CN1420179A - High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof - Google Patents
High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof Download PDFInfo
- Publication number
- CN1420179A CN1420179A CN 01132212 CN01132212A CN1420179A CN 1420179 A CN1420179 A CN 1420179A CN 01132212 CN01132212 CN 01132212 CN 01132212 A CN01132212 A CN 01132212A CN 1420179 A CN1420179 A CN 1420179A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- gyrase
- temperature resistant
- resistant anti
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
A process for coding the separated DNA with activity and function equivalent variant and preparing the polypeptide with high-temp resistant reverse gyrase activity and its function equivalent variant from said DNA by recombination is disclosed. The high-temp resistant reverse gyrase gene is cloned and separated, which can be used to prepare transgenic microbe, animal, or plant and recover the enzyme coded by said gene. The amino acid sequence of said polypeptide and the processes for preparing, separating and purifying said polypeptide are disclosed also.
Description
Technical field
The present invention relates to sudden change or genetic engineering, relate in particular to a kind of high-temperature resistant anti to gyrase gene order and encoded polypeptides and preparation method.
Background technology
Reverse rotation enzyme (Reverse gyrase) is the atypia topological enzyme that is detected in thermophile bacteria, it can make ring-shaped DNA molecule form positive supercoiling, because positive supercoiling can make double chain DNA molecule stablize under up to the temperature of 90 degree Celsius, prevent that the part from untwisting, and be beneficial to spiral renaturation after transcription complex passes through when transcribing, be well-determined so far protein that in thermophile bacteria, exists, known thermophilic archeobacteria or thermophilic eubacterium all contain this kind of enzyme. and he is made up of two functional units, one has the helicase activity of the DNA/RNA of dependency ATP, another is the activity with topoisomerase I, catalytic dna chain break and reconnecting; This enzyme has two kinds of different structure formations in different bacteriums, constitute for single polypeptide or by two subunits. if single polypeptide, helicase active function unit with DNA/RNA of dependency ATP is positioned at aminoterminal, active function unit with topoisomerase I is positioned at carboxyl terminal, if two subunits, then each subunit has one of both functions respectively, and this enzyme how can catalysis be formed the mechanism of positive supercoiling, does not also understand at present.This enzyme can make dna molecular form positive supercoiling and increase its stability to heat, for dna molecular can duplicating or transcribing under hot conditions lay the foundation.
Tengchong thermophilc anaerobe (Thermoanaerobacter tangcongensis), it is a kind of microorganism that lives in the hot spring of Yunnan Province of China province Tengchong County, it is a kind of thermophilic eubacterium (eubacteria), optimum growth temperature is 75 degrees centigrade, anaerobic growth, the gramstaining reaction is positive.It is at first found by Microbe Inst., Chinese Academy of Sciences and has carried out the analysis on the taxonomy.Bacterial classification is kept at Chinese microorganism and preserves center MB4
T(Chinese collection ofmicroorganisms AS 1.2430
T=JCM 11007
T).This thermophilc anaerobe is the distinctive species of China, and the high-temperature resistant anti that is had in its body also has own its specific structure to gyrase.
Summary of the invention
The technical problem to be solved in the present invention provides a kind of high-temperature resistant anti to gyrase gene and encoded polypeptides thereof, and it is had:
1) isolating, coding has the nucleotide sequence of high-temperature resistant anti to the active polypeptide of gyrase.
2) isolating, have high-temperature resistant anti to the gyrase active polypeptide.
The present invention also provide thermophilc anaerobe reverse rotation enzyme recombinant vectors, contain the host cell of recombinant vectors, and produce proteic method.
The technical solution adopted in the present invention is: the present invention relates to a kind of isolated DNA molecule, it can be encoded and have the nucleotide sequence of high-temperature resistant anti to the polypeptide of gyrase protein-active.
Said nucleotide sequence coded the have polypeptide of the aminoacid sequence among the SEQ.ID NO.2 or the modified forms of described polypeptide, on this modified forms function quite or relevant to gyrase with high-temperature resistant anti.
Said nucleotide sequence has the polynucleotide sequence of SEQ ID NO.1 and its mutant form, and mutation type comprises: disappearance, nonsense, insertion, missense.
The invention still further relates to a kind of polypeptide separated, it has high-temperature resistant anti to the gyrase activity.
Described polypeptide has polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence among the SEQ ID No.2.
