CN1974788A - Reagent kit for fast detection of diarrhea causing colibacillus PCR in milk and its prepn process - Google Patents
Reagent kit for fast detection of diarrhea causing colibacillus PCR in milk and its prepn process Download PDFInfo
- Publication number
- CN1974788A CN1974788A CNA2005101273401A CN200510127340A CN1974788A CN 1974788 A CN1974788 A CN 1974788A CN A2005101273401 A CNA2005101273401 A CN A2005101273401A CN 200510127340 A CN200510127340 A CN 200510127340A CN 1974788 A CN1974788 A CN 1974788A
- Authority
- CN
- China
- Prior art keywords
- primer
- dna
- pcr
- liquid
- adsorption column
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind of fast PCR detecting reagent kit for diarrhea causing colibacillus in milk and its preparation process. The reagent kit includes 10xPCR buffer 5.0 microliter, 10 mM dNTP 1.0 microliter, 25 mM MgCl2 3.0 microliter, primer P1(eaeA, ipaH, ST) of ultimate concentration 1, 0.5 and 1 microM separately 1.0 microliter each, primer P2(eaeA, ipaH, ST) of ultimate concentration 1, 0.5, 1 microM separately 1.0 microliter each, DNA template 5.0 microliter, ddH2O 29.5 microliter, and TaqDNA polymerase (5U/Ll) 0.5 microliter; is 50.0 microliter totally. PCR process include pre-denaturation at 95 deg.c for 5min,denaturation at 94 deg.c for 40 s, annealing at 51.3 deg.c for 40 s, extending at 72 deg.c for 1min; repeating for 30 cycles; and extending at 72 deg.c for 10 min. The present invention has fast detection speed, high detectable rate, high sensitivity and other advantages.
Description
(1) technical field
What the present invention relates to is a kind of biological monitoring technology.
(2) background technology
Colon bacillus is popular facultative anaerobe, colonizes in human colon position, is the representative microbial that one hour inherent gi tract of baby due are settled down.Thereafter, colon bacillus usually and its host keep symbiotic relationship.Colon bacillus under normal circumstances is limited in the narrow enteron aisle not pathogenic, but as the host during overtired or immunity degradation, or when the normal gastrointestinal tract wall is destroyed.So that normal " optimum " colon bacillus strain also can cause infection.Lapactic colon bacillus is one of pathogenic bacteria that causes infectious diarrhea.At present, virulence factor according to Lapactic colon bacillus, pathogenesis and Genetic Control thereof, in the world it being divided into five classes---the pathogenic colon bacillus of intestines (EPEC), enterohemorrhagic colon bacillus (EHEC), intestines aggressive colon bacillus (EIEC), enterotoxigenic colon bacillus (ETEC), intestines concentration colon bacillus (EAggEC), wherein the ETEC bacterial strain causes diarrhoea by the effect of LT and ST Disease-causing gene.These bacterial strains can only be expressed LT.Or only express ST, or the two is all expressed.The reference culture that adopts 44247 (ETEC, O in this experiment
6: K
15: H
16) only contained ST by people such as Jav Sarantuya report.EPEC classifies a kind of important diarrhoea intestinal bacteria that cause that developing country has been linked together with infantile diarrhea, and it is pathogenic relevant with the eaeA virulence gene on the LEE pathogenicity island.The invasion and attack mechanism of EIEC is to study the most clearly, and its aggressive causes because of having the aggressive plasmid, contain ipaH toxin Ji Gang on the aggressive plasmid.The isolated culture positive rate of these several diarrhea causing colibacillus is low in the detection food that adopts at present.And waste time and energy, need several time-of-weeks just can report the result.The polymerase chain reaction that development in recent years is got up (PCR) detection technique has the proving time of minimizing, the simple advantage of method, for colibacillary rapid detection provides powerful measure, but does not still have the method that detects several diarrhea pathogens simultaneously at present.
(3) summary of the invention
The object of the present invention is to provide and a kind ofly design primer with ST, eaeA, ipaH toxin gene for goal gene respectively.Use increase the simultaneously virulence gene of main pathogenic colon bacillus EPEC, EIEC and ETEC of multiplex PCR, set up reagent kit for fast detection of diarrhea causing colibacillus PCR in a kind of milk.
