CN1277124C - PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof - Google Patents
PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof Download PDFInfo
- Publication number
- CN1277124C CN1277124C CN 03133939 CN03133939A CN1277124C CN 1277124 C CN1277124 C CN 1277124C CN 03133939 CN03133939 CN 03133939 CN 03133939 A CN03133939 A CN 03133939A CN 1277124 C CN1277124 C CN 1277124C
- Authority
- CN
- China
- Prior art keywords
- reagent
- sample
- pcr
- minutes
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention discloses a PCR rapid detection reagent kit and a detection method for pathogenic vibrio anguillarum. The present invention comprises a PCR detection reagent kit and a set of detection operation procedures, wherein the PCR detection reagent kit is composed of a buffer reagent A, cell disruption reagents B and C, a PCR reagent pipe, a Taq enzyme, common agar sugar, an ethidium bromide solution and a bromophenol blue sampling buffer solution. The present invention has the advantages that multiple PCR reaction is established; pathogenic vibrio anguillarum in a sample can be rapidly, accurately and sensitively detected; the simple, rapid and accurate method is provided for the disease diagnoses of aquiculture animals. The present invention can also be used for monitoring the quality of culturing water and feed.
Description
Technical field
The invention belongs to PCR quick detection kit and the detection method thereof of the pathogenic Vibrio anguillarum of the diagnostic techniques of aquatic animal disease, particularly cultivated animals.
Technical background
Vibrios is the member of ocean water environment microecosystem, extensively exists in seawater and sea life.Vibrio pathogen can cause the epiphytotics outburst of aquaculture organism, causes death.Vibrio anguillarum is that wherein a kind of very important vibrios venereal disease is former, can cause that exanthemv, the human body of cultured fishes is hemorrhage and dead, endangers very huge.For the detection method of pathogenic Vibrio anguillarum, mainly contain Physiology and biochemistry authenticate technology, fluorescent antibody technics, enzyme linked immunosorbent assay and 16srRNA gene probe hybridization technique at present.But there are some shortcoming and defect in these methods.The Physiology and biochemistry detection technique extremely takes time and effort, and unstable result; Fluorescent antibody technics needs expensive instrument and equipment; Enzyme-linked immunosorbent assay susceptibility is not high, also is subject to the influence of disturbing factor; The 16srRNA gene is very conservative in living species, so 16srRNA gene probe hybridization technique specificity is not strong.PCR is a kind of target DNA method for quick with susceptibility height, high specificity, contains a spot of bacterium in the sample and just can detect.Yet, adopt the PCR kit that the fast detecting of Vibrio anguillarum is not appeared in the newspapers at present.
Summary of the invention
The PCR quick detection kit and the detection method thereof that the purpose of this invention is to provide a kind of pathogenic Vibrio anguillarum.
Technical solution of the present invention is as follows:
The PCR quick detection kit of pathogenic Vibrio anguillarum, comprise provide two pairs to the special primer of pathogenic Vibrio anguillarum DNA to 1 and 2, primer is to 3 and 4, and provide a kind of this kit that uses to survey the method for pathogenic Vibrio anguillarum in inspection and the monitoring several samples fast, with accurate, the standardization that realizes pathogenic Vibrio anguillarum is detected, provide the foundation of science for healthy aquaculture.
Cardinal principle of the present invention is: reagent A, B and C carry out cracking with the bacterium in the sample, discharge DNA of bacteria, PCR reagent pipe contains polymerase chain reaction reagent, by adding compositions such as pathogenic vibrio anguillarum specific dna fragmentation primer and Tag enzyme, the DNA that sample is discharged carries out specific amplification.Because our primer of design is peculiar by pathogenic Vibrio anguillarum, therefore, if contain pathogenic Vibrio anguillarum in the sample, the specific fragment of its DNA is after the process amplification so, and concentration will reach 10
8More than the mol (grammol), behind electrophoresis and ethidium bromide staining, ultraviolet light detects the purpose band that just can detect certain molecular weight.If there is not Vibrio anguillarum, the purpose band of the same molecular weight that then can not increase.
