CN101928769B - PCR specific amplification primer for quick detection of vibrio alginnolyficus based on SCAR molecular marker and detection kit - Google Patents

Abstract

The invention discloses a PCR specific amplification primer for quick detection of vibrio alginnolyficus based on an SCAR molecular marker and a detection kit. The nucleotide sequence of the forward primer VaF is 5'-GAGAAGCGGGTGCATTGAAC-3', and the nucleotide sequence of the reverse primer VaR is 5'-GGCTTGAATTCTTCTCCACCTC-3'. The kit contains a PCR specific forward primer VaF/reverse primer VaR mixed solution dissolved by sterilized double-distilled water, and the concentration of the mixed solution is 0.5-2 mu M. The cultured vibrio colony can be directly used for PCR reaction to carry out the detection without extracting the vibrio genome DNA, and thus, the invention has the advantages of time saving, labor saving, convenience, high speed, high accuracy, favorable specificity and high sensitivity. The kit can be used for tracking detection and briny environment monitoring of vibrio alginnolyficus in the marine animal cultivation process, and has high practical value.

Description

PCR specific amplification primer and detection kit based on SCAR molecule marker rapid detection vibrio alginolyticus

Technical field:

The present invention relates to a kind of PCR specific amplification primer and detection kit that detects the marine cultured animal pathogenic bacteria; Especially PCR specific amplification primer and detection kit that a kind of detection accuracy and susceptibility are high, the time is short, cost is low based on SCAR (Sequence characterized amplified region, characteristic sequence amplification region) molecule marker rapid detection vibrio alginolyticus.

Background technology:

Vibrios is the main conditioned pathogen of marine cultured animal; Wherein vibrio pathogen can make the cultivated animals fulminant dead; Will cause huge infringement to marine cultured animal with virus, other bacteriums or parasite etc., be acknowledged as in the sea farming one of severe diseases the most.Can cause cultivated animals such as fish, shrimp, shellfish, sea cucumber dead on a large scale like vibrio alginolyticus (Vibrioalginolyticus), also bring hidden danger to eating the human health that has infected vibrio alginolyticus food by mistake.At present, the Vibrio detection method there are Physiology and biochemistry authenticate technology, EUSA, 16S rRNA gene identification etc., exist following not enough respectively: Physiology and biochemistry authenticate technology time and effort consuming, the accuracy rate of detection is low; EUSA susceptibility is not high; 16S rRNA gene identification can only identify genus with morbid vibrio, and fubaritic to planting.

Summary of the invention:

The present invention be directed to the above-mentioned technical problem of existing in prior technology, a kind of detection accuracy and susceptibility are high, the time is short, cost is low PCR specific amplification primer and detection kit based on SCAR molecule marker rapid detection vibrio alginolyticus are provided.

Technical solution of the present invention is: a kind of PCR specific amplification primer based on SCAR molecule marker rapid detection vibrio alginolyticus is characterized in that the nucleotides sequence of upstream and downstream primer is classified as:

Upstream primer VaF:5 '-GAGAAGCGGGTGCATTGAAC-3 ';

Downstream primer VaR:5 '-GGCTTGAATTCTTCTCCACCTC-3 '.

A kind of detection kit based on SCAR molecule marker rapid detection vibrio alginolyticus is characterized in that comprising following reagent:

Reagent I: with the mixed solution of sterilization distilled water dissolved PCR specific amplified upstream primer VaF and downstream primer VaR, concentration is 0.5-2 μ M, and the nucleotides sequence of upstream and downstream primer is classified as: upstream primer VaF:5 '-GAGAAGCGGGTGCATTGAAC-3 '; Downstream primer VaR:5 '-GGCTTGAATTCTTCTCCACCTC-3 ';

The mixed solution of four kinds of deoxynucleotides of reagent II:dNTPs, concentration are 50～500 μ M;

Reagent III:10 * PCR damping fluid: the 100mM Tris-HCl of 500mM KCl, pH 8.4,15mM MgCl ₂With the 16mM WR 34678;

Reagent IV:Taq archaeal dna polymerase, concentration are 5U/ μ l;

Reagent V: sterilization distilled water;

Reagent VI: as total DNA of the vibrio alginolyticus of positive template, concentration is 50ng/ μ l;

Reagent VII: contain the DL2000DNA molecular weight of 1 * sample-loading buffer, concentration is 50ng/ μ l.

The present invention utilizes RAPD (Random amplified polymorphic DNA; Randomly amplified polymorphic DNA) technology is analyzed in various vibrios; Found the difference DNA fragment specific of vibrio alginolyticus; The difference DNA fragment specific is reclaimed order-checking, and then according to the sequences Design that records and synthesized PCR specific amplified upstream and downstream primer, the detection kit that is used to detect vibrio alginolyticus, the vibrios bacterium colony of available cultivation is directly done the PCR reaction and is detected; Need not to extract the vibrios genomic dna, time saving and energy saving, easy, quick, accurate, specificity is good, highly sensitive.Can be used for tracking detection and the briny environment monitoring of vibrio alginolyticus in the marine cultured animal breeding process, have very high practical value.

Description of drawings:

Fig. 1 is the synoptic diagram as a result with the sick lefteye flounder liver lesion of embodiment of the invention detection of cancerous ascites.

Embodiment:

The embodiment of the invention be utilize more than 200 RAPD primer vibrio alginolyticus (Vibrio alginolyticus) (ATCC 17749), Vibrio vulnificus (Vibrio vulnificus) (ATCC 27562), Vibrio parahaemolyticus (Vibrioparahaemolyticus) (ATCC 17802), Vibrio flurialis (Vibrio fluvialis) (ATCC 33810), vibrio mimicus (Vibrio mimicus) (ATCC 33653), Vibrio harveyi (Vibrio harveyi) (ATCC33842), exploitation and be converted into the species specificity SCAR mark of vibrio alginolyticus on Vibrio campbellii (Vibrio campbellii) (ATCC 33864) and shark vibrio (Vibriocarchariae) vibrios such as (ATCC 35084), its nucleotides sequence is classified as:

GAGAAGCGGGTGCATTGAACGCTGAACTGGTCGTGATATAAGGAGTTAAGGATGAAGCTAGACAGTACCAATGAACAAGCTCAGTTAAATTCGATGCTTTATCACGACAATAGTGCATTGGCTAACATCAAGCATAGTCGTGATCAAGAAGGCGCACTTGAAGTCGTCGCAGGTCAATTTGAGGCAATGTTCCTACAAATGGTGTTACGCCAAATGCGCAGCAGTAGTGATGCTCTTGCTGATAAAGACAACCCGTTCGCCAGTCAGCAACAAGGGGTATTCCGTGATATGTATGACGGTCAGCTGGCGATGGAATTAGCAAAGAAACAGAGCTCAGGCATTGCCAATATGCTCATCCAGCAGCTGAGCCCGTCTATGCGTGAGGTTGCTTTCGATGCTGCGCGCAACATCTCATCCGCTAACGATGGTAAAGCTTCGAATTCTGAATCTATCTCACAAGTAGATTCTAAAGAGGTGGAGAAGAATTCAAGCC。

The embodiment of the invention is according to above-mentioned specific SCAR label, has designed and synthesized the PCR specific amplification primer of rapid detection vibrio alginolyticus, it is characterized in that the nucleotides sequence of upstream and downstream primer is classified as:

Upstream primer VaF:5 '-GAGAAGCGGGTGCATTGAAC-3 ';

Downstream primer VaR:5 '-GGCTTGAATTCTTCTCCACCTC-3 '.

The detection kit that the present invention designed contains following reagent:

Reagent I: with the mixed solution of sterilization distilled water dissolved PCR specific amplified upstream primer VaF (5 '-GAGAAGCGGGTGCATTGAAC-3 ') and downstream primer VaR (5 '-GGCTTGAATTCTTCTCCACCTC-3 '), concentration is 0.5-2 μ M;

The mixed solution of four kinds of deoxynucleotides of reagent II:dNTPs, concentration are 50～500 μ M;

Reagent III:10 * PCR damping fluid: the 100mM Tris-HCl of 500mM KCl, pH 8.4,15mM MgCl ₂With 16mM WR 34678 (DTT);

Reagent IV:Taq archaeal dna polymerase, concentration are 5U/ μ l;

Reagent V: sterilization distilled water (ddH ₂O);

Reagent VI: as total DNA of the vibrio alginolyticus (Vibrio alginolyticus) (ATCC 17749) of positive template, concentration is 50ng/ μ l;

Reagent VII: contain the DL2000 dna molecular amount of 1 * sample-loading buffer, concentration is 50ng/ μ l.

With the sick pathogenic vibrio alginolyticus of lefteye flounder liver lesion of embodiment of the invention detection of cancerous ascites, undertaken by following step:

(1) on Bechtop, scrape to get and suffer from the sick lefteye flounder liver lesion of ascites with connecing collarium, line connects bacterium on the 2216E substratum, cultivates 10～12 hours for 28 ℃, when the diameter of bacterial colony can directly be used for the SCAR-PCR reaction during in 1～1.5mm left and right sides;

(2) in 200 μ l PCR reaction tubess, put 1 μ l reagent I, 2 μ l reagent II, 2.5 μ l reagent III, 0.5 μ l reagent IV and 19 μ l reagent V, fully mixing;

(3) with aseptic toothpick picking list bacterium colony at random on the 2216E flat board, more single bacterium colony is placed above-mentioned PCR reaction tubes, as the bacteria total DNA masterplate;

(4) PCR pipe is placed on carries out amplified reaction on the thermal cycler then, the condition of reaction is: 94 ℃ of preparatory sex change 5 minutes, carry out following 25 circulations then: and 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 25 seconds, 72 ℃ were extended 25 seconds; Last 72 ℃ were extended 4 ℃ of preservations 7 minutes; Do test sample;

(5) in 200 μ l PCR reaction tubess, put 1 μ l reagent I, 2 μ l reagent II, 2.5 μ l reagent III, 0.5 μ l reagent IV and 19 μ l reagent V; Abundant mixing; Then PCR pipe is placed on and carries out amplified reaction on the thermal cycler, the condition of reaction is: 94 ℃ of preparatory sex change 5 minutes, carry out following 25 circulations then: 94 ℃ of sex change 30 seconds; Annealed 25 seconds for 58 ℃, 72 ℃ were extended 25 seconds; Last 72 ℃ were extended 4 ℃ of preservations 7 minutes; Do negative control;

(6) in 200 μ l PCR reaction tubess, put 1 μ l reagent I, 2 μ l reagent II, 2.5 μ l reagent III, 0.5 μ l reagent IV, 18 μ l reagent V and 1 μ l reagent VI, fully mixing; Then PCR pipe is placed on and carries out amplified reaction on the thermal cycler, the condition of reaction is: 94 ℃ of preparatory sex change 5 minutes, carry out following 25 circulations then: and 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 25 seconds, 72 ℃ were extended 25 seconds; Last 72 ℃ were extended 4 ℃ of preservations 7 minutes; Do positive control;

(7) getting step (4), (5), (6) and reagent VII 3-5 μ l respectively and after 1% agarose gel electrophoresis 25-35 minute, on ultraviolet device, observe, if bright DNA band occurs at the 493bp place, then is that vibrio alginolyticus is positive; If reactionless band shows, and is then negative.

Actual detected result is as shown in Figure 1, M:DL2000 dna molecular amount (reagent VII) among the figure; 1: vibrio alginolyticus positive control (doing the SCAR-PCR result of DNA masterplate with reagent VI); 2: vibrio alginolyticus negative control (with the SCAR-PCR result of reagent V); 3: test sample (bacterial colony with cultivating is SCAR-PCR result).

The result shows in the sick lefteye flounder liver of institute's detection of cancerous ascites has vibrio alginolyticus.

Sequence table

< 110>Dalian aquatic product Academy

< 120>PCR specific amplification primer and the detection based on SCAR molecule marker rapid detection vibrio alginolyticus tries

The agent box

<160>2

<170>PatentIn?Version?3.1

<210>1

<211>20

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

< 223>primer

<400>1

gagaagcggg?tgcattgaac 20

<210>2

<211>22

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

< 223>primer

<400>2

ggcttgaatt?cttctccacc?tc 22

Claims (2)

1. PCR specific amplification primer based on SCAR molecule marker rapid detection vibrio alginolyticus is characterized in that the nucleotides sequence of upstream and downstream primer is classified as:

Upstream primer VaF:5 '-GAGAAGCGGGTGCATTGAAC-3 ';

Downstream primer VaR:5 '-GGCTTGAATTCTTCTCCACCTC-3 '.

2. detection kit based on SCAR molecule marker rapid detection vibrio alginolyticus is characterized in that comprising following reagent:

Reagent I: with the mixed solution of sterilization distilled water dissolved PCR specific amplified upstream primer VaF and downstream primer VaR, concentration is 0.5-2 μ M, and the nucleotides sequence of upstream and downstream primer is classified as: upstream primer VaF:5 '-GAGAAGCGGGTGCATTGAAC-3 '; Downstream primer VaR:5 '-GGCTTGAATTCTTCTCCACCTC-3 ';

The mixed solution of four kinds of deoxynucleotides of reagent II:dNTPs, concentration are 50～500 μ M;

Reagent III:10 * PCR damping fluid: the 100mM Tris-HCl of 500mM KCl, pH 8.4,15mM MgCl ₂With the 16mM WR 34678;

Reagent IV:Taq archaeal dna polymerase, concentration are 5U/ μ l;

Reagent V: sterilization distilled water;

Reagent VI: as total DNA of the vibrio alginolyticus of positive template, concentration is 50ng/ μ l;

Reagent VII: contain the DL 2000 dna molecular amounts of 1 * sample-loading buffer, concentration is 50ng/ μ l.

Images