The object of the present invention is achieved like this:
The composition of multiple PCR fast detection kit comprises:
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCI
3 3.0μl
Dna profiling 5.0 μ l
ddH
2O 29.5μl
Taq archaeal dna polymerase (5U/L1) 0.5 μ l
Total 50.0μl
Detection kit of the present invention can also comprise some features like this:
1, the concentration of described primer is:
| Kind | Primer P1 | Primer P2 |
| eaeA ipaH ST | 50.0μM 25.0μM 50.0μM | 50.0μM 25.0μM 50.0μM |
2, described template DNA is that sample or (ETEC, EPEC and EIEC) reference culture mixture are inoculated in LB respectively, i.e. 10% peptone, 5% yeast extract, 10% sodium-chlor are in the liquid nutrient medium of pH7.5.200rpm/min, 37 ± 1 ℃ of shaking tables are cultivated 2.5h, the DNA that takes cracking process or kit method to extract.
3, the PCR reaction conditions is: 95 ℃ of 5min; 94 ℃ of 40S, 51.3 ℃ of 40S, 72 ℃ of 1min circulate 30 times, and 72 ℃ are extended 1Omin again.
Detection kit of the present invention is to adopt such method to prepare:
1, the bacterium that increases of bacterium is cultivated
ETEC, EPEC and EIEC reference culture are inoculated in LB respectively, i.e. 10% peptone, 5% yeast extract, 10% sodium-chlor, in the liquid nutrient medium of pH7.5,37 ℃ of incubated overnight.
2, the extraction of template DNA and quantitative
Take cracking process or kit method extraction DNA, use the light absorption value that ultraviolet-visible pectrophotometer detects DNA, wash quartz colorimetric utensil 4 times with deionized water earlier, the former DNA that extracts is diluted 60 times with deionized water.The cuvette of 3000 μ l deionized waters is put into instrument to be read null value and does reference.The DNA liquid of dilution after 60 times joined go up machine testing in the quartz colorimetric utensil, according to formula: nucleic acid (μ g/ml)=62.9 * A
260-36 * A
280Calculate DNA concentration: the bacterium liquid of incubated overnight is done 10 times increase progressively dilution, select 2-3 suitable extent of dilution.Draw this extent of dilution 1ml diluent in the sterilization plate.Each extent of dilution is made two plates, in time cold to 46 ℃ nutrient agar is injected plate 10-15ml, simultaneously the nutrient agar impouring is added with in the sterilization plate of 1ml diluent and makes blank, treat that agar solidifies after, upset is dull and stereotyped.Put and cultivate 48 ± 2h in 36 ± 1 ℃ of incubators, detect total number of bacterial colony mensuration (GB4789.2-94) according to The People's Republic of China's national standard food microbiology and carry out enumeration;
3, primer design and synthetic
Primer sequence, expanding fragment length:
| Toxin gene | Primer | Primer sequence (5 '-3 ') | Product length (bp) | Annealing temperature |
| eaeA ipaH ST | P1：E1 P2：E2 P1：I1 P2：I2 P1：S1 P2：S2 | CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG GTTCCTTGACCGCCTTTCCGATACCGTC GCCGGTCAGCCACCCTCTGAGAGTAC TTAATAGCACCCGGTACAAGCAGG CCTGACTCTTCAAAAGAGAAAATTAC | 881 619 147 | 52℃ 52℃ 51.3℃ |
4, set up single PCR reaction system
PCR is reflected in the 0.5ml Eppendorf pipe and carries out, and adopts 50 μ l reaction systems, and each reacted constituent is:
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCI
3 3.0μl
Primer P1 1.0 μ l
Primer P2 1.0 μ l
Dna profiling 5.0 μ l
ddH2O 33.5μl
TaqDNA polysaccharase (5U/Ll) 0.5 μ l
Total 50.0μl
Primer concentration is:
| Kind | Primer P1 | Primer P2 |
| eaeA ipaH ST | 50.0μM 25.0μM 50.0μM | 50.0μM 25.0μM 50.0μM |
5, multi-PRC reaction condition of the present invention is:
95 ℃ of pre-sex change 5min; 94 ℃ of sex change 40s, 51.3 ℃ of annealing 40s, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.
Getting 0.5ml milk sample during use is added in the 4.5ml LB liquid nutrient medium, 200rpm/min, 37 ± 1 ℃ of shaking tables are cultivated 2.5h, get 36 μ l LB nutrient solutions, join in the 1.5ml centrifuge tube, at the 10 * TE that adds 4 μ l and 2 * Proteinase K of 60 μ l, 56 ℃ of metal bath 90min, 95 ℃ of water-bath 10min, 10, the centrifugal 1min of 000 * g, get supernatant and do template, make sample ,-20 ℃ of preservations are standby.According to the composition of PCR quick detection kit reaction system, that is: 10 * PCRbuffer, 5.0 μ l; 10mMdNTP 1.0 μ l; 25mM MgCl
23.0 μ l; Each 1.0 μ l of primer P1; Each 1.0 μ l of primer P2; Dna profiling 5.0 μ l; TaqDNA polysaccharase (5U/Ll) 0.5 μ l, all the other add to the reaction cumulative volume with ultrapure water is 50.0 μ l.Carry out pcr amplification, 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 40s, 51.3 ℃ of annealing 40s, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.Carrying out the result again judges: 50 * TAE electrophoretic buffer 20ml is added distilled water be diluted to 1000ml (1 * TAE) is stand-by, 14ml 1 * TAE damping fluid is in triangular flask, add 3.5g agarose heating for dissolving, be chilled to back adding ethidium bromide (0.5 μ g/ml) 0.5 μ l about 50 ℃, on the ready electrophoresis flat board of people, add 1 * TAE damping fluid in the electrophoresis chamber, get the PCR end product and add tetrabromophenol sulfonphthalein point sample 110V electrophoresis 25min in 5: 1 ratio, take out on the ultraviolet transilluminator that places 300nm then and observe, sample appearance and the reddish orange fluorescence band of positive control on same level attitude are promptly positive, otherwise negative.
Principle of the present invention is:
Cause rushing down property E.coli and cause diarrhoea, cause a disease by LT and ST Disease-causing gene as the ETEC bacterial strain by Disease-causing gene own.These bacterial strains can only be expressed LT, or only express ST, or the two is all expressed.EaeA virulence gene on the pathogenic and LEE pathogenicity island of EPEC is relevant.The invasion and attack mechanism of EIEC is to study the most clearly, and its aggressive causes because of having the aggressive plasmid, contain the ipaH toxin gene on the aggressive plasmid.The present invention designs primer with ST, eaeA, ipaH toxin gene for goal gene respectively, carries out pcr amplification, prove that this thrihydrid is specific to corresponding pathogenic bacterium, and susceptibility is very high.So, use in primary first-order equation, increase the simultaneously virulence gene of main pathogenic colon bacillus EPEC, EIEC and ETEC of multiple PCR technique, to set up the pcr amplification method of diarrheagenic E. coli in a kind of rapid detection milk.
The present invention is that pathogenic colon bacillus (EPEC), enterotoxigenic escherichia coli (ETEC) and intestines aggressive E.coli (EIEC) carry out gene test research to diarrhoea pathogenic colon bacillus common in the milk, having set up quick sample handles and multiplex polymerase chain re-action (PCR) diagnostic method, the Disease-causing genes of this three kinds of bacterium simultaneously increases in PCR reaction: the ipaH toxin gene on the aggressive plasmid of the ST gene of ETEC, the eaeA virulence gene of EPEC and EIEC, set up the pcr amplification method of diarrhea causing colibacillus in a kind of rapid detection milk.
Gordian technique of the present invention is to set up a kind of quick sample and handles and multiplex polymerase chain re-action (PCR) diagnostic method.The present invention compares with isolated culture commonly used at present and has the following advantages:
1. quick: present method detects whole process required time and comprises sample pre-treatments 3h, and pcr amplification needs 3.5h, and agarose electrophoresis is observed needs 0.5h, and whole process only needs about 7 hours.Common live bacterial count and biochemical isolation and identification method are about 2 weeks consuming time.
2. recall rate height: existing diagnostic serum does not comprise the serum type of all diarrhea causing colibacillus, can not detectedly but carry causing of toxin gene and rushes down type E.coli but the detection by toxin gene can detect diagnostic serum.This evidence, serology macroscopic agglutination, the pathogenic test positive strain of animal all can detect with multiple PGR method and contain toxin gene, and filter out in biochemical identification, also find to contain the isolated strains that carries toxin gene in serology macroscopic agglutination feminine gender, the doubtful bacterium of the pathogenic test male of animal E.coli.Illustrate that this law verification and measurement ratio is higher than common culture method.