The invention still further relates to a kind of carrier, it contains to encode and has the separated DNA of high-temperature resistant anti to the nucleotide sequence of the polypeptide of gyrase protein-active.
The invention still further relates to a kind of host cell, it is prokaryotic cell prokaryocyte or the eukaryotic cell that transforms with above-mentioned carrier.
The invention still further relates to a kind of method for preparing high-temperature resistant anti to gyrase, this method comprises:
1) isolates the coding high-temperature resistant anti to the nucleotide sequence SEQ of gyrase gene ID NO.1;
2) make up the expression vector that contains SEQ ID NO.1 nucleotide sequence;
3) with step 2) in expression vector change host cell over to, formation can be produced the reconstitution cell of high-temperature resistant anti to gyrase;
4) culturing step 3) in reconstitution cell;
5) separation, purifying obtain high-temperature resistant anti to gyrase.
The invention has the beneficial effects as follows: this gene is used to produce transgenic microorganism or the animals and plants of high-temperature resistant anti to gyrase for preparation, and it is useful to reclaim the enzyme that obtains this genes encoding.In addition, it can make ring-shaped DNA molecule form positive supercoiling, because positive supercoiling can make double chain DNA molecule stablize under up to the temperature of 90 degree Celsius, prevent that the part from untwisting, and be beneficial to spiral renaturation after transcription complex passes through when transcribing, be well-determined so far protein that in thermophile bacteria, exists.
Description of drawings
Fig. 1 is an order-checking library construction flow chart of steps;
Fig. 2 is order-checking and data analysis schema;
Fig. 3 is that forward and reverse sequencing result is analyzed synoptic diagram;
Fig. 4 Part of Co smid end sequencing result schematic diagram;
Embodiment
At first, the invention provides isolating, the coding high-temperature resistant anti is to the polynucleotide molecule of the active polypeptide of gyrase, this nucleic acid molecule is by obtaining Tengchong thermophilc anaerobe genome sequencing and analysis, nucleotide sequence with SEQ.ID NO.1, its coding has the polypeptide that 1117 amino acid are read frame, infers that molecular weight is 128616 dalton.
The invention still further relates to a kind of recombinant vectors, this carrier comprises isolating nucleic acid molecule of the present invention, and the host cell that includes recombinant vectors.Simultaneously, the present invention includes the method that makes up this recombinant vectors and host cell, and produce the method for high-temperature resistant anti to gyrase with the recombined engineering technology.
The present invention provides a kind of isolating high-temperature resistant anti to gyrase or polypeptide further, it is characterized in that having the SEQ.IDNO.2 aminoacid sequence, or at least 70% is similar, more preferably, have at least 90%, 95%, 99% identical.
In the present invention, " isolating " DNA is meant that this DNA or segment have been arranged in its both sides under native state sequence separates, refer to that also this DNA or segment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
In the present invention, " reverse rotation enzyme gene " refer to the encode nucleotide sequence of polypeptide with reverse rotation enzymic activity is as nucleotide sequence and the degenerate sequence thereof of SEQ.ID NO.1.This degenerate sequence be meant have one or more codons to be encoded in this sequence the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of known codon, so be low to moderate about 70% the degenerate sequence described aminoacid sequence of SEQ ID NO.2 of also encoding out with SEQ ID NO.1 nucleotide sequence homology.This term also comprises can be under the rigorous condition of moderate, more preferably under highly rigorous condition with the nucleotide sequence of the nucleotide sequence hybridization of SEQ IDNO.1.This term also comprises and SEQ ID NO.1 nucleotide sequence homology 70% at least, preferably at least 80%, more preferably at least 90%, and at least 95% nucleotide sequence best.
In the present invention, " isolating " proteic polypeptide is meant that it accounts at least 20% of the total material of sample at least, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as uses column chromatography, and PAGE or HPLC method are measured the purity of polypeptide.Isolated polypeptide is substantially free of the component of following it under the native state.
In the present invention, " reverse rotation enzyme " refers to have the SEQ ID NO.2 polypeptide of sequence of reverse rotation enzymic activity.This term also comprises the varient of SEQ ID NO.2 sequence, and these varients have and natural reverse rotation enzyme identical functions.These varients include, but is not limited to several amino acid whose disappearances, insert and/or replace, and add one or several amino acid at C latter end and/or N-terminal, also can be the difference that does not influence on the modified forms of sequence.For example, for known in the field, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C latter end and/or N-terminal and also can not change proteinic function usually.This term also comprises the active part and the reactive derivative of reverse rotation enzyme.
