CN1169968C - Nucleic acid molecular hybridization detection method for silkworm nosema disease - Google Patents
Nucleic acid molecular hybridization detection method for silkworm nosema disease Download PDFInfo
- Publication number
- CN1169968C CN1169968C CNB011383577A CN01138357A CN1169968C CN 1169968 C CN1169968 C CN 1169968C CN B011383577 A CNB011383577 A CN B011383577A CN 01138357 A CN01138357 A CN 01138357A CN 1169968 C CN1169968 C CN 1169968C
- Authority
- CN
- China
- Prior art keywords
- microlitres
- minutes
- dna
- microlitre
- add
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a nucleic acid molecular hybridization detection method of a silkworm corpuscule disease. The method uses the nucleic acid molecular hybridization technique to extract the DNA of silkworm microsporidian; PCR products are cloned to a recombination carrier plasmid through PCR; an N. B. PCR product is made into a molecular probe after being marked by DIG; the pathogeny spores of the silkworm corpuscule disease are detected by DNA Dot blot. Various microsporidian genomes extracted by the present invention have good quality and high content; designed primers are specific for N. B. spores; the primers and the DNA specificity of a template are highly matched; the detection accurate rate is greater than 98%. The method can carry out rapid, qualitative and quantitative detection in the early stage of silkworm corpuscule pathogeny spores; the present invention is a convenient, effective and accurate detection method.
Description
Technical field:
The present invention relates to the detection method of biological disease, relate in particular to the detection method of insect disease, more specifically relate to a kind of nucleic acid molecular hybridization detection method of pebrine disease.
Background technology:
Pebrine disease (Pebrine disease) is that micropartical spore (Nosema bombycis, be called for short N.B.) is parasitic and the flacherie that causes is a kind of destructive silkworm chronic infectious disease of being with, and silkworm and mulberry production harm seriously and for a long time be can not get radical cure.This disease is popular in extensive range, the diagnoses and treatment difficulty, and the silkworm of once mainly breeding silkworms state for the worlds such as Europe, Japan, China already produces with destructive strike in history.National sick eruption and prevalence such as France, Italy because of nosema bombycis, and collapse after a single setback, therefore the control to pebrine is a global problem.
In recent years, China's pebrine disease incidence trend is gradually serious.As Sichuan Province because of its superior geographical environment and good growing weather condition, big area planting mulberry and breeding silkworm are once sent out kind of an amount and reach more than 800 ten thousand 1994 (being contained Chongqing) that the sericulture amount is maximum, nearly 4,000,000 loads of the amount of cocoon production, rank first in the whole country, only silkworm raiser's cocoon money income just reaches 2,000,000,000 yuan.Existing Sichuan Province (removing a Chongqing) year sericulture also has more than 300 ten thousand, produces more than cocoon 1,600,000 loads, is only second to river, Zhejiang, occupies the 3rd in the whole nation.But because of being subjected to the serious puzzlement of pebrine for many years, the per unit area yield of silk cocoon is low, of poor quality, and annual direct economic loss is more than ten million yuan.It is estimated several the accounting for more than 30% of loss that cause because of flacherie every year.And in silkworm egg production of hybrid seeds process, also do not count because of the super malicious loss of being burnt of silkworm egg micropartical.This low yield year after year is low to be received, the breed enthusiasm of having hit the silkworm raiser greatly, and it is of common occurrence to ruin the mulberry incident.This can't but be a kind of huge waste to superior geography, climate resources like this.Therefore, strengthen the control of pebrine disease has been become the task of top priority of stablizing silkworm and mulberry production.
The route of infection of pebrine disease mainly contain two---and food infects down and germinal infection.Chorion, mulberry leaf, insect, silkworm excrement etc. all may have the micropartical spore, become food infectious source down.Silkworm rearing bed mixes educates that to infect be to cause the infectious important factor of pebrine, mix the time of educating more early endanger big more, raise the dry cleansing degree of environment and wherein micropartical spore quantity how much, be to influence infection rate important factor just.And after 4 to 5 ages, silkworm infected the micropartical spore,, can give birth to by the silkworm seed of micropartical spore contamination though female silkworm can normal development, thereby, cause germinal infection.Cultivate through hatching through the infectious silkworm seed of breeding, provide cause of disease for the silkworm rearing season food infects down again, thereby led to vicious cycle, harm is serious.The micropartical spore has stronger resistibility to environment.As still having the infection pathogenecity in 3 years at the female moth endogenous protective of exsiccant; In water, soak the vigor that still had in 5 months; By foods such as chicken, pigs down, the spore of discharging from its ight soil still has very strong infectivity.When pebrine silkworm and carrier's corpse or its movement etc. are handled without the little spore of going out of strictness, the micropartical spore is external except that will directly infecting to the healthy silkworm that educates altogether, also can pollute sericulture environment such as mulberry leaf, a small bundle of straw and rearing instrument, silkworm room via media such as air, flying dust, flowing water, insects.In addition, the micropartical spore is also more intense to the resistibility of multiple physical chemical factor, and this has just increased difficulty for sericulture environment such as silkworm room, rearing instrument and sick silkworm corpse, excremental little work of going out.So silkworm egg, young silkworm, mulberry leaf and sericulture environment etc. are carried out the detection of micropartical spore, the prevention of pebrine disease and treatment are all had very important effect.
Detection to pebrine mainly contains three kinds of methods at present: observation method of naked eye, microscopic examination method and serodiagnosis method.All there is following shortcoming in these three kinds of methods: length consuming time, sensitivity are low, poor accuracy, can't realize early detection.Simultaneously, the existence of the pathogenic protospore worm of multiple variation has also increased difficulty for traditional pebrine and sporozoan detection method of micropartical, has further reduced the accuracy that detects.Therefore set up a kind of efficient, fast, accurately, the sensitive detection method is extremely urgent.