3. highly sensitive present method sensitivity: EPEC, EIEC, ETEC are respectively 4.3 * 10
3, 1.5 * 10
3, 2.6 * 10
4CFU/m is lower than national standard 1 * 10
5CFU/ml.
(4) embodiment
For example the present invention is done in more detail below and describes:
The foundation of the single PCR detection method of 1 intestinal bacteria ETEC, EPEC and EIEC
1.1 the bacterium that increases of bacterium is cultivated
Reference culture: 44247 (ETEC, O
6: K
15: H
16), 44706 (EPEC), 44350 (EIEC) are inoculated in LB (10% peptone available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute respectively with ETEC, EPEC and EIEC reference culture, 5% yeast extract, 10% sodium-chlor, pH7.5) in the liquid nutrient medium, 37 ℃ of incubated overnight.
1.2 the extraction of template DNA and quantitative
1.2.1 cracking process extracts DNA
With 36 μ l LB incubated overnight liquid, add 4 μ l (10 * TE) liquid and 60 μ l (2 * Proteinase K).56 ℃ of water-bath 90min, 95 ℃ of water-bath 10min again, the centrifugal 1min of 10,000 * g gets supernatant and does template, and-20 ℃ of preservations are standby.
1.2.2 kit method extracts DNA
The little extraction reagent kit of DNA plasmid is produced for Time Technology company limited by sky, Beijing.
(1) get in the bacterium liquid adding centrifuge tube of 1～5ml incubated overnight, 13, the centrifugal 1min of 000rpm/min absorbs supernatant as far as possible;
(2) in the centrifuge tube that leaves bacterial sediment, add 250 μ l solution P1, use pipettor or the vortex vibrator bacterial cell precipitation that thoroughly suspends.
(3) in centrifuge tube, add 250 μ l solution P2, leniently spin upside down and make the abundant cracking of thalline for 6～8 times.In centrifuge tube, add 350 μ l solution P3, leniently spin upside down immediately 6～8 times, fully mixing.13, the centrifugal 10min of 000rpm/min transfers to supernatant in another clean centrifuge tube with pipettor.
(4) previous step gained supernatant liquor is added among the adsorption column CB3, adsorption column is put into collection tube, and room temperature is placed 1～2min, and 13, centrifugal 30～60 seconds of 000rpm/min outwells the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.
(5) in adsorption column CB3, add 700 μ l rinsing liquid PW, 13, centrifugal 30～60 seconds of 000rpm/min outwells the waste liquid in the collection tube, will inhale firm post and relay in the recovery collector.
(6) in adsorption column CB3, add 500 μ l rinsing liquid PW, 13, centrifugal 30～60 seconds of 000rpm/min discards the waste liquid in the collection tube.
(7) adsorption column CB3 is relay reclaim in the collector and place 13, the centrifugal 2min of 000rpm/min eliminates liquid with remaining floating in the adsorption column and removes.
(8) adsorption column CB3 is placed room temperature or 50 ℃ of incubators placed several minutes, with rinsing liquid remaining in the thorough airing sorbing material.
(9) adsorption column CB3 is placed a clean centrifuge tube, to the unsettled elution buffer TE that resets and add 50～100 μ l through 65～70 ℃ of water-bath preheatings in the middle part of adsorption film, room temperature is placed 2min, and 13,000rpm/min is centrifugal, and 1min collects plasmid solution in the centrifuge tube.
1.2.3DNA quantitatively
(1) the ultraviolet-visible pectrophotometer method is carried out the light absorption value that DNA quantitative Application Spectrun-756P type ultraviolet-visible pectrophotometer detects DNA.Earlier wash quartz colorimetric utensil 4 times with deionized water.The former DNA that extracts is diluted 60 times with deionized water.The cuvette of 3000 μ l deionized waters is put into instrument to be read null value and does reference.DNA liquid after diluting 60 times is joined last machine testing in the quartz colorimetric utensil.According to formula:
Nucleic acid (μ g/ml)=62.9 * A
260-36 * A
280Calculate DNA concentration
[5]
(2) bacterial concentration (CFU) that calculates LB liquid nutrient medium incubated overnight bacterium liquid is done 10 times with the bacterium liquid of incubated overnight and is increased progressively dilution, selects 2～3 suitable extent of dilution, draws this extent of dilution 1ml diluent in the plate of sterilizing, and each extent of dilution is made two plates.In time cold to 46 ℃ nutrient agar is injected the about 15ml of plate, and the rotation plate makes and mixes.Simultaneously the nutrient agar impouring is added with in the sterilization plate of 1ml diluent and makes blank.After treating that agar solidifies, upset is dull and stereotyped, puts and cultivates 48 ± 2h in 36 ± 1 ℃ of incubators.Detect total number of bacterial colony mensuration (GB4789.2-94) according to The People's Republic of China's national standard food microbiology and carry out enumeration.