In the present invention, can select various carrier known in the art for use, as commercially available various plasmids, clay, phage and retrovirus etc.When producing reverse rotation enzyme of the present invention, reverse rotation enzyme gene order can be able to be operated the low expression regulation sequence that is connected in, thereby form reverse rotation expression of enzymes carrier.Expression vector contains replication origin and expression regulation sequence, promotor, enhanser and necessary machining information site.Expression vector also must contain alternative marker gene, as a) providing to microbiotic or other toxicant (penbritin, the protein or the b of resistance kantlex, methotrexate etc.)) complementary auxotroph protein or c) protein of the essential nutritive ingredient that does not have in the complex medium is provided.Various different hosts' appropriate flags gene be well known in the art or production firm's specification sheets famous.These expression vectors can be with well known to a person skilled in the art recombinant DNA technology preparation, as can be with reference to people such as Sambrook, and 1989 or people such as Ausubel, 1992.
Recombinant expression vector can be introduced host cell with method well known in the art, and these methods comprise: electrotransformation, Calcium Chloride Method, particle bombardment etc.The process that the external source recombinant vectors is imported host cell is called " conversion ".By cultivating host cell, induce the expression of desirable proteins, and by protein separation technology known in the art, obtain required protein as column chromatography etc.Also can adopt these protein of synthetic such as solid phase technique.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic cell prokaryocyte such as intestinal bacteria commonly used, Bacillus subtilus etc.Eukaryotic cell such as yeast cell commonly used, or various animal and plant cells.
Reverse rotation enzyme full length gene sequence of the present invention or its segment can be used the pcr amplification method usually, recombination method, or the method for synthetic obtains.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence design primer, is template with the thermophilc anaerobe complete genome DNA of ordinary method preparation well known by persons skilled in the art, increases and obtains relevant sequence.In case obtained relevant sequence, just it can be cloned into relevant carrier, change host cell again over to, from the host cell after the propagation, separate obtaining large batch of relevant sequence then by ordinary method.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
(1), makes up the order-checking library
The structure in order-checking library adopts full genome shotgun approach (shotgun) to carry out.At first cultivate the Tengchong thermophilc anaerobe, cultural method is pressed Marmur (1961) method and is collected bacterium by (Yanfen Xue, 2000) improved MB substratum (Balch et al., 1979), extracts total DNA.For the randomness of the library construction that guarantees to check order, farthest avoid producing the problem of breakage hot spot, that adopts several different methods, different condition builds the storehouse principle.。Adopt earlier physics cutting method (comprise supersonic method and shear with Hydroshear Machine), next is selected for use AluI to carry out the random partial enzyme according to this bacterium genome signature and cuts.Adopt varying strength to handle sample when physics is sheared, handle sample by enzyme amount gradient is set when enzyme is cut.Sample after the processing adopts electrophoresis fraction collection 1.5-4kb dna fragmentation after flat terminal the processing, be connected with the dephosphorylized pUC18 that cuts through the SmaI enzyme, connects product has made up random sequencing by electric Transformed E .coli DH5 α library.Simultaneously, (cut genomic dna in the order-checking library that has also made up long insertion fragment (about 10kb) for the ease of the later overlap joint of lengthy motion picture disconnected (contig) with Sau3AI random partial enzyme, electrophoresis is collected the fragment about 10kb, is connected, makes up the library with the dephosphorylized pUC18 that cuts through the BamHI enzyme).The order-checking of these two ends in library can obtain the relation between the contig in the process of finishing figure (finishing), and can solve the difficulty that bigger gap causes filling-up hole.Build storehouse flow process such as (see figure 1).
(2), gene order-checking
When finishing the genomic order-checking of Tengchong thermophilc anaerobe, two kinds of full-automatic sequenator: ABI377 and MegaBACE 1000 have mainly been used.These two kinds of sequenators all are to utilize the principle of electrophoresis (see figure 2) that checks order, and can finish 96 samples at every turn.ABI377 is the product of PE company, is a kind of of ABI series.It belongs to the plate gel electrophoresis sequenator.MegaBACE1000 is the product of Pharmacia Corp, belongs to the capillary gel electrophoresis sequenator.