Summary of the invention:
The objective of the invention is, a kind of nucleic acid molecular hybridization detection method of pebrine disease is provided.This method adopts making nucleic acid molecular hybridization technology, can the nosema bombycis protospore early stage, quick, qualitative, detect quantitatively, be a kind of convenience, efficiently, pebrine disease protospore worm detection method accurately.Can realize to pebrine disease early find, the purpose of prevention, early treatment early.
In order to achieve the above object, the present invention adopts following technical scheme:
Use the making nucleic acid molecular hybridization technology, promptly utilize nucleotide base complementary principle, adopt Proteinase K phenol chloroform extraction method to extract the DNA of nosema bombycis, measure its specific DNA segment, by the PCR reaction, PCR product microsporidium specific DNA sequence is cloned into the promotor pGEN that has the SP6 phage
In-3Z the transfer vector plasmid, through the recombinant plasmid sequential analysis, with nosema bombycis spore (Nosema bombycis, abbreviation N.B.) PCR product (217bp) (is a digoxin through digoxin, Digoxigenin is called for short DIG) mark makes molecular probe, synthetic corresponding primer, preparation nylon Hybond membrane adopts dot blot method (DNA Dot blot) to detect nosema bombycis disease pathogen spore.
The present invention compared with prior art has following advantage:
1) good according to the various microsporidium genome quality that the present invention extracted, content is high;
2) designed primer is peculiar by the N.B. spore, so primer and template DNA specificity be identical, and detects accuracy rate＞98%, invalid hybridization
3) the DIG label probe detects the N.B. microsporidian DNA, and is quick, sensitive, accurate.
Description of drawings:
Fig. 1 is the sample DNA agarose gel electrophoretogram.Wherein 1 is the disease silkworm larva, and 2 are strong silkworm larva (5 age), and 3 are strong bollworm pupa, and 4 are strong silkworm chrysalis, and 5 for being with malicious Pyrausta nubilalis (Hubern). pupa, and 6 for being with malicious silkworm moth, and 7 is the Pyrausta nubilalis (Hubern). ovum.
Fig. 2 is PCR product cloning, recombinant plasmid restriction enzyme mapping.
Fig. 3 differentiates nosema bombycis for the nucleic acid probe dot blot.Wherein 2,25,26 is N.B. spore DNA; 3,4 is the Shandong microsporidian DNA; 5,6 is area, Nanning three-spotted phytometra micropartical spore DNA; 7,8,9 is Guangxi beet armyworm micropartical spore DNA; 10,11,12 is area, Guangzhou, Guangdong microsporidian DNA; 13,14,15,16 is Beijing area Pyrausta nubilalis (Hubern). micropartical spore DNA; 17,18 is small white spore DNA; 19,20 is Sichuan megaspore DNA; 21,22 is tussah spore DNA; 23,24 is silkworm larva DNA.
Embodiment:
Concrete operations step of the present invention is as follows:
The application that the extraction of nosema bombycis DNA → polymerization integrated enzyme reaction (PCR) → PCR product cloning and recombinant plasmid evaluation → recombinant plasmid sequential analysis → DIG label probe are already produced silkworm N.B. spore DNA detection sensitivity evaluation → DIG label probe N.B. spore specific evaluation → DIG label probe.
1, the extraction of nosema bombycis DNA: extract with Proteinase K phenol chloroform extraction method.To add the silkworm that the food microsporidium carries out common nursing and pulverize purification, operate according to the following procedure:
Can reach 7～18 micrograms with this method institute extractive microsporidium genomic dna (Fig. 1) content.
2, polymerization integrated enzyme reaction (Polymerase Chain reaction, be called for short PCR): according to the GenBank Sequence database of American National biotechnology information center (NCBI), obtain the nucleotide sequence that all microparticals of having reported belong to the 16SrRNA gene, according to the synthetic pcr amplification primer of one section 240bp (i.e. 240 base pairs) specific sequence design of 16SrRNA small ylidene gene.Through the following steps operation detection, institute's synthetic PCR product is about 217bp.
5 ' end primer: 5 ' CACGAACCACGGTAATACTTGT 3 '
3 ' end primer: 3 ' GGCAATGGTATCTAATCATCTTC 5 '
2.1 the pcr amplification of primer, operation according to the following steps:
2.1.1 in 0.5 milliliter of centrifuge tube, add following material earlier successively to 50 milliliters of cumulative volumes.
Dd H
2O (distilled water) 30 microlitres, 10 * Taq DNA Polymerase buffer (heat-resisting thymus nucleic acid polymer buffer liquid), 5.0 microlitres, d NTPs (thymus nucleic acid mixture) 5.0 microlitres, 5 ' end primer 2 .0 microlitre, 3 ' end primer 2 .0 microlitre, Template DNA (template DNA) 2.0 microlitres, DMSO (dimethyl sulfoxide (DMSO)) 3.5 microlitres, Taq DNAPolymerase (heat-resisting thymus nucleic acid polymkeric substance) 1.0 microlitres.Afterwards, add the aseptic paraffin oil of 30 microlitres again, centrifugal 10 seconds.
2.1.2 95 ℃ of sex change 5 minutes; By 95 ℃ of sex change of each circulation 1 minute, annealed 1 minute for 50 ℃, 72 ℃ were extended totally 30 circulations 2 minutes; 72 ℃ were extended 10 minutes.After amplification finishes, get 5 microlitre PCR products electrophoresis detection on 1.5% sepharose.