The prescription of the PCR kit of wherein said fast detecting Vibrio anguillarum is as follows:
(1) DNA extraction reagent: contain buffer reagent A, cell cracking agent B and C;
Reagent A: pH is 8.0, contains trihydroxy methyl aminomethane (Tris), ethylenediamine tetraacetic acid (EDTA), and their concentration is respectively 10~50mM, 1~10mM;
Reagent B:pH is 8.0, contains proteinase, trihydroxy methyl aminomethane (Tris), ethylenediamine tetraacetic acid (EDTA), and their concentration is respectively 1~10mg/ml, 10~50mM, 1~10mM;
Reagent C: contain hexadecyl trimethyl ammonium bromide (CTAB), sodium chloride, concentration is respectively 1~10g/ml, 5~10M;
(2) PCR reagent pipe composition is: 2.5~5.0 μ l, 10 * buffer (10 * buffer is the buffer solution A of 10 times of concentration), 2.0~4.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 25mM 2.0~4.0 μ l MgCl
2, primer is to 10 μ M, 0.5~1 μ l primer 1 and 10 μ M, 0.5~1 μ l primer 2, and primer is to 20 μ M, 0.5~1 μ l primer 3 and 20 μ M, 0.5~1 μ l primer, 4,14~31 μ l sterilization deionized water;
(3) Taq enzyme 5~10 μ l, 3U/ μ l;
(4) plain agar sugar 1~1.2g; Can be mixed with 1~1.2% working concentration;
(5) 5~10 μ g/ μ l ethidium bromide solutions 0.5~1.0ml can prepare the working concentration that becomes 0.5~1.0 μ g/ml;
(6) 0.25~0.75% (g/ml) bromophenol blue sample-loading buffer 30~100 μ l;
Described primer to 1 and 2, primer is dna fragmentations to 3 and 4, base sequence is respectively 5 ' TTCATGTACCGACGCGAGT3 ' and 5 ' AAGATTTGAAAATGTCGCTC3 ', 5 ' CGTATTTCATTCAGATAGTGA3 ' and 5 ' GTGGGTACTGATTGCGTAG3 ';
The best composition of described PCR reagent is 5.0 μ l, 10 * buffer, 3U/ul 1.0ul Taq enzyme, 4.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 25mM4.0 μ l MgCl
2, 10 μ M, 1 μ l primer, 1,10 μ M, 1 μ l primer 2,20 μ M, 1 μ l primer 3 and 20 μ M1 μ l primers, 4,31 μ l sterilization deionized water.
The detection method of the PCR kit of employing fast detecting Vibrio anguillarum is as follows:
(1) sample preparation: get 0.1~0.5g or 0.1~0.5ml sample, 100~400 μ l reagent A suspended sample, and with the abundant mixing of sample; Centrifugal 2~5 minutes of 10000~12000g;
(2) DNA extraction: abandon supernatant, suspend with 100~200 μ l reagent A and precipitate, add 20~50 μ l reagent B again, or get supernatant, add 20~50 μ l reagent B; In 55~65 ℃ of baths, be incubated 5~10 minutes, add 10~50 μ l reagent C again; Be incubated 5~10 minutes in 55~65 ℃ of baths, centrifugal 8~10 minutes of 10000~12000g gets supernatant and adds the absolute ethyl alcohol deposit D NA of 2 times of supernatant volumes; Room temperature was placed 5~10 minutes, centrifugal 5~10 minutes of 10000-12000g; Remove supernatant, 70~75% ethanol washing precipitations 1~2 time allow ethanol thoroughly volatilize, and precipitation is dissolved in 10~50 μ l sterilization distilled water, are DNA extraction liquid, and 2~8 ℃ of preservations are standby;
(3) multiplex PCR amplification
The DNA extraction liquid that in a PCR reagent pipe, adds 0.5~1 μ l, 0.5~1.0 μ l 3U/ μ l Taq enzyme, 3000~5000g centrifugal 2~5 second mixing, put the PCR instrument and increase; 94~96 ℃ were unwind 2~5 minutes, and 94~96 ℃ of sex change are 40 seconds~1 minute then, 55~60 ℃ of renaturation 30 seconds~1 minute, and 72 ℃ were extended 40 seconds~1 minute, so circulated 25~35 times, and last 72 ℃ were extended 6~10 minutes;
(4) pcr amplification product analysis
Get the sample after 5~10 μ l increase, mix with 2-6 μ l 0.25~0.75% bromophenol blue sample-loading buffer, in containing 1.0~1.2% the agarose that ethidium bromide concentration is 0.5~1.0ug/ml, carry out electrophoresis and dyeing, under the ultraviolet transmissive lamp, observe, if sample well has 422bp and 300bp nucleic acid band, interpret sample has pathogenic Vibrio anguillarum to infect or pollutes, otherwise does not then have.
The present invention has following advantage:
The present invention is at the design special primer and successfully set up on the basis of multiplex PCR detection technique of pathogenic Vibrio anguillarum, further be developed into simple responsive fast PCR detection kit, compare with other vibrios cause of disease detection technique and other cause of disease detection technique, the outstanding feature of the inventive method is: 1) detect very quick, can learn testing result in 3-6 hour, other method then needs 24 hours or one more than week at least; 2) detection sensitivity is high, and the detection lower limit is low to moderate the bacterium about 10-100, and other method just can detect after must reaching 105 bacteriums through the pure culture propagation of certain hour; 3) can be applied to the detection of several samples, as: can detect the situation that cultivated animals is infected by Vibrio anguillarum, also can monitor Vibrio anguillarum in the breeding water body environment, can also detect breeding feed and fresh food and polluted by Vibrio anguillarum.
Embodiment
The present invention is described in further detail below in conjunction with specific embodiment, but not as limitation of the present invention.
Embodiment 1
Make the kit of fast detecting Vibrio anguillarum by following prescription:
Reagent A: pH is 8.0, contains 10mMTris, 1mM EDTA;
Reagent B:pH is 8.0, contains 10mg/ml proteinase, 10mMTris, 1mM EDTA;
Reagent C: contain 10g/ml CTAB, 5M sodium chloride;
PCR reagent pipe composition is: 5.0 μ l, 10 * buffer, 4.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 25mM 4.0 μ l MgCl
2, 10 μ M, 1 μ l primer, 1,10 μ M, 1 μ l primer 2,20 μ M, 1 μ l primer, 3,20 μ M, 1 μ l primer, 4, the 31 μ l deionized water of sterilizing;
Taq enzyme 10 μ l, 3U/ μ l;
(6) plain agar sugar 1.2g;
(7) 10 μ g/ μ l ethidium bromide solution 0.5ml;
(8) 0.25% bromjophenol blue sample-loading buffers 100 μ l.
Detect according to following program:
(1) sample preparation: get 0.5g fish tissue, with 400 μ l reagent A suspended sample, fully homogenate, centrifugal 5 minutes of 12000g;
(2) DNA extraction: abandon supernatant, suspend with 200 μ l reagent A and precipitate, add 50 μ l reagent B, insulation is 10 minutes in 65 ℃ of baths, adds reagent C 50 μ l again, and insulation is 10 minutes in 65 ℃ of baths, centrifugal 10 minutes of 12000g gets supernatant and adds the absolute ethyl alcohol deposit D NA of 600 μ l; Room temperature was placed 5 minutes, and centrifugal 5 minutes of 12000g removes supernatant, and 70% ethanol washing 2 times allows ethanol thoroughly volatilize, and precipitation is dissolved in the 30 μ l sterilization distilled water, was DNA extraction liquid, and 4 ℃ of preservations are standby;
(3) pcr amplification
In a PCR reagent pipe, add 1 μ l DNA extraction liquid, 1.0 μ l 3U/ul Taq enzymes, 3000g centrifugal 5 second mixing, putting the PCR instrument increases: 96 ℃ were unwind 5 minutes, 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, 72 ℃ were extended 40 seconds, so circulated 30 times, and last 72 ℃ were extended 6 minutes;
(4) amplified production analysis
Get the sample after 6 μ l increase, mix with 3 μ l, 0.25% bromophenol blue sample-loading buffer, in containing 1.0% the agarose that ethidium bromide concentration is 0.5ug/ml, carry out electrophoresis and dyeing, under the ultraviolet transmissive lamp, observe, if sample well has 422bp and 300bp nucleic acid band, interpret sample has pathogenic Vibrio anguillarum to infect or pollutes, otherwise does not then have.
Wherein: electrophoresis liquid composition, electrophoresis method and colouring method reference molecule cloning experimentation guide (second edition), p307, p309-313, p314.
Embodiment 2
Make the kit of fast detecting Vibrio anguillarum by following prescription:
Reagent A: pH is 8.0, contains 25mMTris, 5mM EDTA;
Reagent B:pH is 8.0, contains 5mg/ml proteinase, 25mMTris, 5mM EDTA;
Reagent C: 5g/ml CTAB, 7.5M sodium chloride;
PCR reagent pipe composition is: 2.5 μ l, 10 * buffer, 2.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 25mM 2.0 μ l MgCl
2, 10 μ M, 0.5 μ l primer, 1,10 μ M, 0.5 μ l primer 2,20 μ M, 0.5 μ l primer, 3,20 μ M, 0.5 μ l primer, 4, the 15 μ l deionized water of sterilizing;
(5) Taq enzyme 5 μ l, 3U/ μ l;
(6) plain agar sugar 1.0g;
(7) 5 μ g/ μ l ethidium bromide solution 1.0ml;
(8) 0.5% bromjophenol blue sample-loading buffers 50 μ l.
Detect according to following program:
(1) sample preparation: get 0.5g bait, with 200 μ l reagent A suspended sample, fully homogenate, centrifugal 3 minutes of 11000g;
(2) DNA extraction: abandon supernatant, suspend with 100 μ l reagent A and precipitate, add 30 μ l reagent B, insulation is 8 minutes in 60 ℃ of baths, adds reagent C 20 μ l again, and insulation is 8 minutes in 60 ℃ of baths, centrifugal 8 minutes of 12000g gets supernatant and adds the absolute ethyl alcohol deposit D NA of 300ul; Room temperature was placed 8 minutes, and centrifugal 8 minutes of 12000g removes supernatant, and 70% ethanol washing 2 times allows ethanol thoroughly volatilize, and precipitation is dissolved in the 50 μ l sterilization distilled water, was DNA extraction liquid, and 8 ℃ of preservations are standby;
(3) multiplex PCR amplification
In a PCR reagent pipe, add 1 μ l DNA extraction liquid, 1.0 μ l 3U/ μ l Taq enzyme, 4000g centrifugal 3 second mixing, put the PCR instrument and increase, 96 ℃ were unwind 5 minutes, and 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, 72 ℃ were extended 40 seconds, so circulated 30 times, and last 72 ℃ were extended 6 minutes;
(4) amplified production analysis
Get the sample after 10 μ l increase, mix with 5 μ l, 0.5% bromophenol blue sample-loading buffer, in containing 1.0% the agarose that ethidium bromide concentration is 0.8ug/ml, carry out electrophoresis and dyeing, under the ultraviolet transmissive lamp, observe, if sample well has 422bp and 300bp nucleic acid band, interpret sample has Vibrio anguillarum to infect or pollutes, otherwise does not then have.
Embodiment 3
Make the kit of fast detecting Vibrio anguillarum by following prescription:
(1) reagent A: pH 8.0 contains 50mMTris, 10mM EDTA;
(2) reagent B:pH 8.0, contain 8mg/ml proteinase, 50mMTris, 10mM EDTA;
(3) reagent C: 1g/ml CTAB, 10M sodium chloride;
(4) PCR reagent pipe composition is: 5.0 μ l, 10 * buffer, 4.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 25mM 4.0 μ l MgCl
2, 10 μ M, 1 μ l primer, 1,10 μ M, 1 μ l primer 2,20 μ M, 1 μ l primer, 3,20 μ M, 1 μ l primer, 4, the 31 μ l deionized water of sterilizing;
(5) Taq enzyme 8 μ l, 3U/ μ l;
(6) plain agar sugar 1.1g;
(7) 8 μ g/ μ l ethidium bromide solution 0.8ml;
(8) 0.75% bromjophenol blue sample-loading buffers 30 μ l.
Detect according to following program:
(1) sample preparation: get the 0.1ml water sample, with 100 μ l reagent A, abundant mixing, centrifugal 2 minutes of 10000g;
(2) DNA extraction: get supernatant, add 50 μ l reagent B, insulation is 5 minutes in 55 ℃ of baths, adds reagent C 50 μ l again, and insulation is 5 minutes in 55 ℃ of baths, and centrifugal 5 minutes of 12000g gets supernatant and adds the absolute ethyl alcohol deposit D NA of 400ul; Room temperature was placed 10 minutes, and centrifugal 10 minutes of 12000g removes supernatant, and 75% ethanol washing 1 time allows ethanol thoroughly volatilize, and precipitation is dissolved in the 20 μ l sterilization distilled water, was DNA extraction liquid, and 2 ℃ of preservations are standby;
(3) multiplex PCR amplification
In a PCR reagent pipe, add 1 μ lDNA extract, 1.0 μ l 3U/ μ l Taq enzymes, 5000g centrifugal 2 second mixing, putting the PCR instrument increases: 96 ℃ were unwind 5 minutes, 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, 72 ℃ were extended 40 seconds, so circulated 30 times, and last 72 ℃ were extended 6 minutes;
(4) amplified production analysis
Get the sample after 10 μ l increase, mix with 2 μ l, 0.75% bromophenol blue sample-loading buffer, in containing 1.1% the agarose that ethidium bromide concentration is 1.0ug/ml, carry out electrophoresis and dyeing, under the ultraviolet transmissive lamp, observe, if sample well has 422bp and 300bp nucleic acid band, interpret sample has Vibrio anguillarum to infect or pollutes, otherwise does not then have.
Claims (2)
1. the PCR quick detection kit of a pathogenic Vibrio anguillarum comprises:
1) DNA extraction reagent: contain buffer reagent A, cell cracking agent B and C;
Reagent A: pH is 8.0, contains trihydroxy methyl aminomethane, ethylenediamine tetraacetic acid, and their concentration is respectively 10~50mM, 1~10mM;
Reagent B:pH is 8.0, contains proteinase, trihydroxy methyl aminomethane, ethylenediamine tetraacetic acid, and their concentration is respectively 1~10mg/ml, 10~50mM, 1~10mM;
Reagent C: contain hexadecyl trimethyl ammonium bromide, sodium chloride, concentration is respectively 1~10g/ml, 5~10M;
2) PCR reagent pipe composition is: 2.5~5.0 μ l10 * buffer, 2.0~4.0 μ l dNTP (dATP, dTTP, dCTP, the potpourri of dGTP, every kind of concentration 2.5mM), 2 5mM, 2.0~4.0 μ l MgCl
2, primer is to 10 μ M, 0.5~1 μ l primer 1 and 10 μ M, 0.5~1 μ l primer 2, and primer is to 20 μ M, 0.5~1 μ l primer 3 and 20 μ M, 0.5~1 μ l primer, 4,14~31 μ l sterilization deionized water;
3) Taq enzyme 5~10 μ l, 3U/ μ l;
4) plain agar sugar 1~1.2g can be mixed with 1~1.2% working concentration;
5) 5~10 μ g/ μ l ethidium bromide solutions, 0.5~1.0ml can prepare the working concentration that becomes 0.5~1.0 μ g/ml;
6) 0.25~0.75% (g/ml) bromophenol blue sample-loading buffer, 30~100 μ l;
It is characterized in that: described primer to 1 and 2, primer is dna fragmentations to 3 and 4, base sequence is respectively 5 ' TTCATGTACCGACGCGAGT3 ' and 5 ' AAGATTTGAAAATGTCGCTC3 ', 5 ' CGTATTTCATTCAGATAGTGA3 ' and 5 ' GTGGGTACTGATTGCGTAG3 '.
2. detection method of using the PCR quick detection kit of pathogenic Vibrio anguillarum is characterized in that trace routine is as follows:
1) sample preparation: get 0.1~0.5g or 0.1~0.5ml sample, with 100~400 μ l reagent A suspended sample, and with the abundant mixing of sample; Centrifugal 2~5 minutes of 10000~12000g;
2) DNA extraction: abandon supernatant, suspend with 100~200 μ l reagent A and precipitate, add 20~50 μ l reagent B again, or get supernatant, add 20~50 μ l reagent B; In 55~65 ℃ of baths, be incubated 5~10 minutes, add 10~50 μ l reagent C again; Be incubated 5~10 minutes in 55~65 ℃ of baths, centrifugal 8~10 minutes of 10000~12000g gets supernatant and adds the absolute ethyl alcohol deposit D NA of 2 times of supernatant volumes; Room temperature was placed 5~10 minutes, centrifugal 5~10 minutes of 10000~12000g; Remove supernatant, 70~75% ethanol washing precipitations 1~2 time allow ethanol thoroughly volatilize, and precipitation is dissolved in 10~50 μ l sterilization distilled water, are DNA extraction liquid, and 2~8 ℃ of preservations are standby;
3) multiplex PCR amplification
The DNA extraction liquid that in a PCR reagent pipe, adds 0.5~1 μ l, 0.5~1.0 μ l 3U/ μ l Taq enzyme, 3000~5000g centrifugal 2~5 second mixing, put the PCR instrument and increase; 94~96 ℃ were unwind 2~5 minutes, and 94~96 ℃ of sex change are 40 seconds~1 minute then, 55~60 ℃ of renaturation 30 seconds~1 minute, and 72 ℃ were extended 40 seconds~1 minute, so circulated 25~35 times, and last 72 ℃ were extended 6~10 minutes;
4) pcr amplification product analysis
Get the sample after 5~10 μ l increase, mix with 2~6 μ l, 0.2 5~0.75% bromophenol blue sample-loading buffer, in containing 1.0~1.2% the agarose that ethidium bromide concentration is 0.5~1.0ug/ml, carry out electrophoresis and dyeing, under the ultraviolet transmissive lamp, observe, if sample well has 422bp and 300bp nucleic acid band, interpret sample has pathogenic Vibrio anguillarum to infect or pollutes, otherwise does not then have.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 03133939 CN1277124C (en) | 2003-09-10 | 2003-09-10 | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 03133939 CN1277124C (en) | 2003-09-10 | 2003-09-10 | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1595155A CN1595155A (en) | 2005-03-16 |
CN1277124C true CN1277124C (en) | 2006-09-27 |
Family
ID=34658909
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 03133939 Expired - Fee Related CN1277124C (en) | 2003-09-10 | 2003-09-10 | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1277124C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
TWI406950B (en) * | 2008-12-22 | 2013-09-01 | Of Animal And Plant Health Inspection And Quarantine Council Of Agriculture Bureau | Primer pair, method and kit for detecting infection in fish |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100457921C (en) * | 2005-04-27 | 2009-02-04 | 陈立志 | Method for detecting gene of foul foot of cattle and sheep, and detecting kit |
-
2003
- 2003-09-10 CN CN 03133939 patent/CN1277124C/en not_active Expired - Fee Related
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
TWI406950B (en) * | 2008-12-22 | 2013-09-01 | Of Animal And Plant Health Inspection And Quarantine Council Of Agriculture Bureau | Primer pair, method and kit for detecting infection in fish |
Also Published As
Publication number | Publication date |
---|---|
CN1595155A (en) | 2005-03-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101475986B (en) | Chip for gene detection of multiple vibrios at the same time, and detection and use thereof | |
Jin et al. | A real-time LAMP-based dual-sample microfluidic chip for rapid and simultaneous detection of multiple waterborne pathogenic bacteria from coastal waters | |
CN1730664A (en) | Bacteria sum quick-speed detecting reagent kit and filtration cuvette using in detecting device | |
CN1506468A (en) | PCR test kit for hygrophilous aeromonad and its test method | |
CN107988405B (en) | PCR detection kit for Salmonella indiana and non-diagnostic detection method thereof | |
CN103468806A (en) | Quick detection method for scallop pathogenic vibrio splendidus | |
CN1277124C (en) | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof | |
CN1186459C (en) | Mandarin fish infectious splenorenal necrosis virogene diagnostic kit and detecting method thereof | |
CN1188531C (en) | Prawn white spot complex virogene diagnostic kit and detecting method thereof | |
CN1279180C (en) | PCR detection method for eel vibrio | |
CN1232653C (en) | Kit for fast test of vibrio harveyi and the test method thereof | |
CN1180092C (en) | Rockfish viral nerve necrosis virogene diagnostic kit and detecting method thereof | |
CN1169968C (en) | Nucleic acid molecular hybridization detection method for silkworm nosema disease | |
CN1142291C (en) | Reagent kit and method for quickly detecting alga-dissolving vibrio | |
CN1676613A (en) | Quantitative PCR detecting kit and method for detecting vibrio parahaemolyticus thereof | |
CN1614396A (en) | Special primer probe and detection for nematode of pine | |
CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
CN1232654C (en) | Reagent kit for quick test of vibrio vulnificus and the test method thereof | |
CN100572561C (en) | One pipe method half-nest type PCR detection reagent and detection method of Vibrio vulnificus | |
CN1824805A (en) | Process for testing bacteria gene chip in sewage | |
CN1286986C (en) | Method for fast detecting colibacillus in drinking water | |
CN1177062C (en) | Chinese-medicine Fritillaria-thunbergii ploymerase chain reaction appraising trigger and appraising method | |
CN1166783C (en) | Reagent kit and process for quickly detecting schwann's bacterial of alga | |
CN1974788A (en) | Reagent kit for fast detection of diarrhea causing colibacillus PCR in milk and its prepn process | |
CN1974785A (en) | Reagent kit for fast detection of vibrio proteolyticus and its detection process |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20060927 Termination date: 20120910 |