(3), Basecalling and sequencing quality monitoring
So-called Basecalling is meant the process that obtains correct base sequence from the raw data file that sequenator obtains.Because that obtain on the sequenator is A, T, G, the light intensity variation track (trace) of the different wave length that four kinds of base pairs of C are answered need take certain algorithm therefrom correctly to identify the base of different track correspondences with computer.What we used is Phred software (Ewing B, Hillier L, 1998), and reason is that its result is more reliable, and other programs that its result exports in the same software package of being more convenient for are further analyzed.
Phred carries out the algorithm principle of Basecalling, is the shape according to each peak in the track, and spacing, and factor such as signal to noise ratio are judged the base type, simultaneously this base are provided reliability information, i.e. the sequencing quality of base.In large scale sequencing, the monitoring of sequencing quality is crucial, and it directly influences the decision-making to order-checking, comprises the structure in library, the size of fraction of coverage.Can in time feed back the error that may occur in the order-checking experiment simultaneously.
(4), sequence assembly
So-called sequence assembly is exactly full genome shotgun approach, and the sample sequence that claims the shotgun random sequencing to obtain again is assembled into successive lengthy motion picture disconnected (contig), mainly utilizes the overlap between them for referencial use.Consider the influence that has carrier in the order-checking, need earlier sample sequence to be unloaded body and handle.Here used software cross_match and the back used software Phrap of splicing are the software (Gordon D, Abajian C, 1998) of U.S. Washington university, and its ultimate principle is Swith-Waterman algorithm (Waterman MS, 1990).This is a kind of dynamic algorithm, after having considered the comparison between the sequence in twos, can obtain the publicly-owned sequence (consensus sequence) of one group of sequence.Sample sequence behind the removal carrier splices with Phrap again.In when splicing, the sequencing quality of base also has been considered, and the confidence level of resulting publicly-owned each base of sequence is calculated by the sequencing quality of the sample of forming this publicly-owned sequence.
(5), gene annotation
After obtaining genomic most of sequence (frame diagram of finishing the work) substantially, just need carry out note to genome, comprise out frame frame (Open Reading Frame, prediction ORF), the prediction of gene function, and the pulsating analysis of special RNA etc.
The first step adopts the GLIMMER2.0 (Delcher of default parameter, A.L., Harmon, D.1999) and ORPHEUS (Frishman, D.1998) software prediction gene coded sequence, open frame and the non-coding region (intergenicregion) of all predictions all use BLAST software (Altschul, S.F.et al.1997) and the irredundant albumen database (non-redundant protein database) of NCBI relatively to find the gene that may miss then.When judging the starting point of a gene, will be with reference to various relevant informations, as sequence homology, ribosome bind site, possible signal peptide sequence and promoter sequence etc.If open in the frame when a plurality of promotor occurring at one, generally adopt the starting point of first promotor as gene.(Ermolaeva M.D.2000) predicts the transcription terminator that does not rely on Rho (ρ) factor at non-coding region to adopt TransTerm software.If this terminator be positioned at a gene the catchment too at a distance, then may hint a minigene lose or the mistake that checks order has shortened this gene artificially, can be used as the reference of further analysis.When determining to move frame sudden change and point mutation, main basis is judged with the proteinic similarity in the database.If protein is corresponding to the situation of two encoding sequences adjacent one another are, then be considered to a non-activity gene (pseudogene pseudogenes), produce the abort phenomenon because this illustrates between these two encoding sequences owing to suddenling change, and then gene is lost activity.All analytical resultss use Artemis sequence viewer software (Rutherford, K.et al.2000) to carry out manual analysis again.Some are obviously shown eclipsed with other code sequence and open frame, and length does not have homology and wherein do not have tangible promotor or termination is regional opens frame and will be removed less than 150 base pairs and in the data with existing storehouse.
Proteinic functional fragment (motif) and functional area (domain) employing and Pfam, PRINTS, PROSITE, ProDom and SMART database respectively compare, the result uses InterPro database (Apweiler, R.et al.2001) to carry out Macro or mass analysis again.According to the COGs database (Tatusov, R.L.et al.2001) of NCBI and with reference to other result of querying database determine protein in the COGs classification functional classification and possible pathways metabolism.Confirm membranin, abc transport albumen and stride the film functional domain with TMHMM software (Krogh, A.et al.2001).The employing Gram-negative bacteria is a parameter, with SIGNALP2.0 software (Nielsen, H.et al.1999) analytical signal peptide zone.