2.2 the PCR product reclaims: with PCR product electrophoresis on 1.5% sepharose, 90 volts, 30～40 minutes, under ultraviolet lamp, will contain the gel cutting-out of amplified production with scalpel, put into 1.5 milliliters centrifuge tube, add 6 mol NaI, 400 microlitres, 55～60 ℃ of water-baths 5 minutes treat that gel melts fully, are placed in the ice ice bath and reduce to 30 ℃, add 1 milliliter of Wizard DNA Clean-upSystem resin, reversing makes solution mix several times, and room temperature was placed 2 minutes, was added in the filtering bolt, drain, the Virahol that adds 2 milliliter 80% again, the impurity on the suction filtration wash-out resin is put into Eppendorf pipe (little plastics tubing) with the strainer that is loaded with resin, 10000 rev/mins dry remaining Virahol (about 2 minutes), again it is transferred in another new Eppendorf pipe, add 65 ℃ of hot water 30 microlitres to strainer, kept 1 minute, 12000 rev/mins centrifugal 20 seconds, liquid is standby in-20 ℃ of preservations in the collection tube.
3, PCR product cloning and recombinant plasmid are identified
The PCR product is connected conversion by following operation, and identify, (Fig. 2) The selection result showed that its cloning efficiency is very high among whether the PCR product of determining 217bp was cloned into plasmid vector.
3.1PCR product connects: at first in 0.5 milliliter of centrifuge tube, add dd H
2O7 microlitre, pcr amplification product 8 microlitres, pGEM
-T Easy Vector 2.0 microlitres, 10 * T4 DNA ligasebuffer (thyroxine dna ligase buffer liquid), 2.0 microlitres: T4 DNA ligase (thyroxine deoxyribonucleic acid ligase) 1 microlitre (3 micrograms/microlitre SABC) mixed the back centrifugal 20 seconds, inserted in 4 ℃ of refrigerators to connect 50 hours.
3.2 the preparation of competent cell: picking one single bacterium colony on the LB of fresh intestinal bacteria (E.coli) DH5a (beef high protein freezes substratum) flat board, be inoculated on 20 milliliters of LB liquid nutrient mediums, 37 ℃, 300 rev/mins of thermal agitations 4 hours are worked as OD
600, under aseptic condition, bacterium is transferred to 1.5 milliliters of 0.1M CaCl of precooling at=0.3～0.4 o'clock
2Resuspended, placed on ice 15 minutes, 4 ℃, 5000 rev/mins centrifugal 10 minutes, inhale and to remove supernatant liquid, 0.1 mole of CaCl of ice-cold again 200 microlitres
2Resuspended bacterium is competent cell, preserves a week under 4 ℃ of conditions.
3.3 the conversion of competent cell: in the centrifuge tube of precooling, add 10 microlitre ligation liquid, placed 30 minutes on ice behind the 100 microlitre competent cell mixings, 42 ℃ of water-baths 90 seconds.To Guan Zhongli 400 microlitre LB liquid nutrient mediums, 37 ℃, 45 minutes.In a little centrifuge tube, add 4 microlitre IPTG (isopropylthio-s, 200 mg/ml) and 16 microlitre X-Gal (X-semi-lactosis, 20 mg/ml), be evenly coated in behind the mixing and contain LB flat board (containing 100 microlitres/milliliter acillin) surface, room temperature is dried, and then conversion fluid is uniformly coated on the LB flat board.
3.4 a small amount of preparation of blue white bacterium colony screening and DNA:, be named as pGEM transforming 5 white colonies of picking on the flat board
N.B.
1-5, be inoculated in respectively in 4 milliliters of LB substratum test tube of (containing acillin 100 microlitre/milliliters), 37 ℃, 300 rev/mins of shaking culture 8～12 hours.Adopt the alkaline lysis in " molecular cloning experiment guide " to prepare plasmid DNA on a small quantity.
3.5 the enzyme of recombinant plasmid is cut evaluation: in 5 0.5 milliliter Eppendorf pipe, add plasmid DNA 2 microlitres respectively, EcoRI (restriction enzyme) 10 * buffer 5 microlitres, the EcoRI2 microlitre, distilled water 4 microlitres, centrifugal 20 seconds, mixing, 37 ℃ of water-baths 2 hours, enzyme cuts to finish respectively gets 8 microlitre reaction solutions electrophoresis detection on 1% sepharose, does not do contrast with carrying out plasmid DNA and PCR product that enzyme cuts, and PCR Marker does molecular weight marker.
3.6 the recombinant plasmid dna dot blot is identified
3.6.1 DIG dna probe preparation:, do the DIG mark with N.B.PCR product (217bp) and make probe according to " DIG mark and detection kit " specification sheets operation steps that West Germany Berlin Ge Er mannheim company produces.
Get in N.B.PCR product 10 microlitres to the 0.5 milliliter centrifuge tube, 95-100 ℃ of sex change 10 minutes inserted rapidly and kept 4-7 minute on ice; Then, add random primer 2 microlitres, dNTPs (deoxynucleoside triphosphate) 2 microlitres, ddH successively
2O 15 microlitres, Klenow 1 microlitre, 6000 rev/mins centrifugal 20 seconds, 37 ℃ of water-baths spend the night, reaction finishes and adds 2 microlitre 0.2M EDTA (ethylenediamine tetraacetic acid (EDTA)) termination reactions ,-20 ℃ of preservations.
3.6.2 Hybond membrane preparation: will be diluted to 100 nanograms/microlitre, 10 nanograms/microlitre, 1 nanogram/microlitre, 100 piks/four kinds of concentration gradients of microlitre with TE with the N.B. spore genomic dna that SDS-Proteinase K method is extracted, every kind of concentration is got 5 microlitres, 3 microlitres, 2 microlitres, 1 microlitre, point sample on the nylon membrane of 5 centimetres of one 5 cm x successively is again with 120 ℃ of oven dry 30 minutes.
