CN1279180C - PCR detection method for eel vibrio - Google Patents
PCR detection method for eel vibrio Download PDFInfo
- Publication number
- CN1279180C CN1279180C CN 03133940 CN03133940A CN1279180C CN 1279180 C CN1279180 C CN 1279180C CN 03133940 CN03133940 CN 03133940 CN 03133940 A CN03133940 A CN 03133940A CN 1279180 C CN1279180 C CN 1279180C
- Authority
- CN
- China
- Prior art keywords
- pcr
- sample
- reagent
- minutes
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to technology for diagnosing diseases of aquatic animals, particularly to a PCR detection method for the eel vibrio of aquiculture animals. The technology comprises a set of operation procedures such as PCR detection reagent preparation, primary PCR analysis, primary PCR amplification product analysis, etc., wherein the PCR detection reagent is composed of sample processing reagents A and B, a PCR reagent pipe, a Taq enzyme, a comman agar sugar, an ethidium bromide solution and a bromophenol blue sampling buffer solution. The technology additionally has a secondary PCR processing procedure. The present invention is capable of establishing a secondary PCR reaction method on the basis of primary PCR reaction. Moreover, vibrio in a sample can be detected rapidly, accurately and sensitively by the present invention. The present invention provides the simple, rapid and accurate method for the disease diagnoses of aquiculture animals, and can also be used for monitoring the quality of aquiculture water and feed.
Description
Technical field
The invention belongs to the diagnostic techniques of aquatic animal disease, specifically a kind of PCR detection method to the cultivated animals Vibrio anguillarum.
Technical background
Vibrios is the member of ocean water environment microecosystem, extensively exists in seawater and marine organisms.Vibrio pathogen can cause the epiphytotics outburst of aquaculture organism, causes death.Vibrio anguillarum is that wherein a kind of very important vibrios venereal disease is former, can cause that skin ulceration, the human body of cultured fishes is hemorrhage and dead, endangers very huge.For the detection method of pathogenicity bo Vibrio anguillarum, mainly contain Physiology and biochemistry authenticate technology, fluorescent-antibody technique, enzyme linked immunosorbent assay and 16srRNA gene probe hybridization technique at present.But there are some shortcoming and defect in these methods.The Physiology and biochemistry detection technique extremely takes time and effort, and unstable result; Fluorescent-antibody technique needs expensive plant and instrument; Enzyme-linked immunosorbent assay susceptibility is not high, also is subject to the influence of interfering factors; The 16srRNA gene is very conservative in living species, so 16srRNA gene probe hybridization technique specificity is not strong.PCR is a kind of target DNA method for quick with susceptibility height, high specificity, contains a spot of bacterium in the sample and just can detect.Yet, adopt PCR that the detection of Vibrio anguillarum is not appeared in the newspapers at present.
Summary of the invention
The PCR detection method that the purpose of this invention is to provide a kind of Vibrio anguillarum to realize accurate, the stdn detection to Vibrio anguillarum, provides the foundation of science for healthy aquaculture.
To achieve these goals, technical scheme of the present invention is as follows: comprise the following steps:
1) sample preparation:
Get 0.5～1 gram or 0.1～0.5ml sample, with 200～400 μ l reagent A suspended sample, and with the abundant mixing of sample; Centrifugal 2～5 minutes of 10000～12000g;
2) DNA extraction: abandon supernatant,, add 20～100 μ l reagent B mixings again with 100～200 μ l reagent A precipitation that suspends once more; Or get supernatant, and adding 20～100 μ l reagent B mixings again, room temperature was placed 2～10 minutes, was incubated 10～15 minutes again in 55～65 ℃ of baths, and centrifugal 8～10 minutes of 10000～12000g gets supernatant and adds the dehydrated alcohol deposit D NA of 2 times of supernatant volumes; Room temperature was placed 5～10 minutes, centrifugal 5～10 minutes of 10000-12000g; Remove supernatant, 70～75% washing with alcohol 1～2 time allow ethanol thoroughly volatilize, and its precipitation is dissolved in 10～50 μ l sterilization distilled water, are DNA extraction liquid, and 2～8 ℃ of preservations are standby;
3) PCR:
Add the described DNA extraction liquid of 0.5～1 μ l in PCR reagent pipe, every pipe adds Taq enzyme 0.5～1.0 μ l of 2.5 units/ml, 3000～5000g centrifugal 2～5 second mixing, place in the PCR instrument and increase; Unwind 2～5 minutes by 94～96 ℃; 94～96 ℃ of sex change are 40 seconds～1 minute then, 55～60 ℃ of renaturation 30 seconds～1 minute, and 72 ℃ are extended 40s～1 minute, so circulate 25～35 times, and last 72 ℃ were extended 6～10 minutes, and sample must increase;
4) a pcr amplification product analysis
Get the sample after 5～10 μ l increase, mix with 2～6 μ l 0.25% (w/v) tetrabromophenol sulfonphthalein sample-loading buffers, in containing 0.8～1% (w/v) agarose of 0.5～1.0 μ g/ml ethidium bromide, carry out electrophoresis and colour developing, observe under the ultraviolet transmissive lamp, it is the positive that has Vibrio anguillarum to infect or pollute that sample well has a 593bp nucleic acid bar;
To PCR do not occur with the PCR product of sample carry out secondary PCR and handle, be specially: a PCR product 0.5～1 μ l that gets the sample that band do not occur adds PCR reagent pipe, with described step 3) and 4) mode carries out pcr amplification and amplified production analysis, and record sample well the nucleic acid bar of a 593bp being arranged is that Vibrio anguillarum infects or pollute positive; Described reagent A contains sodium-chlor, trihydroxy methyl aminomethane, ethylenediamine tetraacetic acid (EDTA) and triton x-100, and their concentration is respectively 0.1～0.5M, 10～50mM, 1～10mM, 5～10% (v/v); The pH of trihydroxy methyl aminomethane and ethylenediamine tetraacetic acid (EDTA) is 8.0; Described reagent B contains N,O-Diacetylmuramidase and trihydroxy methyl aminomethane, and concentration is respectively 5～10w/v, 10～50mM; The pH of trihydroxy methyl aminomethane is 8.0.
Described PCR reagent pipe composition is 2.5～5.0 μ l, 10 * buffer, 2.0～4.0 μ l dNTP (being the mixture of dTTP, dATP, dCTP, four kinds of Nucleotide of dCTP, every kind of concentration 2.5mM), 2.0～4.0 μ l 25mM MgCl
2, 0.5～1.0 μ l, 20 μ M primers, 1,0.5～1.0 μ l20 μ M primer 2s, 16.5～33 μ l deionized water of sterilizing; The best group of PCR reaction reagent composition becomes 5.0 μ l10 * buffer, 1 μ l, 2.5 units/μ l Taq enzyme, 4.0 μ l dNTP, 4.0 μ l25mM MgCl
2, 1 μ l20 μ m primer, 1,1 μ l, 20 μ m primer 2s, the 33 μ l deionized water of sterilizing; Wherein every kind of nucleotide concentration is 2.5mM among the dNTP; Described primer 1 and primer 2 are respectively to be 5 ' GATCGAGGTACGCGAGTG3 ' and 5 ' TAATGCGGTTGGTATCCACA, 3 ' synthetic dna fragmentation by dna synthesizer by base sequence.
The principle of the invention is: reagent A and B carry out cracking with the bacterium in the sample, discharge DNA of bacteria, PCR reaction reagent pipe contains polymerase chain reaction reagent, by compositions such as vibrio anguillarum specific dna fragmentation primer contained in the reagent pipe and Tag enzymes, the DNA that sample is discharged carries out specific amplification.Because primer of the present invention is peculiar by Vibrio anguillarum, therefore, if contain Vibrio anguillarum in the sample, the specific fragment of its DNA is after the process amplification so, concentration will reach more than the 108mol (mol), behind electrophoresis and ethidium bromide staining, UV-light detects the purpose band that just can detect certain molecular weight.If there is not Vibrio anguillarum, the purpose band of the same molecular weight that then can not increase.
The present invention designs special primer and successfully sets up Vibrio anguillarum PCR detection technique, compares with other vibrios cause of disease detection technique and other cause of disease detection technique, and the present invention has following advantage and positively effect:
1. it is very quick to adopt the inventive method to detect, and can learn detected result in 4～8 hours, and other method then needs 1 day or one more than week at least.
2. adopt the present invention to carry out secondary PCR on the basis of a PCR, can further improve the sensitivity of detection, the detection lower limit is low to moderate the bacterium about 1～10, and other method of prior art must reach 10 through the pure culture propagation of certain hour
5After just can detect.
3. whether the present invention can be applied to the detection of several samples, can detect the situation that cultivated animals is infected by Vibrio anguillarum, also can monitor Vibrio anguillarum in the aquaculture water environment, can also detect feed ingredient and fresh food and polluted by Vibrio anguillarum, is widely used.
Embodiment
The present invention is described in further detail below in conjunction with embodiment, the improper restriction of the present invention of opposing.
Embodiment 1
Detect the reagent of Vibrio anguillarum by following method of completing the square preparation:
(1) reagent A: 0.5M NaCl, 50mM Tris (pH8.0), 10mM EDTA (pH8.0), 10% (ml/ml) TritonX-100;
(2) reagent B:10mg/ml N,O-Diacetylmuramidase, 50mM Tris (pH8.0);
(3) PCR reagent pipe composition: 5.0 μ l, 10 * buffer, 4.0 μ ldNTP (mixture of dTTP, dATP, dCTP, four kinds of Nucleotide of dCTP, every kind of concentration 2.5mM), 4.0 μ l MgCl
2(25mM), 1 μ l primer 1 (20 μ M), 1 μ l primer 2 (20 μ M), the 33 μ l deionized water of sterilizing.
(4) 2.5 units/μ l Taq enzyme;
(5) contain the agarose of 0.8% (g/ml) of 0.5 μ g/ml ethidium bromide;
(6) 0.25% (g/ml) bromjophenol blue sample-loading buffer;
Detect according to following program:
(1) sample preparation: get fish tissue 1 gram, with 400 μ l reagent A suspended sample, homogenizer homogenate, centrifugal 5 minutes of 12000g;
(2) DNA extraction: abandon supernatant,, add 100 μ l reagent B again with the 200 μ l precipitation reagent A that suspends again, room temperature was placed 5 minutes, and insulation is 15 minutes in 65 ℃ of baths, is cooled to room temperature, centrifugal 10 minutes of 12000g gets supernatant and adds the dehydrated alcohol deposit D NA of 600 μ l; Room temperature was placed 5 minutes, centrifugal 5 minutes of 12000g; Remove supernatant, 75% washing with alcohol 2 times allows ethanol thoroughly volatilize, and its precipitation is dissolved in the 20 μ l sterilization distilled water, is DNA extraction liquid, and 8 ℃ of preservations are standby;
(3) PCR
Add the DNA extraction liquid of 1 μ l in PCR reagent pipe, every pipe adds 2.5 units/μ lTaq enzyme 1.0 μ l, 5000g centrifugal 2 second mixing, put the PCR instrument and increase.Unwind 5 minutes by 96 ℃; 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, and 72 ℃ were extended 40 seconds minutes, so circulated 30 times, and last 72 ℃ were extended 6 minutes, and sample must increase.
(4) pcr amplification product analysis
Get the sample after 5 μ l increase, mix with 2 μ l, 0.25% tetrabromophenol sulfonphthalein sample-loading buffer, in the agarose of 0.8% (g/ml) that contain 0.5 μ g/ml ethidium bromide, carry out electrophoresis and colour developing, under the ultraviolet transmissive lamp, observe, if a 593bp nucleic acid band all appears in all samples hole, interpret sample has Vibrio anguillarum to infect or pollutes.
Wherein: electrophoresis liquid composition, electrophoresis method and dyeing process reference molecule cloning experimentation guide (second edition), p307, p309-313, p314.
Embodiment 2
Preparation makes to detect the reagent of Vibrio anguillarum by the following method:
(1) reagent A: 0.1M NaCl, 10mM Tris (pH8.0), 1mM EDTA (pH8.0), 5%tritonX-100;
(2) reagent B:5mg/ml N,O-Diacetylmuramidase, 10mM Tris (pH8.0);
(3) PCR reagent pipe: 5.0 μ l, 10 * buffer, 4.0 μ ldNTP (mixture of dTTP, dATP, dCTP, four kinds of Nucleotide of dCTP, every kind of concentration 2.5mM), 4.0 μ l MgCl
2(25mM), 1 μ l primer 1 (20 μ M), 1 μ l primer 2 (20 μ M), the 33 μ l deionized water of sterilizing.
(4) 2.5U/ μ l Taq enzyme;
(5) contain the agarose of 0.9% (g/ml) of 0.75 μ g/ml ethidium bromide;
(6) 0.25% (g/ml) bromjophenol blue sample-loading buffer.
Detect according to following program:
(1) sample preparation: get bait 0.5 gram, with 200 μ l reagent A suspended sample, fully dissolving, centrifugal 3 minutes of 12000g;
(2) DNA extraction: abandon supernatant,, add 70 μ l reagent B again with the 300 μ l precipitation reagent A that suspends again, room temperature was placed 8 minutes, and insulation is 12 minutes in 60 ℃ of baths, is cooled to room temperature, centrifugal 9 minutes of 12000g gets supernatant and adds the dehydrated alcohol of 740 μ l, deposit D NA; Room temperature was placed 8 minutes, centrifugal 8 minutes of 12000g; Remove supernatant, 75% washing with alcohol 2 times allows ethanol thoroughly volatilize, and its precipitation is dissolved in the 30 μ l sterilization distilled water, is DNA extraction liquid, and 4 ℃ of preservations are standby;
(3) PCR
Add the DNA extraction liquid of 1 μ l in PCR reagent pipe, every pipe adds 2.5 units/μ l Taq enzyme 1.0 μ l, 4000g centrifugal 3 second mixing, put the PCR instrument and increase.Unwind 5 minutes by 96 ℃; 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, and 72 ℃ were extended 40 seconds minutes, so circulated 30 times, and last 72 ℃ were extended 6 minutes, and sample must increase.
(4) pcr amplification product analyses
Get the sample after 8 μ l increase, mix with 4 μ l, 0.25% tetrabromophenol sulfonphthalein sample-loading buffer, in the agarose of 0.9% (g/ml) that contain 0.75 μ g/ml ethidium bromide, carry out electrophoresis and colour developing, under the ultraviolet transmissive lamp, observe, if sample well has a 593bp nucleic acid band, interpret sample has Vibrio anguillarum to infect or pollutes.The PCR product that the sample of band do not occur is used to carry out secondary PCR.
(5) secondary PCR and amplified production analysis
The PCR product 1 μ l that gets the sample that band do not occur adds PCR reagent pipe, carry out pcr amplification and amplified production analysis with above-mentioned step (3) and (4), if sample well has the nucleic acid band of a 593bp, then declaring this sample is that Vibrio anguillarum infects or the pollution positive, otherwise does not then have.
Wherein: electrophoresis liquid composition, electrophoresis method and dyeing process reference molecule cloning experimentation guide (second edition), p307, p309-313, p314.
Embodiment 3
Preparation detects the reagent of Vibrio anguillarum by the following method:
(1) reagent A: 0.25M NaCl, 25mM Tris (pH8.0), 5mM EDTA (pH8.0), 7.5%tritonX-100
(2) reagent B:7.5mg/ml N,O-Diacetylmuramidase, 25mM Tris.C1 (pH8.0)
(3) PCR reagent pipe: 2.5 μ l, 10 * buffer, 2.0 μ ldNTP (mixture of dTTP, dATP, dCTP, four kinds of Nucleotide of dCTP, every kind of concentration 2.5mM), 2.0 μ l MgCl
2(25mM), 0.5 μ l primer 1 (20 μ M), 0.5 μ l primer 2 (20 μ M), the 16 μ l deionized water of sterilizing.
(4) 2.5U/ μ l Taq enzyme;
(5) contain the agarose of 1% (g/ml) of 1 μ g/ml ethidium bromide;
(6) 0.25% (g/ml) bromjophenol blue sample-loading buffer.
Detect according to following program:
(1) sample preparation: water sample 0.1ml adds 200 μ l reagent A, mixing, centrifugal 2 minutes of 10000g;
(2) DNA extraction: get supernatant, add 50 μ l reagent B, mixing, room temperature was placed 10 minutes, insulation is 10 minutes in 55 ℃ of baths, is cooled to room temperature, centrifugal 8 minutes of 12000g, get supernatant and add the dehydrated alcohol deposit D NA of 500 μ l, room temperature was placed 10 minutes, centrifugal 8 minutes of 12000g; Remove supernatant, 75% washing with alcohol 2 times allows ethanol thoroughly volatilize, precipitation is dissolved in the 50 μ l sterilization distilled water, i.e. and DNA extraction liquid, 2 ℃ of preservations are standby;
(3) PCR:
Add the DNA extraction liquid of 1 μ l in PCR reagent pipe, every pipe adds 2.5 units/μ l Taq enzyme 1.0 μ l, 3000g centrifugal 5 second mixing, put the PCR instrument and increase.Unwind 5 minutes by 96 ℃; 96 ℃ of sex change are 1 minute then, 60 ℃ of renaturation 1 minute, and 72 ℃ were extended 1 minute, so circulated 30 times, and last 72 ℃ were extended 6 minutes, and sample must increase.
(4) pcr amplification product analyses:
Get the sample after 10 μ l increase, mix with 5 μ l, 0.25% tetrabromophenol sulfonphthalein sample-loading buffer, in the agarose of 1% (g/ml) that contain 1 μ g/ml ethidium bromide, carry out electrophoresis and colour developing, under the ultraviolet transmissive lamp, observe, if sample well has a 593bp nucleic acid band, interpret sample has Vibrio anguillarum to infect or pollutes.The PCR product that the sample of band do not occur is used to carry out secondary PCR.
(5) secondary PCR and amplified production analysis
The PCR product 1 μ l that gets the sample that band do not occur adds PCR reagent pipe, carry out pcr amplification and amplified production analysis with above-mentioned step (3) and (4), if sample well has the nucleic acid band of a 593bp, then declaring this sample is that Vibrio anguillarum infects or the pollution positive, otherwise does not then have.
Wherein: electrophoresis liquid composition, electrophoresis method and dyeing process reference molecule cloning experimentation guide (second edition), p307, p309-313, p314.
Claims (3)
1. the PCR method of a described detection Vibrio anguillarum is characterized in that comprising the following steps:
1) sample preparation:
Get 0.5～1 gram or 0.1～0.5ml sample, with 200～400 μ l reagent A suspended sample, and with the abundant mixing of sample; Centrifugal 2～5 minutes of 10000～12000g;
2) DNA extraction: abandon supernatant,, add 20～100 μ l reagent B mixings again with 100～200 μ l reagent A precipitation that suspends once more; Or get supernatant, and adding 20～100 μ l reagent B mixings again, room temperature was placed 2～10 minutes, was incubated 10～15 minutes again in 55～65 ℃ of baths, and centrifugal 8～10 minutes of 10000～12000g gets supernatant and adds the dehydrated alcohol deposit D NA of 2 times of supernatant volumes; Room temperature was placed 5～10 minutes, centrifugal 5～10 minutes of 10000-12000g; Remove supernatant, 70～75% washing with alcohol 1～2 time allow ethanol thoroughly volatilize, and its precipitation is dissolved in 10～50 μ l sterilization distilled water, are DNA extraction liquid, and 2～8 ℃ of preservations are standby;
Wherein: reagent A contains sodium-chlor, trihydroxy methyl aminomethane, ethylenediamine tetraacetic acid (EDTA) and triton x-100, and their concentration is respectively 0.1～0.5M, 10～50mM, 1～10mM, 5～10% (v/v); The pH of trihydroxy methyl aminomethane and ethylenediamine tetraacetic acid (EDTA) is 8.0; Reagent B contains N,O-Diacetylmuramidase and trihydroxy methyl aminomethane, and concentration is respectively 5～10w/v, 10～50mM; The pH of trihydroxy methyl aminomethane is 8.0;
3) PCR:
Add the described DNA extraction liquid of 0.5～1 μ l in PCR reagent pipe, every pipe adds Taq enzyme 0.5～1.0 μ l of 2.5 units/ml, 3000～5000g centrifugal 2～5 second mixing, place in the PCR instrument and increase; Unwind 2～5 minutes by 94～96 ℃; 94～96 ℃ of sex change are 40 seconds～1 minute then, 55～60 ℃ of renaturation 30 seconds～1 minute, and 72 ℃ are extended 40s～1 minute, so circulate 25～35 times, and last 72 ℃ were extended 6～10 minutes, and sample must increase;
Wherein: described PCR reagent pipe composition is 2.5～5.0 μ l, 10 * buffer, 2.0～4.0 μ ldNTP (being the mixture of dTTP, dATP, dCTP, four kinds of Nucleotide of dCTP, every kind of concentration 2.5mM), 2.0～4.0 μ l 25mM MgCl
2, 0.5～1.0 μ l20 μ M primer, 1,0.5～1.0 μ l20 μ M primer 2s, 16.5～33 μ l deionized water of sterilizing; Described primer 1 and primer 2 are respectively to be 5 ' GATCGAGGTACGCGAGTG3 ' and 5 ' TAATGCGGTTGGTATCCACA, 3 ' synthetic dna fragmentation by dna synthesizer by base sequence;
4) a pcr amplification product analysis
Get the sample after 5～10 μ l increase, mix with 2～6 μ l 0.25% (w/v) tetrabromophenol sulfonphthalein sample-loading buffers, in containing 0.8～1% (w/v) agarose of 0.5～1.0 μ g/ml ethidium bromide, carry out electrophoresis and colour developing, observe under the ultraviolet transmissive lamp, it is the positive that has Vibrio anguillarum to infect or pollute that sample well has a 593bp nucleic acid bar.
2. according to the described PCR method that detects Vibrio anguillarum of claim 1, it is characterized in that: to PCR do not occur with the PCR product of sample carry out secondary PCR and handle, be specially: a PCR product 0.5～1 μ l that gets the sample that band do not occur adds PCR reagent pipe, with described step 3) and 4) mode carries out pcr amplification and amplified production analysis, and record sample well the nucleic acid bar of a 593bp being arranged is that Vibrio anguillarum infects or pollute positive.
3. according to the PCR method of the described detection of claim 1 Vibrio anguillarum, it is characterized in that: the best group of PCR reaction reagent composition becomes 5.0 μ l10 * buffer, 1 μ l, 2.5 units/μ l Taq enzyme, 4.0 μ l dNTP, 4.0 μ l25mMMgCl
2, 1 μ l20 μ m primer, 1,1 μ l, 20 μ m primer 2s, the 33 μ l deionized water of sterilizing; Wherein every kind of nucleotide concentration is 2.5mM among the dNTP.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03133940 CN1279180C (en) | 2003-09-10 | 2003-09-10 | PCR detection method for eel vibrio |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 03133940 CN1279180C (en) | 2003-09-10 | 2003-09-10 | PCR detection method for eel vibrio |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1594592A CN1594592A (en) | 2005-03-16 |
| CN1279180C true CN1279180C (en) | 2006-10-11 |
Family
ID=34658910
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 03133940 Expired - Fee Related CN1279180C (en) | 2003-09-10 | 2003-09-10 | PCR detection method for eel vibrio |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1279180C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768641B (en) * | 2010-01-19 | 2012-12-26 | 宁波大学 | Primer and probe for LAMP-LFD detecting of listonella anguillarum |
| CN110106178B (en) * | 2019-05-17 | 2023-07-18 | 江苏海洋大学 | DNAzyme for identifying and cutting vibrio anguillarum, screening method and application |
-
2003
- 2003-09-10 CN CN 03133940 patent/CN1279180C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1594592A (en) | 2005-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101475986B (en) | Chip for gene detection of multiple vibrios at the same time, and detection and use thereof | |
| CN107988405B (en) | PCR detection kit for Salmonella indiana and non-diagnostic detection method thereof | |
| Nol et al. | Epizootic hemorrhagic disease outbreak in a captive facility housing white-tailed deer (Odocoileus virginianus), bison (Bison bison), elk (Cervus elaphus), cattle (Bos taurus), and goats (Capra hircus) in Colorado, USA | |
| CN1506468A (en) | PCR test kit for hygrophilous aeromonad and its test method | |
| CN1279180C (en) | PCR detection method for eel vibrio | |
| CN112322754A (en) | Detection primer, detection kit, detection method and application of clonorchis sinensis | |
| CN1186459C (en) | Mandarin fish infectious splenorenal necrosis virogene diagnostic kit and detecting method thereof | |
| CN1286988C (en) | Quantitative PCR detecting kit and method for detecting vibrio parahaemolyticus thereof | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| CN1277124C (en) | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof | |
| CN1180092C (en) | Rockfish viral nerve necrosis virogene diagnostic kit and detecting method thereof | |
| CN1232653C (en) | Kit for fast test of vibrio harveyi and the test method thereof | |
| Chiu et al. | Bacterial Distribution in the Epidermis and Mucus of the Coral Euphyllia glabrescens by CARD-FISH | |
| CN105420383B (en) | A kind of marine bacteria drug resistant gene detection chip and its application | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| CN1614396A (en) | Special primer probe and detection for nematode of pine | |
| CN1142291C (en) | Reagent kit and method for quickly detecting alga-dissolving vibrio | |
| CN1974788A (en) | Reagent kit for fast detection of diarrhea causing colibacillus PCR in milk and its prepn process | |
| Li et al. | Combination of direct boiling and glass beads increases the purity and accuracy of bacterial DNA extraction | |
| CN101067154A (en) | PCR detection method for Marine products crusts hemoparasitic egg dinoflagellate | |
| CN1824805A (en) | Process for testing bacteria gene chip in sewage | |
| CN1232654C (en) | Reagent kit for quick test of vibrio vulnificus and the test method thereof | |
| CN1186460C (en) | Frog virogene diagnostic kit and detecting method thereof | |
| CN1286986C (en) | Method for fast detecting colibacillus in drinking water | |
| KR20040055617A (en) | Oligonucleotide microchip and method for the detection of pathogenic microorganisms using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20061011 Termination date: 20120910 |