(6), filling-up hole
After finishing genomic work frame chart, will carry out the filling-up hole work of difficulty more, promptly finish the order-checking of whole genome 100%, obtain an annular genome.Groundwork is exactly that the contig that obtains is previously coupled together.This is a very concrete and numerous and diverse job.Main method comprises:
A. utilize forward and reverse order-checking sample message in the order-checking in the order-checking process, we have carried out two-way order-checking to some sample intentionally, check order simultaneously promptly that certain inserts pulsating two ends, institute's calling sequence are spliced with other sequences again.Because the relation of this a pair of sequence on genome is certain, distance between it is roughly known, according to this information, one can confirm whether certain section contig is reliable, the 2nd, when this a pair of sequence lays respectively on the different contig, can determine direction relations and the position relation of these two contig, for further contrived experiment provides with reference to (see figure 3).
B. long insertion segment and Cosmid end sequencing are based on same principle, and we can make up the insertion segment library of different lengths, and only to its two ends order-checking, its particular location is analyzed in splicing then.These libraries comprise that length is the long Cosmid library of inserting about segment storehouse and 20-40Kb of 9-12Kb.Specific analytical method is same as above.Figure 4 shows that Part of Co smid end sequencing result.
C.PCR and the terminal Walking of extension test
According to contig direction and position relation that A and B provided, further Biochemistry Experiment just can have been carried out.As design a pair of primer and carry out pcr amplification, or carry out end extension (Walking) with a certain contig end sequence synthetic primer and come filling-up hole etc.
(7), the preparation of reverse rotation enzyme and purification
According to the reverse rotation enzyme complete encoding sequence (SEQ ID NO.1) that gene annotation among the embodiment obtains, design can amplify the primer that complete coding is read frame, and introduces restriction endonuclease sites respectively on positive anti-primer, so that construction of expression vector.Plasmid DNA with the order-checking library that obtains among the embodiment 1 is a template, behind pcr amplification, guarantee to read recombinate under the correct prerequisite of frame to the pGEX-2T carrier (Pharmacia, Piscataway, NJ).Again recombinant vectors is transformed into that (method for transformation is CaCL in the bacillus coli DH 5 alpha
2Method or electrotransformation).Screening and Identification to the engineering bacteria DH5 α-pGEX-2T-Rg that contains expression vector.
The engineering bacteria DH5 α-pGEX-2T-Rg of picking list bacterium colony contains in the LB substratum of 100 μ g/ml penbritins jolting in 3ml and cultivates 37 ℃ and spend the night, draw nutrient solution by 1: 100 concentration and in new LB substratum (containing 100 μ g/ml penbritins), cultivated about 3 hours, to OD
600After reaching 0.5, add IPTG, continue at 37 ℃ and cultivated respectively 0,1,2,3 hours to final concentration 1mmol/L.It is centrifugal to get the different 1ml bacterium liquid of incubation time, in the bacterial precipitation thing, add lysate (2 * SDS sample-loading buffer, 50 μ l, distilled water 45 μ l, 3-mercaptoethanol 5 μ l), the suspendible bacterial precipitation, boiled in the boiling water bath 5 minutes, centrifugal 1 minute of 10000rpm, supernatant adds electrophoresis in the 12%SDS-PAGE glue.The bacterial strain that the protein content of dyeing back observation expection molecular weight size increases with the IPTG induction time is the engineering bacteria of expressing desirable proteins.
As stated above behind the engineering bacteria of abduction delivering desirable proteins, with bacterium centrifugation, add 50% saturated Triptide Sepharose 4B of 20mlPBS by every 400ml bacterium, 37 ℃ of joltings were in conjunction with 30 minutes, 10000rpm precipitated the Triptide Sepharose 4B that combines desirable proteins in centrifugal 10 minutes, abandoned supernatant.Add 100 μ l reduced glutathione elutriants by every milliliter of ultrasonic liquid gained precipitation, room temperature was put 10 minutes, and supernatant is the albumen of wash-out.Repeat twice of wash-out.The supernatant of wash-out is stored in-80 ℃, and carries out the SDS-PAGE electrophoresis, detects purification effect.Protein band at 128616 dalton place is the reverse rotation enzyme.