3.6.3 Hybond membrane prehybridization, hybridization.
As in the prehybridization solution, prehybridization is 1 hour on 40-45 ℃ of shaking bath, removes prehybridization solution, adds hybridization solution (containing the DIG label probe) with the Hybond membrane of oven dry, 40-45 ℃ of hybridization 10-20 hour.
3.6.4 wash film: at ambient temperature, wash film 2 times for 100 milliliters with 2 * SSC and 0.1% (weight/volume) SDS, each 5 minutes; Under 68 ℃ of conditions, 0.1 * SSC and 0.1% (weight/volume) SDS (sodium laurylsulfonate) washes film 2 times for 100 milliliters, each 5 minutes.
3.6.5 antigen antibody reaction and colour developing:
3.6.5.1, put into 40 milliliters of Maleic acid buffer (toxilic acid damping fluid) with the Hybond membrane of strict rinsing, add 0.3% (volume/volume) Tween-20 (tween 20), be placed on and washed film on the swaying platform 5 minutes.
3.6.5.2 Hybond membrane is changed in 50 milliliters of Maleic acid buffer+10% (weight/volume) blocking reagent (reagent of blockading), 10 * cone lock solution, reaction is 30 minutes on swaying platform, again with lock solution dilution anti-DIG-AP antibody to 1: 5000 (volume/volume) promptly are made into antibody-solutions, as in 20 milliliters of antibody-solutions, reaction is 30 minutes on swaying platform with Hybond membrane.
3.6.5.3 be placed on 60 milliliters of Maleic acid buffer solution that are added with 0.3%Tween-20 and wash film on the swaying platform 2 times, each 15 minutes, to remove unconjugated antibody, again Hybond membrane was washed 5 minutes in not containing the Maleic acid buffer of Tween-20, outwell rinsing liquid, add 60 milliliters of Detection Solution (colour developing liquid) (0.1% mole of Tris-HCL, 0.1 mole of NaCL, 50 mmole Mgcl
2, pH9.5), balance 2 minutes.
3.6.5.4 Detection Solution is outwelled, add 10 milliliters of colour developing liquid (10 milliliters of Detection Solution add 45 microlitre NBT and 35 microlitre X-phospate) and leave standstill under the condition color reaction spend the night (15-20 hour) in the room temperature dark, when spot fully shows, add 50 milliliters of TE buffer and washed film 5 minutes, termination reaction is analyzed results of hybridization.
4, recombinant plasmid pGEM
N.B. sequential analysis
The recombinant plasmid dna of PEG purifying is diluted to 0.2 microgram/microlitre, get two 0.5 milliliter centrifuge tube, add recombinant plasmid dna, distilled water, the single primer of PCR therein in one, cumulative volume reaches 12 microlitres, plasmid content is 400 nanograms, and primer content is 3.2 picomole; Add recombinant plasmid dna, ddH in another centrifuge tube
2O, pGEM
Carrier universal primer, cumulative volume reach 8 microlitres, and plasmid DNA content is 400 nanograms, analyze (as table 1) after the PCR reaction on the PERKIN ELMER ABI-377DNA of company automatic sequencer, compare with the 240bp sequence, and homology reaches more than 95%.
Nosema bombycis DNA PCR product sequence
NB01?GCCAAACCGA?GTCCCACCAC?CCCCGGTAAT?ACTTGTCCCG?ATATTTTGTT-51
NB02?GCCAAACCGA?GTCCCACCAC?CCCCGGTAAT?ACTTGTCCCG?ATATTTTGTT-51
NB01?TGTTGATTGA?TCCAGTTAAA?AAGCCTGTAG?TTTATTTATA?ATAAGCATTG-101
NB02?TGTTGATTGA?TCCAGTTAAA?AAGCCTGTAG?TTTATTTATA?ATAAGCATTG-101
NB01?TAAGGTATAC?TGTATGGTTA?GGAGAGAGAT?GAAATGTGAT?AACCCTAACT-151
NB02?TAAGGTATAC?TGTATGGTTA?GGAGAGAGAT?GAAATGTGAT?AACCCTAACT-151
NB01?GGATGAACAG?AAGCGAAAGC?TGTATACTTA?AATGTATTAT?TAGAACAAGG-201
NB02?GGATGAACAG?AAGCGAAAGC?TGTATACTTA?AATGTATTAT?TAGAACAAGG-201
NB01?ACGTAAGCTA?GAGGATCGAA?GATGATTAGA?TACCATTGTA-240
NB02?ACGTAAGCTA?GAGGATCGAA?GATGATTAGA?TACCATTGTA-240
Wherein NB01 is a N.B.16SrRNA small ylidene gene specific and conserved sequence, and NB02 is the sequence of PCR product of the present invention.
5, the DIG label probe is identified the N.B. spore specific:
5.1 dot blot (Dot Blot): above DIG dna marker probe through mark is carried out prehybridization, hybridizes, washes film, antigen antibody reaction, color reaction etc. (method 3.6.2,3.6.3,3.6.4,3.6.5 described).The results of hybridization of 10 kinds of microsporidium genomic dnas such as its N.B. shows, in 10 kinds of microsporidian DNAs being got, the dna probe of the 217bp of DIG mark only has stronger hybridization signal to the N.B. spore, illustrates that being used for the 217bp dna segment of label probe is N.B. spore genomic dna peculiar (Fig. 3).
5.2 southern blotting technique hybridization (Southern Blot): be the false positive of elimination point hybridization, adopt DNA Southern Blot to identify to being used for the 217bp dna segment of mark.Select for use 7 kinds of microsporidium genomic dnas to carry out Hind III enzyme and cut, the result has only N.B. sporozoite DNA and probe to produce hybridization signal, and further specifying the 217bp dna segment is that N.B. spore genomic dna institute is peculiar.Its operation steps is as follows:
5.2.1 the genomic dna enzyme is cut: in 0.5 milliliter centrifuge tube, add each 10 microlitre of genomic dna such as N.B. spore, Shandong microsporidium, three-spotted phytometra micropartical spore, beet armyworm micropartical spore, area, Guangzhou microsporidium, Pyrausta nubilalis (Hubern). micropartical spore, small white spore, Sichuan megaspore, tussah spore, silkworm larva successively, HindIII * buffer 5 microlitres, HindIII 2 microlitres, distilled water 33 microlitres.With 5000 rev/mins centrifugal 20 seconds, 37 ℃ of water-baths 2 hours.
5.2.2 preparation Hybond membrane:
5.2.2.1 get each 20 microlitre of above reaction solution, electrophoresis on 1% sepharose, 90 volts, 30 minutes.Put into a porcelain dish after the taking-up again, add 200 milliliters of sex change liquid, constantly jog is 30 minutes, outwells sex change liquid, adds a small amount of distillation washing gel once, outwells distilled water, adds 200 milliliters of neutralizers again, and constantly jog is 30 minutes.
Shift liquid 5.2.2.2 add 800 milliliters of 10 * SSC in a big porcelain dish, do platform with a sponge, transfer liquid liquid level outline the is in the plane.Be cut into one " window " according to the big young pathbreaker's one clean plastics film of gel, be put on the platform, transfer 3 millimeters filter paper of two waters graceful (Whatman) at window then, roll with glass stick and drive top bubble away through the moistening mistake of 10 * SSC.
5.2.2.3 clip and gel nylon membrane of the same size is used distilled water immersion 5 minutes, cuts one jiao and makes marks.Again gel is taken out from neutralizer, be placed on conversely on the graceful 3 millimeters filter paper of water of platform, again the wetted nylon membrane is placed on the gel.
5.2.2.4 with two graceful 3 millimeters filter paper of usefulness 10 * SSC wetted water, be placed on (can not there be bubble the centre) on the nylon membrane, again folded (10-12 cm thick) size is placed on the graceful 3 millimeters filter paper of water less than the thieving paper of the graceful 3 millimeters filter paper of water approximately, put a sheet glass thereon, with the weight compacting of about 500 grams.DNA was shifted 16-22 hour.
Finish 5.2.2.5 shift, soaked nylon membrane 2 minutes with 2 * SSC, nylon membrane is gone out again, room temperature was dried 30 minutes, and 120 ℃ were toasted 30 minutes.
5.2.3 the prehybridization of nylon membrane, hybridization: undertaken by the 3.6.3 operation steps.
5.2.4 wash film: undertaken by the 3.6.4 operation steps.
5.2.5 antigen antibody reaction, color reaction: undertaken by the 3.6.4 operation steps.
6, the DIG label probe is identified the sensitivity of N.B. spore DNA detection
As each operation of 5.1-5.2, N.B. genome and DIG label probe with different concns or content are hybridized, its result shows, when N.B. spore DNA is between 500～10 nanograms, the DIG probe can detect existence and its content of N.B. spore DNA significantly, but when N.B. spore dna content was lower than 1 nanogram, probe can only illustrate the existence of DNA qualitatively, can not do quantitative analysis.Therefore, if pebrine disease is made qualitative detection, the sensitivity that DIG label probe then of the present invention can detect the N.B. genomic dna reaches 1 nanogram dna level.
7, the DIG label probe application of already producing silkworm.
7.1DIG label probe is used the detection of sick moth
The sick moth incidence of pebrine disease is divided into Three Estate in the production, promptly light (N.B. content 10
5～10
6Individual spore/milliliter), medium (N.B. content 10
7Individual spore/milliliter), serious (N.B. content 10
8Individual spore/milliliter).
Get 60 of anosis normal silkworm moths, add 100 ml distilled waters, in mortar, grind, use the nosema bombycis that precipitates in the serious silkworm moth lapping liquid of grinding fluid dilution morbidity after one deck filtered through gauze, be made into 1 * 10
9Individual spore/milliliter, 1 * 10
8Individual spore/milliliter, 1 * 10
7Individual spore/milliliter, 1 * 10
6Individual spore/milliliter, 1 * 10
5Individual spore/milliliter, 5 * 10
5Individual spore/six concentration gradients of milliliter is respectively got 500 microlitre diluents, by the method for operation steps 1, with SDS and Proteinase K method extracting DNA.
The DNA (containing silkworm moth DNA and N.B. spore DNA) that extracting is obtained carries out DNA Dot Blot hybridization with DIG label probe (containing the special segment of 217bp DNA), and operation is as described in 3.1.Each gradient repeats 2 times, is over against photograph with recombinant plasmid dna, and normal moth DNA is negative contrast.The DNA that the sick moth lapping liquid extracting of six concentration as a result obtains has hybridization signal, and sensitivity can reach 1 nanogram dna level.
7.2 the DIG label probe is used the detection of tame flacherie ovum
Get about 5 grams of silkworm seed that the strong moth of silkworm gives birth to, add 40 ml distilled waters, grind the back and use one deck filtered through gauze, the nosema bombycis with this grinding fluid dilution pebrine silkworm seed lapping liquid precipitates is mixed with 1 * 10
9Individual spore/milliliter, 1 * 10
8Individual spore/milliliter, 1 * 10
7Individual spore/milliliter, 1 * 10
6Individual spore/milliliter, 1 * 10
5Individual spore/milliliter, 5 * 10
5Individual spore/six concentration gradients of milliliter is respectively got 500 microlitre diluents, by implementation method the method for the extraction of nosema bombycis DNA " 1, ", with SDS and Proteinase K method extracting DNA.
The DNA (containing silkworm seed DNA and N.B. spore DNA) that extracting is obtained carries out DNA Dot Blot hybridization with DIG label probe (containing the special segment of 217bp DNA), and operation is as described in 3.1.Each gradient repeats 2 times, is over against photograph with recombinant plasmid dna, and normal ovum DNA is negative contrast.The DNA that the sick moth lapping liquid extracting of six concentration as a result obtains has hybridization signal, and sensitivity can reach 1 nanogram dna level.
Claims (5)
1, a kind of nucleic acid molecular hybridization detection method of pebrine disease, it is characterized in that, this method adopts Proteinase K phenol chloroform extraction method to extract the DNA of nosema bombycis, measure its specific DNA segment, synthetic primer, obtain the PCR product by PCR amplification, PCR product microsporidium specific DNA sequence is cloned into the promotor pGEN that has the SP6 phage
In-3Z the transfer vector plasmid, through the recombinant plasmid sequential analysis, 217bp makes molecular probe through the digoxin mark with nosema bombycis spore PCR product, adopts the dot blot method to detect nosema bombycis disease pathogen spore.
2, the nucleic acid molecular hybridization detection method of a kind of pebrine disease according to claim 1 is characterized in that, the DNA that described Proteinase K phenol chloroform extraction method extracts nosema bombycis follows these steps to carry out:
A, will add the silkworm that the food microsporidium carries out common nursing and grind purify;
B, get 400 microlitres and remove supernatant+equal-volume 0.2 mol K after centrifugal
2CO
3, 30 ℃, 1 hour, remove impurity;
C, transfer in the phosphoric acid buffer, Ph7.8,2 hours, stimulates spore-germination by 30 ℃;
D, 6000 rev/mins, 5 minutes, remove supernatant, add 40 microlitre spore lysates, 54 ℃, water-bath 3～5 hours;
E, the saturated phenol extracting of equal-volume once, 4000 rev/mins, 5 minutes;
F, get supernatant liquor, add equal-volume phenol/chloroform/primary isoamyl alcohol, 6000 rev/mins, 5 minutes;
G, get supernatant liquor, add 2.5 times of dehydrated alcohols, 10 moles of NH of 1/30 volume
4AC ,-20 ℃, 12 hours, 12000 rev/mins, 10 minutes;
H, abandon supernatant, precipitation is respectively washed once with 70% cold ethanol, dehydrated alcohol, and vacuum was drained 10 minutes, was dissolved in the 30 microlitre TE damping fluids-20 ℃ of preservations.
3, the nucleic acid molecular hybridization detection method of a kind of pebrine disease according to claim 1 is characterized in that, described polymerase chain reaction follows these steps to carry out:
A, according to the following primer of one section 240bp specific sequence design of 16SrRNA small ylidene gene:
5 ' end primer: 5 ' CACGAACCACGGTAATACTTGT 3 '
3 ' end primer: 3 ' GGCAATGGTATCTAATCATCTTC 5 '
The pcr amplification of B, primer:
In 0.5 milliliter of centrifuge tube, add earlier following material successively to 50 milliliters of cumulative volumes:
Distilled water 30 microlitres, 10 * heat-resisting thymus nucleic acid polymer buffer liquid 5.0 microlitres, thymus nucleic acid mixture 5.0 microlitres, 5 ' end primer 2 .0 microlitre, 3 ' end primer 2 .0 microlitre, template DNA 2.0 microlitres, dimethyl sulfoxide (DMSO) 3.5 microlitres, heat-resisting thymus nucleic acid polymkeric substance 1.0 microlitres, aseptic paraffin oil 30 microlitres, centrifugal 10 seconds;
95 ℃ of sex change 5 minutes; By 95 ℃ of sex change of each circulation 1 minute, annealed 1 minute for 50 ℃, 72 ℃ were extended totally 30 circulations 2 minutes; 72 ℃ were extended 10 minutes;
Get 5 microlitre PCR products electrophoresis detection on 1.5% sepharose;
C, PCR product reclaim:
The PCR product is electrophoresis on 1.5% sepharose, and 90 volts, 30～40 minutes;
Under ultraviolet lamp, will contain the gel cutting-out of amplified production with scalpel, put into 1.5 milliliters centrifuge tube, add 6 mol NaI, 400 microlitres, 55～60 ℃ of water-baths 5 minutes treat that gel melts fully, be placed in the ice ice bath and reduce to 30 ℃, add 1 milliliter of Wizard DNA Clean-up System resin, reversing makes solution mix several times, and room temperature was placed 2 minutes, be added in the filtering bolt, drain;
The Virahol that adds 2 milliliter 80%, the impurity on the suction filtration wash-out resin is put into the little plastics tubing of an Eppendorf with the strainer that is loaded with resin, adopt 10000 rev/mins centrifugal 2 minutes, dry remaining Virahol;
Again it is transferred in the little plastics tubing of another new Eppendorf, adds 65 ℃ of hot water 30 microlitres to strainer, kept 1 minute, 12000 rev/mins centrifugal 20 seconds, liquid is standby in-20 ℃ of preservations in the collection tube.
4, the nucleic acid molecular hybridization detection method of a kind of pebrine disease according to claim 1 is characterized in that, described PCR product microsporidium specific DNA sequence is cloned into the promotor pGEN that has the SP6 phage
Follow these steps to carry out in-3Z the transfer vector plasmid:
A, PCR product connect:
0.5 add ddH in the milliliter centrifuge tube
2O 7 microlitres, pcr amplification product 8 microlitres, pGEM
-TEasy Vector 2.0 microlitres, 10 * thyroxine dna ligase buffer liquid, 2.0 microlitres, thyroxine deoxyribonucleic acid ligase 1 microlitre mixed the back centrifugal 20 seconds, inserted in 4 ℃ of refrigerators to connect 50 hours;
B, competent cell preparation:
The conversion of C, competent cell:
In the centrifuge tube of precooling, add 10 microlitre ligation liquid, placed 30 minutes on ice behind the 100 microlitre competent cell mixings, 42 ℃ of water-baths 90 seconds;
Xiang Guanzhong adds 400 microlitre LB liquid nutrient mediums, 37 ℃, 45 minutes;
In a little centrifuge tube, add isopropylthio-4 microlitres of 200 mg/ml and X-Gal 16 microlitres of 20 mg/ml, be evenly coated in the LB planar surface that contains 100 microlitres/milliliter acillin behind the mixing, room temperature is dried, and conversion fluid is uniformly coated on the LB flat board then;
The a small amount of preparation of D, blue white bacterium colony screening and DNA: transforming 5 white colonies of picking on the flat board, called after pGEM
N.B.
1-5, be inoculated in respectively in the test tube of every milliliter of 4 milliliters of LB substratum that contain 100 microlitre acillins, 37 ℃, 300 rev/mins of shaking culture 8～12 hours.Adopt the alkaline lysis in " molecular cloning experiment guide " to prepare plasmid DNA on a small quantity;
The enzyme of E, recombinant plasmid is cut evaluation: add plasmid DNA 2 microlitres respectively in 5 0.5 milliliter the little plastics tubing of Eppendorf, EcoRI 10 * buffer 5 microlitres, EcoRI 2 microlitres, distilled water 4 microlitres, centrifugal 20 seconds, mixing, 37 ℃ of water-baths 2 hours, enzyme cuts to finish respectively gets 8 microlitre reaction solutions electrophoresis detection on 1% sepharose, does not do contrast with carrying out plasmid DNA and PCR product that enzyme cuts, and PCR Marker does molecular weight marker;
F, recombinant plasmid dna dot blot are identified
1. DIG dna probe preparation:
Do the DIG mark with N.B.PCR product 217bp and make probe;
Get in N.B.PCR product 10 microlitres to the 0.5 milliliter centrifuge tube, 95-100 ℃ of sex change 10 minutes inserted rapidly and kept 4-7 minute on ice; Add random primer 2 microlitres, deoxynucleoside triphosphate 2 microlitres, distilled water 15 microlitres, Ke Lienuo segment 1 microlitre more successively, 6000 rev/mins centrifugal 20 seconds, 37 ℃ of water-baths spend the night, and reaction finishes and adds 2 microlitres, 0.2 moles of ethylene diamine tetraacethyl termination reaction ,-20 ℃ of preservations;
2. Hybond membrane preparation: the N.B. spore genomic dna that extracts is diluted to 100 nanograms/microlitre, 10 nanograms/microlitre, 1 nanogram/microlitre, 100 piks/four kinds of concentration gradients of microlitre with the TE damping fluid, every kind of concentration is got 5 microlitres, 3 microlitres, 2 microlitres, 1 microlitre, point sample on the nylon membrane of 5 centimetres of one 5 cm x successively is again with 120 ℃ of oven dry 30 minutes;
3. Hybond membrane prehybridization, hybridization: as in the prehybridization solution, prehybridization is 1 hour on 40-45 ℃ of shaking bath, removes prehybridization solution with the Hybond membrane of oven dry, adds hybridization solution and contains the DIG label probe, 40-45 ℃ of hybridization 10-20 hour;
4. wash film: at ambient temperature, be that 0.1% sodium laurylsulfonate is washed film 2 times for 100 milliliters, each 5 minutes with 2 * SSC damping fluid and weight/volume; Under 68 ℃ of conditions, 0.1 * SSC and weight/volume are that 0.1% sodium laurylsulfonate is washed film 2 times for 100 milliliters, each 5 minutes;
5. antigen antibody reaction and colour developing: with the Hybond membrane of strict rinsing, put into 40 milliliters of toxilic acid damping fluids, add volume/volume and be 0.3% tween 20, be placed on and washed film on the swaying platform 5 minutes; Changing Hybond membrane over to 50 milliliters of toxilic acid damping fluid+weight/volume is in the reagent of blockading+10 * conc lock solution of 10%, reaction is 30 minutes on swaying platform, be promptly to be made into antibody-solutions at 1: 5000 with lock solution dilution anti-DIG-AP antibody to volume/volume again, as in 20 milliliters of antibody-solutions, reaction is 30 minutes on swaying platform with Hybond membrane; Be placed on 60 milliliters of toxilic acid buffered soln that are added with 0.3% tween 20 and wash film on the swaying platform 2 times, each 15 minutes, to remove unconjugated antibody, again Hybond membrane was washed 5 minutes in not containing the toxilic acid buffered soln of tween 20, outwell rinsing liquid, add 60 milliliters of colour developing liquid, the prescription of this colour developing liquid is: 0.1% mole of Tris-HCL, 0.1 mole NaCL, 50 mmole Mgcl
2, pH9.5; Balance 2 minutes, the liquid that will develop the color is outwelled, and adds 10 milliliters of colour developing liquid again, and the prescription of this colour developing liquid is: 10 milliliters of DetectionSolution add 45 microlitre NBT and 35 microlitre X-phospate; Left standstill under the condition color reaction 15-20 hour in the room temperature dark, when spot fully shows, add 50 milliliters of TE buffer and washed film 5 minutes, termination reaction is analyzed results of hybridization.
5, the nucleic acid molecular hybridization detection method of a kind of pebrine disease according to claim 1 is characterized in that, described recombinant plasmid sequential analysis is meant:
The recombinant plasmid dna of PEG purifying is diluted to 0.2 microgram/microlitre, get two 0.5 milliliter centrifuge tube, add recombinant plasmid dna, distilled water, the single primer of PCR therein in one, cumulative volume reaches 12 microlitres, plasmid content is 400 nanograms, and primer content is 3.2 picomole; Add recombinant plasmid dna, ddH in another centrifuge tube
2O, pGEM
Carrier universal primer, cumulative volume reach 8 microlitres, and plasmid DNA content is 400 nanograms, analyze on the PERKIN ELMER ABI-377DNA of company automatic sequencer after the PCR reaction, and result and 240bp sequence compare, and homology reaches more than 95%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011383577A CN1169968C (en) | 2001-12-27 | 2001-12-27 | Nucleic acid molecular hybridization detection method for silkworm nosema disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB011383577A CN1169968C (en) | 2001-12-27 | 2001-12-27 | Nucleic acid molecular hybridization detection method for silkworm nosema disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1428437A CN1428437A (en) | 2003-07-09 |
| CN1169968C true CN1169968C (en) | 2004-10-06 |
Family
ID=4674558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB011383577A Expired - Fee Related CN1169968C (en) | 2001-12-27 | 2001-12-27 | Nucleic acid molecular hybridization detection method for silkworm nosema disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1169968C (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100389189C (en) * | 2005-12-16 | 2008-05-21 | 广东省农业科学院蚕业与农产品加工研究所 | Process for industrialized production of microsporidian using silkworm as host |
| CN100402540C (en) * | 2006-02-24 | 2008-07-16 | 华南农业大学 | Fast method of extracting microsporidian DNA |
| KR101120270B1 (en) * | 2007-08-16 | 2012-03-06 | 모리나가 뉴교 가부시키가이샤 | Method and kit for detection of microorganism |
| CN102181541B (en) * | 2011-04-08 | 2013-09-04 | 孟维娜 | Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof |
| CN104017891B (en) * | 2014-06-20 | 2015-05-20 | 华南农业大学 | Application of septin1 gene to detection of nosema bombycis |
| CN105177165A (en) * | 2015-10-26 | 2015-12-23 | 江苏省淡水水产研究所 | Eriocheir sinensis Microsporidia in-situ hybridization detection probe and kit |
| CN112522266B (en) * | 2020-12-10 | 2022-06-10 | 西南大学 | Promoter of bombyx mori pebrine induced expression gene BmPGT 2 and application thereof |
-
2001
- 2001-12-27 CN CNB011383577A patent/CN1169968C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1428437A (en) | 2003-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lo et al. | Specific genomic DNA fragment analysis of different geographical clinical samples of shrimp white spot syndrome virus | |
| Read et al. | Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP | |
| Magbanua et al. | White spot syndrome virus (WSSV) in cultured Penaeus monodon in the Philippines | |
| CN110093461B (en) | Quadruple RT-PCR (reverse transcription-polymerase chain reaction) detection primers and kit for four porcine diarrhea viruses | |
| CN1169968C (en) | Nucleic acid molecular hybridization detection method for silkworm nosema disease | |
| CN110699489A (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN1195070C (en) | Detection type gene chip for detecting various infectious desease and use thereof | |
| CN104611471B (en) | For detecting gene chip and its detection method of foot and mouth disease viruses | |
| CN101418351B (en) | Shrimp white spot syndrome virus detection reagent kit and detecting method | |
| CN110592278A (en) | Multiplex RT-PCR kit for PRoV, PoSaV and PAStV | |
| CN105063237A (en) | Gene chip for identification of six swine disease pathogens and detection method thereof | |
| CN103451310B (en) | Gene chip capable of simultaneously detecting various vibrios and method for detecting vibrios | |
| CN105543410A (en) | Method for detecting pig viral diseases on basis of TEM-PCR and gene chip | |
| CN110607398B (en) | RT-LAMP kit for fluorescent visual rapid detection of porcine epidemic diarrhea virus | |
| Baek et al. | Detection of channel catfish virus in adult channel catfish by use of a nested polymerase chain reaction | |
| CN110964848A (en) | RAA amplification primer and probe for rapidly detecting carp herpesvirus II, detection kit and use method | |
| CN113584227B (en) | Nested PCR (polymerase chain reaction) detection primer group and method for identifying African swine fever gene deletion strain | |
| CN1814806A (en) | C. andersoni PCR detecting kit | |
| CN1289691C (en) | Quick detection method of pathogenic microbe diagnosis type gene chip | |
| CN1614396A (en) | Special primer probe and detection for nematode of pine | |
| CN113430274A (en) | RPA primer, probe, kit and method for detecting liver enterocytozoon | |
| CN110184385B (en) | Freshwater crayfish thrum virus PCV-87R specific sequence and application | |
| Momta et al. | Comparisons of competitive enzyme-linked immunosorbent assay and one step RT-PCR tests for the detection of bluetongue virus in south west of Iran | |
| CN104611470A (en) | Gene chip for detecting bluetongue virus and detecting method of same | |
| Zhu et al. | Onsite and visual detection of ranavirus in largemouth bass (Micropterus salmoides) by an isothermal recombinase polymerase amplification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: TIANYOU BIOLOGIC SCI. & TECH. CO., LTD., CHENGDU Free format text: FORMER OWNER: CHENGDU TIANYOU DEVPT CO., LTD. Effective date: 20020802 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20020802 Applicant after: Tianyou Biologic Sci. & Tech. Co., Ltd., Chengdu Applicant before: Chengdu Tianyou Devpt Co., Ltd. |
|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |