CN1373358A - Reagent kit and method for quickly detecting alga-dissolving vibrio - Google Patents
Reagent kit and method for quickly detecting alga-dissolving vibrio Download PDFInfo
- Publication number
- CN1373358A CN1373358A CN 01130127 CN01130127A CN1373358A CN 1373358 A CN1373358 A CN 1373358A CN 01130127 CN01130127 CN 01130127 CN 01130127 A CN01130127 A CN 01130127A CN 1373358 A CN1373358 A CN 1373358A
- Authority
- CN
- China
- Prior art keywords
- reagent
- minute
- vibrio alginolyticus
- dna
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A reagent kit or quickly detecting alga-dissolving vibrio contains DNA extracting reagent including buffer reagent and cell-cracking reagent, PCR reaction reagent including pre-mixing reagnet and reaction primer reagent, and electrophoretic and colouring reagent. Its quickly detecting method is also disclosed. Its advantages are high speed and high correctness.
Description
Technical field
The present invention relates to the kit of a kind of fast detecting vibrio alginolyticus, further relate to the method that the kit that uses the fast detecting vibrio alginolyticus is surveyed the inspection vibrio alginolyticus fast.
Technical background
In recent years, China's mariculture industry fast development, sea-farming output has increased 5-6 doubly in the period of 10 in the past.But the great development band of last stage sea-farming bears the character of much blindness even is destructive, causes this sea-farming increase of production in 2 years to begin to slow down, and especially the change of the problem of disease is more and more serious.Wherein vibriosis is one of important cause of disease that endangers multiple sea-farming biologies such as culturing fish and shrimp shellfish algae.Vibrios is the native bacterium of ocean origin, widely distributes in seawater and sea life; Vibrio pathogen can cause that aquaculture organism is explosive dead, and can with virus, other bacterium or parasite etc. are caused co-infected together.In China's sea-farming biology, vibrio alginolyticus is modal vibrio pathogen, and the loss that caused by vibrio alginolyticus every year is very huge.Current vibrios cause of disease detection technique mainly contains following several: 1, the routine biochemistry detection technique, it be with the microbionation behind the purifying in the nutrient culture media that contains different biochemical substances, because the material of bacterial metabolism not of the same race is incomplete same, also different with the result of developer reaction in the nutrient culture media, with these results and reference culture and Documentary Records result contrast, just can reach a conclusion.(list of references: Lou Yongxin Wang Jinliang chief editor " practical clinical bacteriology check and progress " 1992 Tianjin Scientific English Translation publishing company), this methods and results more accurately but very consuming time, and is and very unreliable to the testing result of new kind; 2, quick bacteria identification kits such as API-20E, statistical study drew expert's conclusion after it adopted and detects a few biochemical indicator, relatively save time, but the result was not too reliable.
Summary of the invention
The kit that the purpose of this invention is to provide a kind of fast detecting vibrio alginolyticus particularly provides a pair of vibrio alginolyticus Auele Specific Primer VP
01And VP
02, and provide a kind of kit of fast detecting vibrio alginolyticus that uses to survey the method for vibrio alginolyticus in inspection and the monitoring several samples fast, thus the foundation of science is provided for healthy aquaculture.
Cardinal principle of the present invention is: reagent A and B carry out cracking with the bacterium in the sample, discharge DNA of bacteria, reagent C and D are polymerase chain reaction technology reagent, by vibrio alginolyticus specific DNA fragment primer contained in the reagent D and the compositions such as hot polymerization synthase in the reagent C, the DNA that sample is discharged carries out specific amplification, because our primer of design is peculiar by vibrio alginolyticus, therefore, if contain vibrio alginolyticus in the sample, the specific fragment of its DNA is after the process amplification so, and concentration will reach 10
8More than the mol (grammol), like this, behind electrophoresis and ethidium bromide staining, ultraviolet light detects the purpose band that just can detect certain molecular weight.If there is not vibrio alginolyticus, the purpose band of the same molecular weight that then can not increase.
The kit of a kind of fast detecting vibrio alginolyticus of the present invention is characterized in that solvent comprises:
(a) DNA extraction reagent: contain buffer reagent A and cell cracking agent B,
Reagent A contains NaCl, Tris (trihydroxy methyl aminomethane), EDTA (ethylenediamine tetraacetic acid) and TritonX-100 (triton x-100), and their concentration is respectively: 0.1-0.3M NaCl, 1-100mM Tris (pH8.0), 0.1-10mM pH8.0 EDTA, 0-20% Triton X-100;
Reagent B contains lysozyme and Tris (trihydroxy methyl aminomethane), and concentration is respectively: 1-10mg/ml lysozyme and 1-100mM pH8.0 Tris;
(b) PCR reaction reagent: comprise reaction premix reagent C and reaction primer reagent D,
Reagent C contains 10 times of PCR reaction buffers, Taq enzyme (hot polymerization synthase) and ddH
2O (sterilization distilled water), content are respectively 10 times of PCR reaction buffers of 2.5-5.0 μ l, 0.1-0.5 μ l Taq enzyme (5 unit/μ l), 18-35.5 μ l ddH
2O;
Reagent D: comprise that special primer is to VP
01And VP
02, dNTP (potpourris of four kinds of deoxynucleotides) and MgCl
2, content is respectively 0.2-1 μ M VP
01With 0.2-1 μ M VP
02, 20-200 μ M dNTP and 0.5-10mM MgCl
2
(c) electrophoresis and chromogenic reagent comprise reagent E and reagent F,
Reagent E: be 50 times of TAE (electrophoretic buffer), contain Tris-acetate and EDTA, concentration is respectively: 0.04M Tris-acetate, 0.001M EDTA;
Reagent F:0.8-2% agarose+0.5-20 μ g/ml ethidium bromide.
Special primer in the reagent D is to VP
01And VP
02Be special primer and the necessary composition that carries out the PCR reaction, VP
01Refer in particular to 5 ' ATTGAGAACCCGACAGAAGCGAAG;
VP
02Refer in particular to 5 ' CCTAATGCGGTGATCAGTGTTACTPCR.
The best group of every tube reaction reagent becomes: reagent C: 5.0 μ l, 10 * PCR Buffer, 0.5 μ l Taq (5U/ μ l), 35.5 μ l ddH
2O, reagent D: 4.0 μ l dNTP (2.5mM each), 3.0 μ l MgCl
2(25mM), 10pm VP
0110pmVP
02
Reagent A is the DNA extraction damping fluid, for the extraction of DNA provides suitable buffer environment and suppresses the degraded of DNA; Reagent B is a cell cracking agent, makes the bacterium cracking and discharges DNA; Reagent C is a PCR reaction premix reagent, is one of principal ingredient of PCR reaction reagent, and reagent D is a PCR primer reagent, also is the principal ingredient of PCR reaction, includes the most key special primer VP of this kit
01And VP
02Reagent E is 50 times of TAE (electrophoretic buffer), and the buffer system of suitable pH value, ionic strength etc. is provided for sample electrophoresis; Reagent F is electrophoretic medium agarose+developer ethidium bromide.
The method that the kit of use fast detecting vibrio alginolyticus is surveyed the inspection vibrio alginolyticus fast comprises the following steps: successively
(a). sample preparation: get 0.1-0.5 gram sample, with 100-400 μ l reagent A suspended sample, and with the abundant mixing of sample; The centrifugal 2-5 of 10000-12000g minute, abandon supernatant;
(b) .DNA extracts: with the 100-300 μ l reagent A precipitation that suspends once more, and adding 20-100 μ l reagent B mixing, room temperature was placed more than 2 minutes, was incubated 1-10 minute again in boiling water bath, and cell is broken fully, discharged DNA; The centrifugal 8-10 of 10000-12000g minute, get supernatant and add the absolute ethyl alcohol deposit D NA of 2 times of supernatant volumes (400-800 μ l); Room temperature was placed 5-10 minute, the centrifugal 3-8 of 10000-12000g minute; Remove supernatant, 75% ethanol washs once, allows ethanol thoroughly volatilize, and precipitation is dissolved in the 10-50 μ l sterilization distilled water; Be DNA extraction liquid;
(c) .PCR amplification: the DNA that extracts with 0.5-1 μ l is as the template of pcr amplification; Getting 21-42 μ l reagent C mixes with 4-8 μ l reagent D; On thermal cycler, the dna profiling that extracts is increased, unwind 2-5 minute by 94 ℃-98 ℃; Then 93-95 ℃ of sex change 30 seconds-1 minute, 54-58 ℃ of renaturation 30 seconds-1 minute, 72 ℃ were extended 30 seconds-1.5 minutes, so circulated 25-35 time, were incubated 8-12 minute at 72 ℃ at last, and the specific fragment of vibrio alginolyticus is increased to 10
8More than the mol;
(d). electrophoresis and color developing detection: get the sample after 5-10 μ l increases, mix with 2-6 μ l 0.25% bromophenol blue, 0.8-1.2% agarose electrophoresis and colour developing, under ultraviolet light, detect the band whether one 300 nucleotide pair is arranged, if the band of a 300bp is arranged, interpret sample has vibrio alginolyticus to infect or pollutes, otherwise does not then have.Advantage of the present invention and good effect:
Detection technique based on nucleic acid, comprise dna probe and round pcr (polymerase chain reaction technology), relatively other vibrios cause of disease detection technique and other cause of disease detection technique, this method has several significant advantages: at first, this method detects very quick, can learn testing result in 3-4 hour, other method then needs 3 days or one more than week at least; Secondly, this method detection sensitivity is high, and the detection lower limit is low to moderate the bacterium about 10, and other method must have the pure culture propagation of certain hour to reach 10
5After just can detect.The present invention can be applied to the detection of several samples; Can detect the situation that cultivated animals is infected by vibrio alginolyticus, also can monitor cause of disease vibrio alginolyticus in the breeding water body environment, can also detect breeding feed and fresh food and polluted by vibrio alginolyticus.
Embodiment
Following example is further to explanation of the present invention, should not be used as limitation of the present invention.
Embodiment 1:
Make the kit of fast detecting vibrio alginolyticus by following prescription:
Reagent A: 0.1M NaCl, 10mM Tris.Cl (pH8.0), 1mM EDTA (pH8.0), 5% Triton X-100
Reagent B:10mg/ml lysozyme, 10mM Tris.Cl (pH8.0)
Reagent C: 5.0 μ l, 10 * PCR Buffer, 0.5 μ l Taq (5U/ μ l), 35.5 μ l ddH
2O
Reagent D: 4.0 μ l dNTP (2.5mM each), 3.0 μ l MgCl
2(25mM),
20pm?VP
01?20pm?VP
02
Reagent E: 50 * TAE
Reagent F: agarose (1%)+ethidium bromide (0.5 μ g/ml)
Detect according to following program:
1. the extraction of sample preparation and DNA: get the about 0.1-0.5 of fish tissue gram, add 400 μ l reagent A in sample, the sterilization toothpick is smashed to pieces, and centrifugal 2 minutes of 12000g abandons supernatant, with 350 μ l reagent A and the 50 μ l reagent B precipitation that suspends again, mixing.Room temperature was placed 5 minutes, 100 ℃ of water-baths 5 minutes.Be cooled to room temperature, centrifugal 10 minutes of 12000g.Get supernatant.Add 800 μ l absolute ethyl alcohols, room temperature was placed 5 minutes, and centrifugal 5 minutes of 12000g thoroughly removes supernatant, and 75% ethanol washs once, allowed ethanol volatilize, and precipitation is dissolved in 30 μ l sterilization distilled water, was DNA extraction liquid.
2. the specific fragment of marine alga vibrios amplification
In a pipe reagent C, add 1 μ l DNA extraction liquid, add 8 μ l reagent D again, centrifugal 30 seconds of 10000g.On PCR thermal cycle reaction instrument, carry out following reaction:
94 ℃ of heat denatured 4 minutes; Unwind 1 minute at 95 ℃ then, 58 ℃ of renaturation 1 minute, 72 ℃ were extended 1 minute, and circulated altogether 35 times; Stop reaction after 10 minutes 72 ℃ of insulations.
3. electrophoresis and color developing detection: reaction is got 5-10 μ l reactant liquor after finishing, and mixes with 4 μ l, 0.25% bromophenol blue, use 1% agarose gel electrophoresis, and ultraviolet light detects down, if the band of a 300bp is arranged, interpret sample has vibrio alginolyticus infection or pollution; Otherwise then do not have.
Embodiment 2:
Press the various solution of following formulated:
Reagent A: 0.3M NaCl, 10mM Tris.Cl (pH8.0), 1mM EDTA (pH8.0),
Reagent B:5mg/ml lysozyme, 10mM Tris.Cl (pH8.0)
Reagent C: 2.5 μ l, 10 * PCR Buffer, 0.25 μ l Taq (5U/ul), 35.5 μ l ddH
2O
Reagent D: 2.0 μ l dNTP (2.5mM each), 1.5 μ l MgCl
2(25mM),
10pm?VP
01(0.5μl)，10pm?VP
02(0.5μl)
Reagent E:: 50 * TAE
Reagent F: agarose (1.2%)+ethidium bromide (0.8 μ g/ml)
Operate according to following program:
1. the extraction of sample preparation and DNA
Get the about 0.1-0.5 of fish tissue gram, add 200 μ l reagent A in sample, the sterilization toothpick is smashed to pieces, and centrifugal 2 minutes of 12000g abandons supernatant, with 150 μ l reagent A and the 50 μ l reagent B precipitation that suspends again, mixing.Room temperature was placed 5 minutes, 100 ℃ of water-baths 1 minute.Be cooled to room temperature, centrifugal 10 minutes of 12000g.Get supernatant, add 400 μ l absolute ethyl alcohols, room temperature was placed 5 minutes, and centrifugal 5 minutes of 12000g thoroughly removes supernatant, and 75% ethanol washs once, allowed ethanol volatilize, and precipitation is dissolved in 30 μ l sterilization distilled water, was DNA extraction liquid.
2. the specific fragment of vibrio alginolyticus amplification
In a pipe reagent C, add 1 μ l DNA extraction liquid, add 8 μ l reagent D again, centrifugal 30 seconds of 10000g.On PCR thermal cycle reaction instrument, carry out following reaction:
94 ℃ of heat denatured 3 minutes; Unwind for 45 seconds at 95 ℃ then, in 58 ℃ of 30 seconds of renaturation, 72 ℃ were extended for 30 seconds, circulate altogether 30 times; Stop reaction after 10 minutes 72 ℃ of insulations.
3. electrophoresis and color developing detection: reaction is got 5-10 μ l reactant liquor after finishing, and mixes with 4 μ l, 0.25% bromophenol blue, use 1% agarose gel electrophoresis, and ultraviolet light detects down, if the band of a 300bp is arranged, interpret sample has vibrio alginolyticus infection or pollution; Otherwise then do not have.
Claims (4)
1. the kit of a fast detecting vibrio alginolyticus is characterized in that solvent comprises:
(a) DNA extraction reagent: contain buffer reagent A and cell cracking agent B,
Reagent A contains NaCl, trihydroxy methyl aminomethane, ethylenediamine tetraacetic acid and triton x-100, and their concentration is respectively: 0.1-0.3M, 1-100mM pH8.0,0.1-10mM pH8.0 and 0-20%;
Reagent B contains lysozyme and trihydroxy methyl aminomethane, and concentration is respectively 1-10mg/ml and 1-100mMpH8.0;
(b) PCR reaction reagent: comprise reaction premix reagent C and reaction primer reagent D,
Reagent C contains 10 times of PCR reaction buffers, hot polymerization synthase and sterilization distilled water, and content is respectively 2.5-5.0 μ l, a 0.5-2.5 unit and 18-35.5 μ l;
Reagent D: comprise that special primer is to VP
01And VP
02, dNTP and MgCl
2, content is respectively 0.2-1 μ M and 0.2-1 μ M, 20-200 μ M and 0.5-10mM;
(c) electrophoresis and chromogenic reagent comprise reagent E and reagent F,
Reagent E: be 50 times of electrophoretic buffers, contain trihydroxy methyl aminomethane-acetate and ethylenediamine tetraacetic acid, concentration is respectively 0.04M and 0.001M;
Reagent F:0.8-2% agarose and 0.5-20 μ g/ml ethidium bromide.
2. according to the kit of a kind of fast detecting vibrio alginolyticus described in the claim 1, it is characterized in that the special primer VP in the reagent D
01Refer in particular to 5 ' ATTGAGAACCCGACAGAAGCGAAG; VP
02Refer in particular to 5 ' CCTAATGCGGTGATCAGTGTTACTPCR.
3. according to the kit of a kind of fast detecting vibrio alginolyticus described in the claim 1, the optimization formula that it is characterized in that every tube reaction reagent is 10 times of PCR reaction buffers of 5.0 μ l, 2.5 unit hot polymerization synthase, the 35.5 μ l distilled water of sterilizing, 4.0 μ l 2.5mM dNTP, 3.0 μ l 25mM MgCl
2, 10pm VP
01, 10pm VP
02
4. the use method of surveying the inspection vibrio alginolyticus fast according to the kit of the fast detecting vibrio alginolyticus described in the claim 1 comprises the following steps: successively
(a). sample preparation: get 0.1-0.5 gram sample, with 100-400 μ l reagent A suspended sample, and with the abundant mixing of sample; The centrifugal 2-5 of 10000-12000g minute, abandon supernatant;
(b) .DNA extracts: with the 100-300 μ l reagent A precipitation that suspends once more, and adding 20-100 μ l reagent B mixing, room temperature was placed more than 2 minutes, was incubated 1-10 minute again in boiling water bath, and cell is broken fully, discharged DNA; The centrifugal 8-10 of 10000-12000g minute, get supernatant and add the absolute ethyl alcohol deposit D NA that 2 times of supernatant volumes are 400-800 μ l; Room temperature was placed 5-10 minute, the centrifugal 3-8 of 10000-12000g minute; Remove supernatant, 75% ethanol washs once, allows ethanol thoroughly volatilize, and precipitation is dissolved in the 10-50 μ l sterilization distilled water; Be DNA extraction liquid;
(c) .PCR amplification: the DNA that extracts with 0.5-1 μ l is as the template of pcr amplification; Getting 21-42 μ l reagent C mixes with 4-8 μ l reagent D; On thermal cycler, the dna profiling that extracts is increased, unwind 2-5 minute by 94 ℃-98 ℃; Used 93-95 ℃ of sex change then 30 seconds-1 minute, 54-58 ℃ of renaturation 30 seconds-1 minute, 72 ℃ were extended 30 seconds-1.5 minutes, so circulated 25-35 time, were incubated 8-12 minute at 72 ℃ at last, and the specific fragment of vibrio alginolyticus is increased to 10
8More than the mol;
(d). electrophoresis and color developing detection: get the sample after 5-10 μ l increases, mix with 2-6 μ l 0.25% bromophenol blue, 0.8-1.2% agarose electrophoresis and colour developing, under ultraviolet light, detect the band whether one 300 nucleotide pair is arranged, if the band of a 300bp is arranged, interpret sample has vibrio alginolyticus to infect or pollutes, otherwise does not then have.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011301279A CN1142291C (en) | 2001-12-27 | 2001-12-27 | Reagent kit and method for quickly detecting alga-dissolving vibrio |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011301279A CN1142291C (en) | 2001-12-27 | 2001-12-27 | Reagent kit and method for quickly detecting alga-dissolving vibrio |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1373358A true CN1373358A (en) | 2002-10-09 |
| CN1142291C CN1142291C (en) | 2004-03-17 |
Family
ID=4669754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB011301279A Expired - Fee Related CN1142291C (en) | 2001-12-27 | 2001-12-27 | Reagent kit and method for quickly detecting alga-dissolving vibrio |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1142291C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100419087C (en) * | 2006-10-19 | 2008-09-17 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting vibrio alginolyticus |
| CN1791667B (en) * | 2003-05-09 | 2010-04-28 | 韩国海洋研究院 | Red pigment originated from Hahella chejuensis, having algalcidal effect |
| CN101928769B (en) * | 2009-09-29 | 2012-07-04 | 大连水产学院 | PCR specific amplification primer for quick detection of vibrio alginnolyficus based on SCAR molecular marker and detection kit |
| CN108384869A (en) * | 2018-05-18 | 2018-08-10 | 福州大学 | The multiple PCR primer group and detection method and kit of four kinds of morbid vibrios of detection simultaneously |
-
2001
- 2001-12-27 CN CNB011301279A patent/CN1142291C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1791667B (en) * | 2003-05-09 | 2010-04-28 | 韩国海洋研究院 | Red pigment originated from Hahella chejuensis, having algalcidal effect |
| CN100419087C (en) * | 2006-10-19 | 2008-09-17 | 天津市水产研究所 | Primer sequence and detecting reagent kit for detecting vibrio alginolyticus |
| CN101928769B (en) * | 2009-09-29 | 2012-07-04 | 大连水产学院 | PCR specific amplification primer for quick detection of vibrio alginnolyficus based on SCAR molecular marker and detection kit |
| CN108384869A (en) * | 2018-05-18 | 2018-08-10 | 福州大学 | The multiple PCR primer group and detection method and kit of four kinds of morbid vibrios of detection simultaneously |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1142291C (en) | 2004-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tarr et al. | Identification of Vibrio isolates by a multiplex PCR assay and rpoB sequence determination | |
| Litaker et al. | IDENTIFICATION OF PFIESTERIA PISCICIDA (DINOPHYCEAE) AND PFIESTERIA‐LIKE ORGANISMS USING INTERNAL TRANSCRIBED SPACER‐SPECIFIC PCR ASSAYS 1 | |
| CN103993007B (en) | The simple and easy method of a kind of high efficiency extraction DNA from pedotheque | |
| CN101225440B (en) | Detection method of leptospira | |
| CN107988405B (en) | PCR detection kit for Salmonella indiana and non-diagnostic detection method thereof | |
| CN1232653C (en) | Kit for fast test of vibrio harveyi and the test method thereof | |
| CN1142291C (en) | Reagent kit and method for quickly detecting alga-dissolving vibrio | |
| CN101200756A (en) | Reagent kit for rapid detection of vibrio harveyi and detection method thereof | |
| Antonov et al. | Molecular identification and typing of Burkholderia pseudomallei and Burkholderia mallei: when is enough enough? | |
| CN1232654C (en) | Reagent kit for quick test of vibrio vulnificus and the test method thereof | |
| CN1506468A (en) | PCR test kit for hygrophilous aeromonad and its test method | |
| Carlsgart et al. | Multiplex PCR on single unembryonated Ascaris (roundworm) eggs | |
| CN1166783C (en) | Reagent kit and process for quickly detecting schwann's bacterial of alga | |
| CN1286988C (en) | Quantitative PCR detecting kit and method for detecting vibrio parahaemolyticus thereof | |
| Mackie et al. | Experimental parameters affecting quantitative PCR of Artemia franciscana: a model for a marine zooplanktonic target in natural plankton samples | |
| CN1614396A (en) | Special primer probe and detection for nematode of pine | |
| CN101691613B (en) | Primer group for detecting vibrio coralliilyticus by using LAMP, quick diagnosis kit and detecting method | |
| RU2698651C1 (en) | Method for determination of hydrobionts saprobity for assessment of ecological state of water bodies | |
| CN100487134C (en) | Reagent kit and detection method for quickly detecting shark vibrio | |
| CN101805788B (en) | PCR specific amplified primer for fast detection of vibrio parahaemolyticus based on SCAR molecular markers and detection kit | |
| Petrisor et al. | Microbial forensics | |
| CN1277124C (en) | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof | |
| CN101200757A (en) | Rapid detection reagent kit for human great pathogen-comma bacillus and detection method thereof | |
| CN100572561C (en) | One pipe method half-nest type PCR detection reagent and detection method of Vibrio vulnificus | |
| CN1279180C (en) | PCR detection method for eel vibrio |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20040317 Termination date: 20151227 |
|
| EXPY | Termination of patent right or utility model |