1.SEQ ID NO.1 ( 1 ) :a.:3354b.:DNAc.:d.: ( 2 ) : ( 3 ) :atggcattggcaacaggtgcaaaatactatcactcctgcataaactgcggaggaataaacacggacacaagaaatgaaaaaggcttaccttgtgaggtgtgcttgccgtttgaagatggagatgtcctaaaaggtttgaaactcaacaacagtcttaaaggatatgaaaaatactggaatttaaatcaacaatacaaggaatttgaagaatttttcttttcaaaaataaacaaaaagcccaccgggtatcaaagattctgggcaaagcggcttttactctcaaaaagctttacactcgttgctccaactggagtcggcaaaactacatttggactaatttcagctctttggattgcaaaaaaaggcggtaaagtagctctcgttttccccacggtctcactggtagaacaggcagcaaagaggttgattgaattttctaaagaagatgaagatgtgaatattctcttttatacgtcttcgctgaaaaaaaaggaaagggaaaaatttgaaaaaaacttttctgaaggaaactacgacatactggtaatctcatcccagttcatatccaaaagaaaagagcagctttctcaaaaagtttttgacctcgtatttgtggatgacgtagatgcagttttgaaatcatcgaaaaatattgacacacttcttaatatgataggaatctcacaaaaagcgatagactcaactttagacaatctaaaaaaaggtaacaattccgataaaattcaaattgaagaaaaagctccaaaaggaaggttaatcgtctcttctgccaccgcaaaaccaaaaggcataaaaccccttttatttagagaacttttgggttttgaaatcggaagatttactaccagtgcacggaatataacaaacgtgagaataaaagaaaaatcgctagaaaaattgctctatataattaacctcttaaaagacggaatcctgctctttgtacccacagaagaagaagggaaagaaattgcaaactatttagaagaacatggagtaaaattaggtaaaacatgggaagattttgagaaatcttttgaaaaatttaaggagggaagcctacagcttctatgtggcatatactcttactacggaaaattagtaaggggaattgacttgcctttaaggatcaaatttgcagtattttggggaactccctcttttaaattcagcacaaagttagaaaatgctcccagatttattctagaaagaaattttcaggattatttagaaaacaacccaaaattgaaggcctacttcaaagacctgcagaggctttcaacagaaaagctcagaaaatctgtagaaaaatacatatcacctgaaacctgggaaaaactcatacagaaaaatttccccactacaaaatttgataaagagaaaaatctcatagtaatacctgatgtgtacacatacatccaggcttctggaaggacttcgagaatattcggtacatctctcaccaaaggaatttccatactctttgaggaagacgattccttatttgaacttttaaaggcaagacttctctacctcaccgaggaagagtggacagaagaaggtgaaattgagcatttagtgaaagaagcagaagaaactagaaaagccatttcaacagacagctcttctaaagacatgaaatctagaatgataatcgtcgaatctcctacaaaggcccaaactatttcaaaatttttagaaaaatcttctacaagaagatacgggtctttaatggtacacgagtcaataacacaggaaggtattttgcttttaactgcatcaaaaggacatttgtatgatttggagacaaaaacagggctgcacggcgtggagataaatgatggcagattcattccttactacaactccataaagcgttgtagttcctgcggagctcagtttacagatgaactaccccgttgcccctactgcaattcagacaagattgatgataagaaaaaaattttagaagctttaagggacatcgcgatggaagtagatgaagtgataattgccacagacccagacgtggaaggcgaaaaaattgggtgggatatctcccaatatataaaaccggtaaataaaaacgttcagcgcattgaaatgcacgaaattacaaaatttggcttcgataaggccataagaaatcggagaaactgtgatgtgaatcttgtaaagtcgcaaattgtgaggagaatcgaagatagatgggtaggatttgaactgagcttgcggcttcagaaaaattttcaaaactctaatttatctgcaggaagagtgcaaagcaccgttctcgggtggattttagaaaaagaaatagaacacagtaaaagcaaaaaaactgtaactcagttcacactggataatggatttaaatttgaagtagatggaaaaatagatgtagacgaggtagaagtggagatagtagaagaaaaagaacaggcgctttctcccttaccaccttttaatactccttctttgttgacagctgcttctcagcaatttaaactgcctgtgcagcagataatggaaatactccagacgctttttgagctaggctttataacttatcacagaacagactccaccagaatttcttctacaggacagaaaatagcgcggtcataccttgagaaaataggtaaaattacccttttgtctgaaagagaatggggtaaagaaggagctcatgaggccataagaccggtaaaaccgatatctccagaagaattatctgaattcatcacagaaaaaatagctgcctatttaagtcccatgcacataaaagtgtattctttgatattcaatagattcatggcaagccaaatgacatcccctgtcgtgataaatcaaaaaattttgattaagaatggttcttttcaggtagaaagggaggtgccagtaaaattacaagaagaaggatggaatatttttaacccaataacagtctatacaccctttgaagagaaaaaatactcagtagtttctaagaggacttacactactcacacagttccccttttcacacaagcttctttgattgaagaaatgcaaaaaagaaatataggcaggccctccacatatgcaaaaatagtagatatacttttcaaaaggaagtatataattgaggacgtttataaaaggcttagaaccactgctttgggaagaaaggtctattcgtacttgtcagaaagatatatgaactacataaacgaagaaactacccgccaattggaaaagctcatggaatcagtcgaaacaggagaaaaagattaccagagtgttttaaaaaacttatatgaagaattaaacgagattctaataaaaaattaa2.SEQ ID NO.2 ( 1 ) :a.:1117b.:c.:d.: ( 2 ) : ( 3 ) MALATGAKYYHSCINCGGINTDTRNEKGLPCEVCLPFEDGDVLKGLKLNNSLKGYEKYWNLNQQYKEFEEFFFSKINKKPTGYQRFWAKRLLLSKSFTLVAPTGVGKTTFGLISALWIAKKGGKVALVFPTVSLVEQAAKRLIEFSKEDEDVNILFYTSSLKKKEREKFEKNFSEGNYDILVISSQFISKRKEQLSQKVFDLVFVDDVDAVLKSSKNIDTLLNMIGISQKAIDSTLDNLKKGNNSDKIQIEEKAPKGRLIVSSATAKPKGIKPLLFRELLGFEIGRFTTSARNITNVRIKEKSLEKLLYIINLLKDGILLFVPTEEEGKEIANYLEEHGVKLGKTWEDFEKSFEKFKEGSLQLLCGIYSYYGKLVRGIDLPLRIKFAVFWGTPSFKFSTKLENAPRFILERNFQDYLENNPKLKAYFKDLQRLSTEKLRKSVEKYISPETWEKLIQKNFPTTKFDKEKNLIVIPDVYTYIQASGRTSRIFGTSLTKGISILFEEDDSLFELLKARLLYLTEEEWTEEGEIEHLVKEAEETRKAISTDSSSKDMKSRMIIVESPTKAQTISKFLEKSSTRRYGSLMVHESITQEGILLLTASKGHLYDLETKTGLHGVEINDGRFIPYYNSIKRCSSCGAQFTDELPRCPYCNSDKIDDKKKILEALRDIAMEVDEVIIATDPDVEGEKIGWDISQYIKPVNKNVQRIEMHEITKFGFDKAIRNRRNCDVNLVKSQIVRRIEDRWVGFELSLRLQKNFQNSNLSAGRVQSTVLGWILEKEIEHSKSKKTVTQFTLDNGFKFEVDGKIDVDEVEVEIVEEKEQALSPLPPFNTPSLLTAASQQFKLPVQQIMEILQTLFELGFITYHRTDSTRISSTGQKIARSYLEKIGKITLLSEREWGKEGAHEAIRPVKPISPEELSEFITEKIAAYLSPMHIKVYSLIFNRFMASQMTSPVVINQKILIKNGSFQVEREVPVKLQEEGWNIFNPITVYTPFEEKKYSVVSKRTYTTHTVPLFTQASLIEEMQKRNIGRPSTYAKIVDILFKRKYIIEDVYKRLRTTALGRKVYSYLSERYMNYINEETTRQLEKLMESVETGEKDYQSVLKNLYEELNEILIKN
Claims (8)
1. isolated DNA molecule is characterized in that: it is that coding has the nucleotide sequence of high-temperature resistant anti to the polypeptide of gyrase protein-active.
2. dna molecular according to claim 1, it is characterized in that: the polypeptide of the aminoacid sequence among the said nucleotide sequence coded SEQ.ID of the having NO.2 or the modified forms of described polypeptide, on this modified forms function quite or relevant to gyrase with high-temperature resistant anti.
3. dna molecular according to claim 1 is characterized in that: said nucleotide sequence has the polynucleotide sequence of SEQ ID NO.1 and its mutant form, and mutation type comprises: disappearance, nonsense, insertion, missense.
4. polypeptide separated, it is characterized in that: it has high-temperature resistant anti to the gyrase activity.
5. polypeptide according to claim 4 is characterized in that: it has polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence among the SEQ ID No.2.
6. carrier, it is characterized in that: it contains the DNA in the claim 1.
7. host cell is characterized in that: it is prokaryotic cell prokaryocyte or the eukaryotic cell that transforms with the described carrier of claim 6.
8. method for preparing high-temperature resistant anti to gyrase is characterized in that this method comprises:
1) isolates the coding high-temperature resistant anti to the nucleotide sequence SEQ of gyrase gene IDNO.1;
2) make up the expression vector that contains SEQ ID NO.1 nucleotide sequence;
3) with step 2) in expression vector change host cell over to, formation can be produced the reconstitution cell of high-temperature resistant anti to gyrase;
4) culturing step 3) in reconstitution cell;
5) separation, purifying obtain high-temperature resistant anti to gyrase.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 01132212 CN1420179A (en) | 2001-11-15 | 2001-11-15 | High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 01132212 CN1420179A (en) | 2001-11-15 | 2001-11-15 | High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1420179A true CN1420179A (en) | 2003-05-28 |
Family
ID=4671250
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 01132212 Pending CN1420179A (en) | 2001-11-15 | 2001-11-15 | High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1420179A (en) |
-
2001
- 2001-11-15 CN CN 01132212 patent/CN1420179A/en active Pending
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1418954A (en) | High temp. resistant HSP 70 molecular chaperone and coded polypeptide and preparation process thereof | |
CN1420172A (en) | High-temp resistant CTP synthetase gene, polypeptide coded therewith and preparing method thereof | |
CN1198928C (en) | High-temperature resistant ribosomal protein L15 gene and its coded polypeptide and preparing process | |
CN1417338A (en) | High temperature-resisting DNA polymerase gene sequence and its encoded polypeptide and prepn process | |
CN1366059A (en) | Refractory phosphomannose isomerase gene and its polypeptide coded by it and preparing process | |
CN1164750C (en) | High-temperature resistant transaldolase gene, polypeptide coded by same and preparation method of polypeptide | |
CN1371996A (en) | High-temperature resistant spermidine synthase gene sequence, polypeptide coded by same and method for preparing polypeptide | |
CN1420179A (en) | High-temp. resistant reverse gyrase gene, polypeptide coded therewith and preparing method thereof | |
CN1366054A (en) | Refractory glutaminic acid imine methyltransferase gene and its polypeptide coded by it and preparing process | |
CN1367249A (en) | High-temp. resistant chorismate synthase gene and its coded polypeptide and preparation method | |
CN1364908A (en) | High-temperature resistant enolase gene and its coded polypeptide and preparation method | |
CN1367250A (en) | High-temperature-resistant isocitrate dehydrogenase gene, polypeptide coded by same and preparation method of polypeptide | |
CN1418955A (en) | High temp. resistant FtsA protein gene and coded polypeptide and preparation process thereof | |
CN1371998A (en) | High-temp. resistant guanosine triphosphate cyclic hydrolase gene sequence and its coded polypeptide and preparation method | |
CN1379101A (en) | Refractory thymidine phosphorylase gene and its polypeptide coded by it and preparing process | |
CN1379103A (en) | High-temperature resistant glucan phosphorylase gene and polypeptide coded by same and preparation method | |
CN1390943A (en) | High-temp. resistant 6-phosphoglucose isomerase gene and its coded polypeptide and preparing process | |
CN1418957A (en) | High temp. resistant acetyl-coA carboxylase gene and coded polypeptide and preparation process thereof | |
CN1420175A (en) | High-tamp. resistant threonine synthetase gene, polypeptide coded therewith and preparing method thereof | |
CN1371997A (en) | High-temp. resistant dihydroorotate dehydrogenase gene sequence and its coded polypeptide and preparing process | |
CN1418958A (en) | High temp. resistant urocanate hydratase gene and coded polypeptide and preparation proess thereof | |
CN1379097A (en) | Refractory phosphoglyceromutase 1 gene and its polypeptide coded by it and preparing process | |
CN1420173A (en) | High-temp. resistant biotin synthetase gene, polypeptide coded therewith and preparing method thereof | |
CN1418956A (en) | High temp. resistant Nus G protein gene and coded polypeptide and preparation process thereof | |
CN1379094A (en) | High-temperature-resistant tyrosyl tRNA synthetase gene, polypeptide coded by same and preparation method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |