

A. utilize forward and reverse order-checking sample message in the order-checking in the order-checking process, we have carried out two-way order-checking to some sample intentionally, check order simultaneously promptly that certain inserts segmental two ends, institute's calling sequence are spliced with other sequences again.Because the relation of this a pair of sequence on genome is certain, distance between it is roughly known, according to this information, one can confirm whether certain section contig is reliable, the 2nd, when this a pair of sequence lays respectively on the different contig, can determine direction relations and the position relation of these two contig, for further contrived experiment provides reference.

B. long fragment and the Cosmid end sequencing of inserting

Based on same principle, we can make up the insertion fragment library of different lengths, and only to its two ends order-checking, its particular location is analyzed in splicing then.These libraries comprise that length is the long Cosmid library of inserting about sheet phase library and 20-40Kb of 9-12Kb.Specific analytical method is same as above.

C. PCR and the terminal Walking of extension test

According to contig direction and position relation that A and B provided, further Biochemistry Experiment just can have been carried out.As design a pair of primer and carry out pcr amplification, or carry out end extension (Walking) with a certain contig end sequence synthetic primer and come filling-up hole etc.

Embodiment 6: the preparation of tyrosyl-t RNA synthetase and purification

According to the tyrosyl-t RNA synthetase complete encoding sequence (SEQ IDNO.1) that gene annotation among the embodiment obtains, design can amplify the primer that complete coding is read frame, and introduces restriction endonuclease sites respectively on positive anti-primer, so that construction of expression vector.Plasmid DNA with the order-checking library that obtains among the embodiment 1 is a template, behind pcr amplification, guarantee to read recombinate under the correct prerequisite of frame to the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Again recombinant vectors is transformed into that (method for transformation is CaCL in the bacillus coli DH 5 alpha ₂Method or electrotransformation), Screening and Identification obtains containing the engineering bacteria DH5 α-pGEX-2T-TyrS of expression vector.

The engineering bacteria DH5 α-pGEX-2T-TyrS of picking list bacterium colony contains in the LB substratum of 100 μ g/ml penbritins jolting in 3ml and cultivates 37 ℃ and spend the night, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD ₆₀₀After reaching 0.5, add IPTG, continue at 37 ℃ and cultivated respectively 0,1,2,3 hours to final concentration 1mmol/L.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing desirable proteins.

As stated above behind the engineering bacteria of abduction delivering desirable proteins, with bacterium centrifugation, add 50% saturated glutathione S epharose 4B of 20ml PBS by every 400ml bacterium, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the glutathione S epharose 4B that combines desirable proteins in centrifugal 10 minutes, abandoned supernatant.Add 100 μ l reduced glutathion elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, and supernatant is the albumen of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.Protein band at 46684 dalton place is tyrosyl-t RNA synthetase.

1. SEQ ID NO.1 ( 1 ) ：a.：1221b.：DNAc.：d.： ( 2 ) ： ( 3 ) ：gtgtcggtgctagaggttttaaaagaaagaggatatatcgctcaaatgacccatgaagaagagatagagaagcttttagaaaaagaaaagataactttttacataggttttgaccccactgctgacagcctgcacgtaggtcatttgattcagataatgacaatggctcacatgcagagagccggccacaggccaattgtgcttttgggaggcggaactgcccttataggagatccgagcggtagaactgacatgagaaaaatgctcactaaagaggaaatagatagaaatgctgaagccttcaaaaagcagatggagagattcatcgatttttctgagggcaaagctataatggaaaacaatgctaaatggctccttggcttgaattacatagaatttttgagagatataggtgttcactttactgtaaatcgaatgcttgaggcggaagcttttaagactcgcatggaaagaggccttactttccttgagtttaattacatgctaatgcaggcttatgactttttagagctttacaggcgctatggctgtgtaatgcagatgggaggaaatgatcagtggtctaatataatcgctggagtagagcttatacgcaaaaaagaaggcaagcaggcttatggaatgacttttgtgctccttacaacaagcgaaggaaagaagatgggcaaaactgaaaaaggcgctatatggctggatcctaaaaagacttctccttatgaattttatcagtactggagaaatataggagacgcagatgtggaaaaggctttggctcttttgactttccttcctatggacgaagtgagaaggcttgggagactaagggataaggagataaacgaagctaaaaaggtactggcttttgaggttacaaagcttgtacacggtgaagaagaagccctaaaggctcagaaggcggccgaagctctgtttgaaggcggcggtgaaatggaacacgtgcccagcattgaagtctctcaggacataatcggaaggaaaatagttgatgtgctttttgaagctaaagtcataccttcaaagagcgagggaagaaggcttattcagcagggaggcctttacatcaacgacaagagggtagaaaacgtggatgaatgcataaaagaagagatggtaaaagaaaatgccattcttgtaagaaaagggaaaaaggaatatcacaggttattggtaaaggaatga2. SEQ ID NO.2 ( 1 ) ：a.：406b.：c.：d.： ( 2 ) ： ( 3 ) Val Ser Val Leu Glu Val Leu Lys Glu Arg Gly Tyr Ile Ala Gln Met1 5 10 15Thr His Glu Glu Glu Ile Glu Lys Leu Leu Glu Lys Glu Lys Ile Thr

20 25 30Phe?Tyr?Ile?Gly?Phe?Asp?Pro?Thr?Ala?Asp?Ser?Leu?His?Val?Gly?His

35 40 45Leu?Ile?Gln?Ile?Met?Thr?Met?Ala?His?Met?Gln?Arg?Ala?Gly?His?Arg

50 55 60Pro?Ile?Val?Leu?Leu?Gly?Gly?Gly?Thr?Ala?Leu?Ile?Gly?Asp?Pro?Ser65 70 75 80Gly?Arg?Thr?Asp?Met?Arg?Lys?Met?Leu?Thr?Lys?Glu?Glu?Ile?Asp?Arg

85 90 95Asn?Ala?Glu?Ala?Phe?Lys?Lys?Gln?Met?Glu?Arg?Phe?Ile?Asp?Phe?Ser

100 105 110Glu?Gly?Lys?Ala?Ile?Met?Glu?Asn?Asn?Ala?Lys?Trp?Leu?Leu?Gly?Leu

115 120 125Asn?Tyr?Ile?Glu?Phe?Leu?Arg?Asp?Ile?Gly?Val?His?Phe?Thr?Val?Asn

130 135 140Arg?Met?Leu?Glu?Ala?Glu?Ala?Phe?Lys?Thr?Arg?Met?Glu?Arg?Gly?Leu145 150 155 160Thr?Phe?Leu?Glu?Phe?Asn?Tyr?Met?Leu?Met?Gln?Ala?Tyr?Asp?Phe?Leu

165 170 175Glu?Leu?Tyr?Arg?Arg?Tyr?Gly?Cys?Val?Met?Gln?Met?Gly?Gly?Asn?Asp

180 185 190Gln?Trp?Ser?Asn?Ile?Ile?Ala?Gly?Val?Glu?Leu?Ile?Arg?Lys?Lys?Glu

195 200 205Gly?Lys?Gln?Ala?Tyr?Gly?Met?Thr?Phe?Val?Leu?Leu?Thr?Thr?Ser?Glu

210 215 220Gly?Lys?Lys?Met?Gly?Lys?Thr?Glu?Lys?Gly?Ala?Ile?Trp?Leu?Asp?Pro225 230 235 240Lys?Lys?Thr?Ser?Pro?Tyr?Glu?Phe?Tyr?Gln?Tyr?Trp?Arg?Asn?Ile?Gly

245 250 255Asp?Ala?Asp?Val?Glu?Lys?Ala?Leu?Ala?Leu?Leu?Thr?Phe?Leu?Pro?Met

260 265 270Asp?Glu?Val?Arg?Arg?Leu?Gly?Arg?Leu?Arg?Asp?Lys?Glu?Ile?Asn?Glu

275 280 285Ala?Lys?Lys?Val?Leu?Ala?Phe?Glu?Val?Thr?Lys?Leu?Val?His?Gly?Glu

290 295 300Glu?Glu?Ala?Leu?Lys?Ala?Gln?Lys?Ala?Ala?Glu?Ala?Leu?Phe?Glu?Gly305 310 315 320Gly?Gly?Glu?Met?Glu?His?Val?Pro?Ser?Ile?Glu?Val?Ser?Gln?Asp?Ile

325 330 335Ile?Gly?Arg?Lys?Ile?Val?Asp?Val?Leu?Phe?Glu?Ala?Lys?Val?Ile?Pro

340 345 350Ser?Lys?Ser?Glu?Gly?Arg?Arg?Leu?Ile?Gln?Gln?Gly?Gly?Leu?Tyr?Ile

355 360 365Asn?Asp?Lys?Arg?Val?Glu?Asn?Val?Asp?Glu?Cys?Ile?Lys?Glu?Glu?Met

370 375 380Val?Lys?Glu?Asn?Ala?Ile?Leu?Val?Arg?Lys?Gly?Lys?Lys?Glu?Tyr?His385 390 395 400Arg?Leu?Leu?Val?Lys?Glu

405

Claims (8)

1. isolated DNA molecule is characterized in that: it is the nucleotide sequence that coding has the polypeptide of high temperature resistant tyrosyl-t RNA synthetase protein-active.

2. dna molecular as claimed in claim 1, it is characterized in that: the polypeptide of the aminoacid sequence among the said nucleotide sequence coded SEQ.ID of the having NO.2 or the modified forms of described polypeptide, on this modified forms function quite or relevant with high temperature resistant tyrosyl-t RNA synthetase.

3. dna molecular as claimed in claim 1 is characterized in that: said nucleotide sequence has the polynucleotide sequence of SEQ ID NO.1 and its mutant form, and mutation type comprises: disappearance, nonsense, insertion, missense.

4. polypeptide separated, it is characterized in that: it has high temperature resistant tyrosyl-t RNA synthetase activity.

5. polypeptide as claimed in claim 4 is characterized in that: it has polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence among the SEQ ID No.2.

6. carrier, it is characterized in that: it contains the DNA in the claim 1.

7. host cell is characterized in that: it is prokaryotic cell prokaryocyte or the eukaryotic cell that transforms with the described carrier of claim 6.

8. method for preparing high temperature resistant tyrosyl-t RNA synthetase is characterized in that this method may further comprise the steps:

1) isolate the coding high temperature resistant tyrosyl-t RNA synthetase gene nucleotide sequence SEQ ID NO.1;

2) make up the expression vector that contains SEQ ID NO.1 nucleotide sequence;

3) with step 2) in expression vector change host cell over to, form the reconstitution cell can produce high temperature resistant tyrosyl-t RNA synthetase;

4) culturing step 3) in reconstitution cell;

5) separation, purifying obtain high temperature resistant tyrosyl-t RNA synthetase.

Images