1.3 primer design is with synthetic
Carry out eaeA, ipaH and ST design of primers, each primer is synthetic by precious Imtech.Primer sequence, expanding fragment length:
| Toxin gene | Primer | Primer sequence (5 '-3 ') | Product length (bp) | Annealing temperature |
| eaeA ipaH ST | P1：E1 P2：E2 P1：I1 P2：I2 P1：S1 P2：S2 | CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG GTTCCTTGACCGCCTTTCCGATACCGTC GCCGGTCAGCCACCCTCTGAGAGTAC TTAATAGCACCCGGTACAAGCAGG CCTGACTCTTCAAAAGAGAAAATTAC | 881 619 147 | 52℃ 52℃ 51.3℃ |
1.4PCR reaction system
PCR is reflected in the 0.5ml Eppendorf pipe and carries out, and adopts 50 μ l reaction systems, and each reacted constituent is:
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCI
3 3.0μl
Primer P1 1.0 μ l
Primer P2 1.0 μ l
Dna profiling 5.0 μ l
ddH2O 33.5μl
TaqDNA polysaccharase (5U/Ll) 0.5 μ l
Total 50.0μl
Primer concentration:
| Kind | Primer P1 | Primer P2 |
| eaeA ipaH ST | 50.0μM 25.0μM 50.0μM | 50.0μM 25.0μM 50.0μM |
1.5PCR reaction conditions
Adopt the reaction of heat lid, carry out circulating reaction by following temperature condition: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 52 ℃ of annealing 1min, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.
1.6 the agarose gel electrophoresis of PCR product is identified
Adopt conventional agarose gel electrophoresis to carry out electrophoresis.Sepharose concentration is 2.5%, contains ethidium bromide 0.25 μ g/ml, and damping fluid is 1 * TAE, with observations under the row ultraviolet lamp about 110V weighing apparatus piezoelectricity swimming 20min.
1.7 specific fragment glue reclaims
The PCR product is carried out electrophoresis in 1% sepharose, under ultraviolet scanner, downcut specific fragment, reclaim test kit with rich day glue and carry out the glue recovery.
1.8 the clone of PCR product and evaluation
In miniature centrifuge tube, add following solution:
pMD
18-18T Veceor 0.5μl
Control Insert DNA 4.5μl
Ligation Solution 5.0μl
Total 100.0μl
14 ℃～16 ℃ reaction 30min.(Dh5 a) to take out the intestinal bacteria competence from-70 ℃ of refrigerators.Be placed on and make it on ice slowly to melt, add the connection product of 10 μ l, mix gently with the Tip head of precooling.Be put in static 30min on ice.42 ℃ of water-bath 90S are put in cooled on ice 2～4min.Add 200 μ l liquid LB, 37 ℃ of shaking table incubation 1h.Add X-gal (20mg/ml) 35 μ l after the taking-up.IPTG(100mmol)33μl。At Amp
+Be coated with bacterium on (60 μ g/ml) LB solid agar plate.Put to be inverted in 37 ℃ of thermostat containers and cultivate 12～16h.Take out flat board next day and put into 4 ℃ of refrigerator colour developings.The picking white colony shakes bacterium.The plasmid DNA of using in the intestinal bacteria of the little extraction reagent kit extraction of plasmid conversion back is done template, carries out PCR and identifies.
1.9 PCR atopic sequencing fragment
Be sent to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and check order being defined as recombinating, transform successful plasmid, with the toxin gene of having reported for work among sequencing result and the NCBI [
Gi|2809547|gb|AF043226.1|,
Gi|24080789|gb|AE005674.1|,
Gi|148029|gb|M29255.1|ECOTOXHS] sequence carries out the homology comparative analysis.
Judge the specificity of PCR product.
1.10 PCR susceptibility experiment
Standard bacterium to the LB incubated overnight carries out enumeration, surveys the light absorption value that extracts DNA with ultraviolet-visible pectrophotometer, calculates its concentration, and PCR susceptibility experiments experiment is carried out in doubly dilution then.
2, the optimization of the structure of multiplex PCR and reaction conditions
2.1 multi-PRC reaction system
10×PCR buffer 5.0μl
10mM dNTP 1.Oμl
25mM MgCI
3 3.0μl
Dna profiling 5.0 μ l
ddH
2O 29.5μl
Taq archaeal dna polymerase (5U/L1) 0.5 μ l
Total 50.0μl
The explanation of multiple PCR primer concentration
| Kind | Primer P1 | Primer P2 |
| eaeA ipaH ST | 50.0μM 25.0μM 50.0μM | 50.0μM 25.0μM 50.0μM |
2.2 multi-PRC reaction condition
95 ℃ of pre-sex change 5min; 94 ℃ of sex change 40s, 51.3 ℃ of annealing 40s, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.
Claims (7)
1, diarrheagenic E. coli PCR quick detection kit in a kind of milk, it is characterized in that: its composition comprises:
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCl
2 3.0μl
Dna profiling is that LB cultivates the DNA 5.0 μ l that bacterium liquid extracts
ddH
2O 29.5μl
Taq archaeal dna polymerase (5U/L1) 0.5 μ l
Total 50.0μl
2, diarrheagenic E. coli PCR quick detection kit in the milk according to claim 1, it is characterized in that: the concentration of described primer is:
Kind Primer P1 Primer P2
eaeA ipaH ST 50.0μM 25.0μM 50.0μM 50.0μM 25.0μM 50.0μM
3, diarrheagenic E. coli PCR quick detection kit in the milk according to claim 1 and 2, it is characterized in that: described LB cultivates the DNA that bacterium liquid extracts, be that sample or the reference culture of making positive control are inoculated in LB respectively, i.e. 10% peptone, 5% yeast extract, 10% sodium-chlor, in the liquid nutrient medium of pH7.5,200rpm/min, 37 ± 1 ℃ of shaking tables are cultivated 2.5h, the DNA that takes cracking process or kit method to extract.
4, diarrheagenic E. coli PCR quick detection kit in the milk according to claim 1 and 2, it is characterized in that: the PCR reaction conditions is: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 40s, 51.3 ℃ of annealing 40s, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.
5, the preparation method of diarrheagenic E. coli PCR quick detection kit in a kind of milk is characterized in that:
(1), the bacterium that increases of bacterium is cultivated
ETEC, EPEC and EIEC reference culture are inoculated in LB respectively, i.e. 10% peptone, 5% yeast extract, 10% sodium-chlor, in the liquid nutrient medium of pH7.5,37 ℃ of incubated overnight.
(2), the extraction of template DNA and quantitative
Take cracking process or kit method to extract DNA; Use the light absorption value that ultraviolet-visible pectrophotometer detects DNA, earlier wash quartz colorimetric utensil 4 times with deionized water, the former DNA that extracts is diluted 60 times with deionized water, the cuvette of 3000 μ l deionized waters is put into instrument to be read null value and does reference, the DNA liquid of dilution after 60 times joined go up machine testing in the quartz colorimetric utensil, according to formula: nucleic acid (μ g/ml)=62.9 * A
260-36 * A
280Calculate DNA concentration; The bacterium liquid of incubated overnight is done 10 times increase progressively dilution, select 2-3 suitable extent of dilution, draw this extent of dilution 1ml diluent in the sterilization plate, each extent of dilution is made two plates, in time cold to 46 ℃ nutrient agar is injected plate 10～15ml, simultaneously the nutrient agar impouring is added with in the sterilization plate of 1ml diluent and makes blank, after treating that agar solidifies, upset is dull and stereotyped, put and cultivate 48 ± 2h in 36 ± 1 ℃ of incubators, detect total number of bacterial colony mensuration (GB4789.2-94) according to The People's Republic of China's national standard food microbiology and carry out enumeration;
(3), primer design and synthetic
Primer sequence, expanding fragment length:
Toxin gene Primer Primer sequence (5 '-3 ') Product length (bp) Annealing temperature
eaeA ipaH ST P1：E1 P2：E2 P1：I1 P2：I2 P1：S1 P2：S2 CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG GTTCCTTGACCGCCTTTCCGATACCGTC GCCGGTCAGCCACCCTCTGAGAGTAC TTAATAGCACCCGGTACAAGCAGG CCTGACTCTTCAAAAGAGAAAATTAC 881 619 147 52℃ 52℃ 51.3℃
(4), set up single PCR reaction system
PCR is reflected in the 0.5ml Eppendorf pipe and carries out, and adopts 50 μ l reaction systems, and each reacted constituent is:
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCI
3 33.0μl
Primer P1 1.0 μ l
Primer P2 1.0 μ l
Dna profiling 5.0 μ l
ddH
2O 33.5μl
TaqDNA polysaccharase (5U/L1) 0.5 μ l
Total 50.0μl
Primer concentration is:
Kind Primer P1 Primer P2
eaeA ipaH ST 50.0μM 25.0μM 50.0μM 50.0μM 25.0μM 50.0μM
(5) set up the multiplex PCR method and answer system and reaction conditions
10×PCR buffer 5.0μl
10mM dNTP 1.0μl
25mM MgCl
2 3.0μl
Final concentration each 1,0.5, each 1.0 μ l of 1uM primer P1 (eaeA, ipaH, ST)
Final concentration each 1,0.5, each 1.0 μ l of 1uM primer P2 (eaeA, ipaH, ST)
Dna profiling 5.0 μ l
ddH
2O 29.5μl
TaqDNA polysaccharase (5U/L1) 0.5 μ l
Total 50.0μl
The PCR reaction conditions is: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 40s, 51.3 ℃ of annealing 40s, 72 ℃ are extended 1min, carry out 30 circulations; 72 ℃ are extended 10min.
6, the preparation method of diarrheagenic E. coli PCR quick detection kit in the milk according to claim 4, it is characterized in that: it is with 36 μ l LB incubated overnight liquid that described cracking process extracts DNA, add 4 μ l (10 * TE) liquid and 60 μ l (2 * Proteinase K), 56 ℃ of water-bath 90min, 95 ℃ of water-bath 10min again, the centrifugal 1min of 10,000 * g, get supernatant and do template ,-20 ℃ of preservations.
7, the preparation method of diarrheagenic E. coli PCR quick detection kit in the milk according to claim 4 is characterized in that: described kit method extracts DNA and is:
(1) get in the bacterium liquid adding centrifuge tube of 1～5ml incubated overnight, 13, the centrifugal 1min of 000rpm/min absorbs supernatant as far as possible;
(2) in the centrifuge tube that leaves bacterial sediment, add 250 μ l solution P1, use pipettor or the vortex vibrator bacterial cell precipitation that thoroughly suspends;
(3) in centrifuge tube, add 250 μ l solution P2, leniently spin upside down and make the abundant cracking of thalline for 6～8 times.In centrifuge tube, add 350 μ l solution P3, leniently spin upside down immediately 6～8 times, abundant mixing, 13, the centrifugal 10min of 000rpm/min transfers to supernatant in another clean centrifuge tube with pipettor;
(4) previous step gained supernatant liquor is added among the adsorption column CB3, adsorption column is put into collection tube, and room temperature is placed 1～2min, and 13, centrifugal 30～60 seconds of 000rpm/min outwells the waste liquid in the collection tube, adsorption column is relay reclaim in the collector;
(5) in adsorption column CB3, add 700 μ l rinsing liquid PW, 13, centrifugal 30～60 seconds of 000rpm/min outwells the waste liquid in the collection tube, will inhale firm post and relay in the recovery collector;
(6) in adsorption column CB3, add 500 μ l rinsing liquid PW, 13, centrifugal 30～60 seconds of 000rpm/min discards the waste liquid in the collection tube;
(7) adsorption column CB3 is relay reclaim in the collector and place 13, the centrifugal 2min of 000rpm/min eliminates liquid with remaining floating in the adsorption column and removes;
(8) adsorption column CB3 is placed room temperature or 50 ℃ of incubators placed several minutes, with rinsing liquid remaining in the thorough airing sorbing material;
(9) adsorption column CB3 is placed a clean centrifuge tube, to the unsettled elution buffer TE that resets and add 50～100 μ l through 65～70 ℃ of water-bath preheatings in the middle part of adsorption film, room temperature is placed 2min, and 13,000rpm/min is centrifugal, and 1min collects plasmid solution in the centrifuge tube.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101273401A CN100540679C (en) | 2005-12-16 | 2005-12-16 | Reagent kit for fast detection of diarrhea causing colibacillus PCR and preparation method thereof in the milk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101273401A CN100540679C (en) | 2005-12-16 | 2005-12-16 | Reagent kit for fast detection of diarrhea causing colibacillus PCR and preparation method thereof in the milk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1974788A true CN1974788A (en) | 2007-06-06 |
| CN100540679C CN100540679C (en) | 2009-09-16 |
Family
ID=38125134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101273401A Expired - Fee Related CN100540679C (en) | 2005-12-16 | 2005-12-16 | Reagent kit for fast detection of diarrhea causing colibacillus PCR and preparation method thereof in the milk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100540679C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101186947B (en) * | 2007-12-06 | 2010-11-24 | 中国人民解放军疾病预防控制所 | Multiple PCR detection method for escherichia coli, kit and application thereof |
| CN102605068A (en) * | 2012-03-15 | 2012-07-25 | 深圳市生科源技术有限公司 | Pathogenic escherichia coli assay kit and pathogenic escherichia coli assay method |
| CN107385009A (en) * | 2017-08-21 | 2017-11-24 | 哈尔滨理工大学 | Detection method for bacterial content in milk |
-
2005
- 2005-12-16 CN CNB2005101273401A patent/CN100540679C/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101186947B (en) * | 2007-12-06 | 2010-11-24 | 中国人民解放军疾病预防控制所 | Multiple PCR detection method for escherichia coli, kit and application thereof |
| CN102605068A (en) * | 2012-03-15 | 2012-07-25 | 深圳市生科源技术有限公司 | Pathogenic escherichia coli assay kit and pathogenic escherichia coli assay method |
| CN102605068B (en) * | 2012-03-15 | 2013-09-11 | 深圳市生科源技术有限公司 | Pathogenic escherichia coli assay kit and pathogenic escherichia coli assay method |
| CN107385009A (en) * | 2017-08-21 | 2017-11-24 | 哈尔滨理工大学 | Detection method for bacterial content in milk |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100540679C (en) | 2009-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Salehi et al. | Detection of invA gene in isolated Salmonella from broilers by PCR method | |
| Rodrigues et al. | The Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) identification versus biochemical tests: a study with enterobacteria from a dairy cattle environment | |
| Uchii et al. | Genetic and physiological characterization of the intestinal bacterial microbiota of bluegill (Lepomis macrochirus) with three different feeding habits | |
| CN103898108B (en) | The nucleotide special to vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN111378774B (en) | Primer group, kit and method for rapidly detecting listeria monocytogenes | |
| CN101045943A (en) | Process of PCR detecting salmonella with added amplifying internal standard | |
| CN104046616B (en) | A kind of test kit of DNA rapid extraction from donkey-hide gelatin and extracting method thereof | |
| Xu et al. | Molecular-based environmental risk assessment of three varieties of genetically engineered cows | |
| CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN1974788A (en) | Reagent kit for fast detection of diarrhea causing colibacillus PCR in milk and its prepn process | |
| CN1506468A (en) | PCR test kit for hygrophilous aeromonad and its test method | |
| CN109811073A (en) | Double PCR early stage quickly detects primer and its application of Streptococcusagalactiae and Streptococcus iniae | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| CN1319136A (en) | Genes for detecting bacteria and detection method by using the same | |
| CN1296488C (en) | Detection of main pathogenic microorganism in medicine | |
| CN1279180C (en) | PCR detection method for eel vibrio | |
| D’Rose et al. | Comparative analysis of metagenomic DNA extraction methods from gut microbiota of zebrafish (Danio rerio) for downstream next-generation sequencing | |
| CN105256028A (en) | Specific nucleotides for citrobacter 017 and 039 and application of special nucleotides | |
| Pang et al. | A new method for quantitative detection of Lactobacillus casei based on casx gene and its application | |
| CN1176218C (en) | Universal primer PCR method for immunocapture to detect bacteria | |
| CN108715897A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| Xia et al. | Common specific indigenous bacteria reside in the intestinal tract of Chinese mitten crab (Eriocheir sinensis) | |
| CN108715899A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| CN1277124C (en) | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090916 Termination date: 20101216 |