CN1357625A - Partial ESR gene sequence, swine farrowing characteristic related ESR gene and polymorphic FSH-Beta gene determination technology - Google Patents

Abstract

The present invention relates to partial sequence of ESR gene and one new kind of PCR-RFLPs method of detecting swine ESR gene polymorphyism. The said improved method has reduced concentration of agarose gel for detection, raised definition of PCR-RFLPs bars and economic and simple ESR gene detection. The present invention also discloses the method of detecting swine ESR and polymorphic FCR-Beta gene polymorphyism simultaneously, and the said method has low detection cost, raised heterozygosis frequency in detection result and thus increased polymorphic information content in analysis result. The present invention provides one more effective, simple and practical molecular genetic marker with more polymorphic information content for auxiliary marker selection and infiltration of marker in breeding.

Description

ESR Gene Partial sequence reaches the ESR gene relevant with the farrowing proterties of pig and the polymorphic detection technique of FSH-Beta gene

The present invention relates to the genetically engineered field, relate in particular to ESR Gene Partial sequence and reach the ESR gene relevant and the polymorphic detection technique of FSH-Beta gene with the farrowing proterties of pig.

Litter size of pig is a kind of quantitative character, and the improvement that litter size of pig is small just can bring huge economic benefit to pig industry.Bibliographical information is arranged; as long as litter size of pig is improved 1.0/tire; Britain's pig industry can obtain 700,000,000 pounds surplus profit every year; and the annual surplus profit that obtains of the whole European Community will be 2,000,000,000 pounds at least; though China's pig industry large-scale degree not high (being approximately 15%), its surplus profit will be more than 19,000,000,000 Renminbi.

Heredity of traditional animal and breeding theory think, important economical trait (overwhelming majority is a quantitative character) is the control that the genetic effect by many little effects can add.Although this model is also not exclusively reasonable; but obtained great achievement really by Phenotypic Selection improvement animal varieties in the decades in past; yet; today is under this traditional theory and breeding technique guidance; the genetic progress of animal varieties improvement is very slow; or even stagnation, reached so-called " selection plateau ".Selection to the litter size of pig is all the more so, and France has used 30 years to improve this proterties, blank wall as a result; Denmark has used 50 years just every tire litter size to be improved 1.0.This is relevant with " selection plateau " phenomenon on the one hand, and is simultaneously also relevant with the characters of number born heritability lower (being about 0.1) of pig, make animal produce development constantly, has only and explores and use new hi-tech.

Under the inspiration of the inspiration of Human genome location plan and huge achievement, livestock and poultry assignment of genes gene mapping plan came into effect the beginning of the nineties.The major objective of Human genome location plan is to find gene and the gene therapy methods relevant with genetic diseases, and the major objective of livestock and poultry assignment of genes gene mapping plan is to find important economical trait (as: litter size, milk yield, day weight gain, egg productivity, disease resistance etc.) seat or chain with it dna marker, and is applied to marker assisted selection (Marker-assisted Selection; MAS) improve livestock and poultry species, improve animal production efficiency.

Zelanian Montgomery.G had greatly inspired the investigator in this field to remove to seek the key-gene of control pig reproductive trait in the great discovery of sheep fecund gene (FecB) in 1993.U.S. Rothschild study group found that ESR was one of major gene of litter size of pig in 1994, and 1.5 litter size/tires and 1 product young number/tire alive can be controlled in this seat in the synthetic system of Chinese plum mountain pig.Through meticulous Position Research, although the hereditary effect of ESR seat control litter size descends to some extent, proved directly causing by the ESR gene really of this hereditary effect in big yorker population.In Chinese painted face in Beijing opera hybridization population, the work of our research group has not only confirmed people's such as Rothschild result of study, has also found the major gene seat FSH-Beta of another control litter size of pig simultaneously.This locus can be controlled 2.0 litter size/tires of litter size of pig and 1.5 product young number/tires alive.

Present ESR:(Estrogen Receptor) female hormone receptor gene has been positioned 1p24--p25; Linear linkage map is-SW552-[8.3cm]-SWR485-[3.2cm]-ESR-[2.9cm]-SOD2-[2.9cm]-SW137-[2.6cm]-SW64-[25.4cm]-S0008.The litter size of control 0.44-1.15 head/nest.The influence of pig ESR gene pairs characters of number born sees Table 1

Table 1: the influence of pig ESR gene pairs characters of number born

ESR?genotype	??????????First?parity		????????Later?parities
					????TNB	????NBA	????TNB	????NBA
	?AA ?AB ?BB ?Effect	????10.14 a????10.59 b????10.97 c	????9.42 a????9.87 b????10.22 c	????11.36 a????11.86 b????12.04 b					????10.03 a????10.51 b????10.71 b

??Additive ??Dominace

?????0.42 **?????0.04

???0.39 **???0.05

?????0.31 **?????0.16

?????0.31 **?????0.14

^{*: *, b, c}Means within a column without a common superscript differ (P＜0.01). ^*: P＜0.05; ^*: P＜0.01. (selecting from Rothschild (1996)).

The follicular stimulating hormone beta subunit gene, follicular stimulating hormone acceptor gene (FSH β, FS hour) has also been finished location work.FSH β is positioned 2p16--p12; Be positioned 3q22-q23 in FS hour.Control 1.5-2.0 head/nest litter size.The influence of pig FSH β gene pairs characters of number born sees Table 2.

Table 2: the influence of pig FSH β gene pairs characters of number born

FSHβ	????????First?parity			??????????Second?parity			??????????Third?parity			?????????Fouth?parity
													???N	???TNB	???NBA	???N	????TNB	????NBA	???N	????TNB	???NBA	???N	????TNB	????NBA
	?AA ?AB ?BB? ? ??A ??D ??D	??17 ??70 ??20 ??2	???7.83 ???9.68 ???10.36? ? ???1.27 ???0.59 ???0.46	???7.42 ???9.06 ???9.54? ? ???1.06 ???0.58 ???0.55	??11 ??45 ??117	???8.85 ???10.54 ???10.96? ? ???1.06 ???0.64 ???0.60	???8.01 ???9.88 ???10.12? ? ???1.01 ???0.77 ???0.76	? ??30 ??91	? ???11.24 ???11.62	? ???10.76 ???10.94	? ??16 ??36	? ??11.39 ??11.69													? ???10.68 ???11.25

^*：N：testnumber；D：d/a；a：additive?effect；d：dominance?effect.(Adapted?from?Li?Ning，1998)。

ESR gene and the FSH-beta gene obvious effect aspect the litter size of pig makes people have reason to think that the polymorphism of in the different colony of different kinds these two genes may be relevant with the difference of the farrowing performance of pig.Castagnoli in 1987 have reported the PvuII polymorphism in people's ESR site, and Rothschild in 1991 have reported the polymorphism of the PvuII in pig ESR site.Then people such as Rothschild in 1994 utilize the 1.3Kb cDNA of people's ESR to analyze for probe carries out RFLPs to a plurality of pig kinds that contain Chinese plum mountain pig blood relationship, find that wherein a kind of genotype can increase by 1.5 total litter size/tires and 1.0 product young number/tires alive significantly, its extent of dominance is respectively 1.31 and 0.43, reflects that gene action is explicit mode basically.Rothschild research group in 1996 is called the B gene with the gene of the peculiar 3.7Kb band of plum mountain pig of high litter size again, and the unnamed gene of the 4.3Kb band that corresponding low litter size kind contains is the A gene.1997, Li Ning etc. were the candidate gene of litter size key-gene with the ESR gene, and the cDNA of the 1.8Kb of personnel selection ESR gene is a probe, and the DNA of the pig of different varieties has been carried out the RFLPs polymorphism analysis that the PvuII enzyme is cut.Found that four kinds of different multiformities, the special band of 2.5Kb and 4.0Kb is promptly arranged in painted face in Beijing opera, plum mountain pig has the special band of 2.5Kb, 4.3Kb or 2.8Kb, 4.0Kb; And big York and big two pigs show the heterozygous of Taihu Lake pig and European pig in this site banding pattern complexity.

Relatively the difference of the PvuII endonuclease bamhi that Li Ning and Rothschild reported may be because the concentration of Marker that uses and gel is variant, the difference of the artificial estimation that is caused.In addition, Li Ning research group also detects the specific fragment of 2.5Kb in the painted face in Beijing opera pig, in big York, also find have the special band result of 3.7Kb of plum mountain pig consistent with Rothschild, it can be interpreted as the Chinese Pigs kind that big yorker may originate from input Britain before the 19th-century.

In order to determine more pigs genotype only, American I owa state university cooperates and has developed a kind of PCR-RFLPs testing method of the ESR of detection polymorphism with PIC company.This chamber Zhao wants people such as wind, Li Ning also to set up the PCR and the PCR-RFLPs testing method (Zhao Yaofeng, 1998) of FSH-Beta gene polymorphic.The present invention's method and program to the polymorphic analysis of ESR and FSH-β gene on the basis of previous work improved, make it more easy fast, polymorphism information content greatly improves, and also greatly reduces the detection cost.The partial sequence of the ESR gene that we measured also provides necessary material for designing and developing of mark of correlation.

American I owa state university and PIC company cooperate the PCR-RFLPs testing method of detection ESR polymorphism of (people such as Short.TH in 1997) development owing to the position of the primer and the reasons such as length of amplified fragments, make two segmental length that the PCR product forms after the PvuII enzyme is cut relatively near (one for 56bp another is 65bp), need the sepharose (4%) of high-resolution preferably two bands to be separated, it is higher to detect cost like this, and ESR is polymorphic polymorphic relevant with the litter size of pig with FSH-β, therefore two polymorphic detections if can be merged and to improve detection efficiency greatly, reduce cost, improve the polymorphism information content of analytical results simultaneously.

One of purpose of the present invention is the partial sequence that the clone has measured the ESR gene.

Two of purpose of the present invention is the partial sequence redesign primers according to the ESR gene of being measured, and has set up the PCR-RFLPs method of a new detection ESR gene pleiomorphism.

Three of purpose of the present invention has provided the polymorphic method that detects ESR gene and FSH-Beta gene simultaneously, this method is adjusted the position and the sequence of the polymorphic detection the primer of ESR gene PCR-RFLPs, reduce on the one hand ESR gene polymorphic PCR-RFLPs detect in the concentration of used sepharose, thereby the cost when reducing this mark and using separately.On the other hand that the PCR-RFLPs of ESR gene is the polymorphic and polymorphic detection union operation of PCR FSH-β gene detects cost thereby further reduce, and improves detection efficiency.For the breeding work of pig provides more succinct, fast effectively and the lower genetic marker of cost, the partial sequence of the ESR gene that we measured can be used for the exploitation of mark of correlation.

The present invention is achieved in that

To be the probe genomic dna of cutting pig with the PvuII enzyme carry out RFLPs to the colony of pig analyzes (probe mark and Southern hybridization are closed specification sheets referring to the digoxigenin labeled hybridizing reagent and carried out) with people's ESR full length gene cDNA (1.8kb) in the present invention, find at RFLPs and analyze the individuality that occurs the 3.7kb band in the collection of illustrative plates, used PvuII restriction enzyme cut when the genomic dna usefulness that this is individual was carried out the RFLPs analysis, electrophoresis reclaims the DNA in its 3.0-4.0kb scope, and it is cloned on pGEM-7zf (+) carrier, method screening (the ESR full length gene cDNA sequence that probe is behaved, method is closed specification sheets with reference to the fluorescent mark hybridizing reagent) by bacterium in situ hybridization has obtained three positive colonies.Positive colony is after enzyme is cut evaluation correctly, selecting one of them to carry out sequencing (carries out with Dye-primer Sequencing Kit and ABI 377 DNA sequencer, the method reference reagent closes the operation instruction with sequenator), obtained this segmental 5 ' end and 3 ' end parts sequence.

According to Short in 1997, the primer sequences that the people delivered such as TH (primer I: 5 '-CCTGTTTTTACAGTGACTTTTACAGAG-3 ', primer I I5 '-CACTTCGAGGGTCAGTCCAATTAG-3 '), synthetic primer carries out the PCR-RFLPs analysis to the kind (painted face in Beijing opera pig, Large White, the fragrant pig of landrace, duroc and two flesh stern pig) of different pigs.

PCR reaction system: 2.5 μ l, 10 * Taq dna polymerase buffer liquid (500mmol/LKCl, 100mmol/L TrisCl, 15mmol/L MgCl ₂, 0.01% gelatin), 2 μ ldNTPs (2.5mmol/L for each), primer final concentration 0.5 μ mol/L, 1U Taq archaeal dna polymerase, template DNA 50-100ng.Final volume 25 μ l

The PCR reaction conditions:

94 ℃ of 60 ℃ of 70 ℃ of circulations in 1 minute in 1 minute in 4 minutes, then 94 ℃ 1 minute, 60 ℃ 1 minute, 70 ℃ of 31 circulations in 1 minute, last 72 ℃ of 8 minutes 4 ℃ of long-time preservations.

Endonuclease reaction system and reaction conditions: 10 μ l PCR products add the PvuII restriction enzyme of 0.5 μ l (10U), 37 ℃ of digestion spend the night (5-12 hour).

Agarose gel electrophoresis with 4% detects enzyme and cuts the result.

Determine to comprise in the amplified fragments homozygous individual at PvuII point of contact, be that template is carried out pcr amplification with above-mentioned primer with this individual genomic dna then, and pcr amplification product be cloned on the carrier of pGEM-T-vector.Obtain this segmental nucleotide sequence (sequence measurement is the same) through sequencing.These sequences that we measured can be used for developing the genetic marker (as PCR-RFLPs mark, RFLPs mark etc.) that detects the ESR gene polymorphic, do not see the report of these sequences in GenBank.

3.7kb and 121bp two segmental sequencing results are analyzed, show that the PvuII endonuclease bamhi of pcr amplification district 56bp is positioned at the start-up portion of 3.7kb fragment forward sequence, therefore, according to 3.7kb sequencing fragment consequence devised a reverse primer (primer I II:5 '-CAGTTGAGAGCAAATCAATGCTAAG-3 '), combine with the forward primer (primer I) of employed primer centering in the aforementioned detection, detect the PCR-RFLPs polymorphism of ESR gene with restriction enzyme PvuII.

PCR reaction system: 2.5 μ l, 10 * Taq dna polymerase buffer liquid (500mmol/LKCl, 100mmol/L TrisCl, 15mmol/L MgCl ₂, 0.01% gelatin), 2 μ ldNTPs (2.5mmol/L for each), primer final concentration 0.5 μ mol/L, 1U Taq archaeal dna polymerase, template DNA 50-100ng, final volume 25 μ l.

The PCR reaction conditions: 94 ℃ 4 minutes, 60 ℃ 1 minute, 72 ℃ of 2 circulations in 1 minute, then 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ of 31 circulations in 1 minute, last 72 ℃ 8 minutes, 4 ℃ of prolonged preservation.

Endonuclease reaction system and reaction conditions: 10 μ l PCR products add the PvuII restriction enzyme of 0.5 μ l (10U), 37 ℃ of digestion spend the night (5-12 hour).

Agarose gel electrophoresis detection enzyme with 2.5-3% is cut the result.

Can produce three kinds of bands when detecting ESR gene polymorphic with this method, length is respectively 246bp (A haplotype) and 185bp, 65bp (B haplotype) and Short in 1997, the primer PCR amplified production that the people delivered such as TH produces other three kinds of different lengthss after the PvuII enzyme is cut dna fragmentation is 121bp (A haplotype) and 65bp, 56bp (B haplotype), both compare, use the sepharose (2.5-3%) of low concentration just three fragments well can be separated in the method that we invented, and Short in 1997, need to use 4% the sepharose could be separately in people's such as TH the method with three dna fragmentations, thereby our method is improved the detection of the PCR-RFLPs of ESR gene, reduce the concentration of sepharose when detecting and improved the readability that the PCR-RFLPs band is differentiated simultaneously, made the genotypic detection of ESR more economical and simple.

Synthetic other two pairs of the content that takes wind Ph D dissertation in 1998 with reference to Zhao detects the polymorphic primer of FSH-beta gene PCR-RFLPs:

Primer I V:5 '-ACTGGTCTATTCATCCTCTC-3 '

Primer V:5 '-CCTTTAAGACAGTCAATGGC-3 ' detects primer I with the ESR gene polymorphic, III and FSH-beta gene polymorphic detect primer I V, V merges, two pairs of primers are put in carry out PCR reaction in the same reaction system, grope suitable PCR reaction conditions, after treating the PCR stable reaction conditions, colony to the different varieties pig analyzes with this method, promptly use this reaction system and under determined PCR reaction conditions, carry out the PCR reaction, then the PCR reaction product is carried out enzyme with PvuII and cut, the electrophoretic examinations enzyme is cut result's (concentration of used sepharose is 4%).

PCR reaction system: 2.5 μ l, 10 * Taq dna polymerase buffer liquid (500mmol/LKCl, 100mmol/L TrisCl, 15mmol/L MgCl ₂, 0.01% gelatin), 2 μ ldNTPs (2.5mmol/L for each), primer final concentration 0.5 μ mol/L, 1U Taq archaeal dna polymerase, template DNA 50-100ng.Final volume 25 μ l.

The PCR reaction conditions: 94 ℃ of 58 ℃ of 70 ℃ of 1 circulations in 1 minute in 1 minute in 4 minutes, 94 ℃ of 58 ℃ of 70 ℃ of 31 circulations in 1 minute in 1 minute in 1 minute then, last 72 ℃ 8 minutes, 4 ℃ of prolonged preservation.

Endonuclease reaction system and reaction conditions: 10 μ l PCR products add the PvuII restriction enzyme of 0.5 μ l (10U), 37 ℃ of digestion spend the night (5-12 hour).

Agarose gel electrophoresis with 4% detects enzyme and cuts the result.This method detects the polymorphic of two genes simultaneously in same system, therefore greatly reduce two costs in the gene polymorphics detection, time and manpower is saved, simultaneously the heterozygosis frequency of analytical results is greatly improved, thereby increased the polymorphism information content of analytical results, for the auxiliary work of infiltrating of marker assisted selection in the breeding work or mark provides a molecular genetic marker more efficiently, simple and easy to do, that polymorphism information content is higher.

The present invention clones the partial sequence of having measured the ESR gene, comprise a restriction enzyme PvuII site in the row that check order with polymorphism, therefore can be used for developing the genetic marker mark (as PCR-RFLPs mark, RFLPs mark etc.) that detects the ESR gene polymorphic.

The contriver has set up the PCR-RFLPs method of a new detection ESR gene pleiomorphism according to the partial sequence redesign primer of the ESR gene of being measured.The PCR product can produce the dna fragmentation of three kinds of length in this method after the PvuII enzyme is cut, be 246bp (A haplotype) and 185bp, 65bp (B haplotype), and Short in 1997, the primer PCR amplified production that the people delivered such as TH produces other three kinds of different lengthss after the PvuII enzyme is cut dna fragmentation is 121bp (A haplotype) and 65bp, 56bp (B haplotype), both compare, use the sepharose (2.5-3%) of low concentration just three fragments well can be separated in the method that we invented, and Short in 1997, need to use 4% the sepharose could be separately in people's such as TH the method with three dna fragmentations, thereby our method improvement the detection method of PCR-RFLPs of ESR gene, reduce the concentration of sepharose when detecting and improved the readability that the PCR-RFLPs band is differentiated simultaneously, made the genotypic detection of ESR more economical and simple.

Take the synthetic polymorphic primer of a pair of detection FSH-beta gene PCR-RFLPs of content of wind Ph D dissertation in 1998 with reference to Zhao, employed primer and FSH-beta gene polymorphic in the ESR gene polymorphic detection method that we rebulid are detected primer to be merged, two pairs of primers are put in carry out PCR reaction in the same reaction system, and with PvuII cutting PCR product, thereby set up an energy detects ESR gene and FSH-Beta gene simultaneously in same system polymorphic method, this method on the one hand, greatly reduce two costs in the gene polymorphics detection, time and manpower is saved, material resources, make simultaneously that the heterozygosis frequency greatly improves in the detected result, thereby increased the polymorphism information content of analytical results, for the auxiliary work of infiltrating of marker assisted selection in the breeding work or mark provide one more effective, simple and easy to do, the molecular genetic marker that polymorphism information content is higher.

The simple declaration of accompanying drawing

The forward sequencing result of Fig. 1 .3.7Kb positive colony.

The result of Fig. 2 .3.7Kb positive colony backward sequencing.

Fig. 3 .121bp PCR product sequencing result.

The listed sequence of Fig. 1-3 can be directly used in the research and development of molecular labeling of the polymorphic detection of ESR gene. These sequences have no report in GenBank. The mensuration of its sequence still belongs to the first time.

The different detection methods of Fig. 4 detect the ESR gene and FSH-Beta gene pleiomorphism result (A) is application Short in 1997, the method that TH delivers, the electrophoresis pattern that the PCR-RFLPs of the ESR gene that individual difference and the kind of different pigs are carried out analyzes, Ago-Gel concentration is 4%. (B) electrophoresis pattern of analyzing for the PCR-RFLPs that uses the ESR gene that method that we rebulid carries out individuality and the different cultivars of different pigs, Ago-Gel concentration is 2.5%. (C) electrophoresis result for wanting the method in the wind thesis for the doctorate that individuality and the different cultivars of different pigs are carried out FSH-Beta gene PCR polymorphism analysis with Zhao in 1998. (D) want wind thesis for the doctorate the primer to be incorporated in the same reaction system for detection ESR gene PCR that I is designed-RFLPs polymorphism the primer and Zhao, simultaneously the electrophoresis pattern of and FSH-Beta gene PCR Polymorphism Analysis polymorphic to the individualities of different pigs and different cultivars ESR gene PCR-RFLPs.

From Fig. 4 (A) and result (B) can find out (1) with regard to the detection of independent ESR gene polymorphic, in the situation that Ago-Gel concentration has reduced, the method for using our redesign has obtained very satisfied result too. (B) from Fig. 4, (C) and (D) we can find out, it is polymorphic polymorphic with the PCR FSH-Beta gene that the primer of the new detection ESR gene pleiomorphism that we are designed and FSH-Beta gene pleiomorphism detection the primer are incorporated in the PCR-RFLPs that detects simultaneously the ESR gene in the same reaction system, its specificity has identical effect with electrophoretic resolution with independent the detection, greatly saved the time but merge to detect, manpower, material resources, thus the heterozygosis frequency that has improved simultaneously again analysis result has improved the polymorphism information content of analysis result. Therefore merge the polymorphic detection that detection method is two genes, the work of the auxiliary infiltration of the marker assisted selection in the breeding work of pig or mark etc. provides a more detection means of practicability and effectiveness.

Embodiment 1

The clone of ESR gene measures one, experiment material and method 1, experiment material 1.1 bacterial strains and cloning vector bacterial strain uses therefor of the present invention are as follows:

Strain name	Phenotype and genotype
		DH5α	?supE44?ΔLac169(Φ80?LacZ?ΔM15)hsdR17?RecA?endA1?gyrA98?thi-1?recA1
JM109	?recA1?supE44?endA1?hsdr17?gryA96?relA1?thiΔ(lac-proAB)F′〔traD36 ?proAB +?laI q?LacZ?ΔM15)

The used cloning vector of the present invention is that pGEM 3zf (+/-) vectorspGEM 7zf (+/-) vectorsPGEM-T Vectors is all from the 1.2. of Promega company tissues of experimental animals sample and blood sample

Organize sample and the blood sample of different varieties pig pick up from the state-run farms producing good poultry and animal strains in Changshu City, Jiangsu Province, ChangPing, Beijing City county Chinese Small-sized pig breeding field, and pig farm, kind pig farm, Ninghe, Tianjin, kind pig farm, Wuqing, Tianjin, pig farm, southern suburbs, Beijing are planted by flood dragon bridge Jiangxi Province, Nanchang City.1.3. probe: the plasmid pSG5-EHO that has people's ESR 1.8kb cDNA probe is given by the U.S..1.4. enzyme and reagent

Various restriction enzymes and modifying enzyme are respectively available from Huamei Bio-Engrg Co.,, Biolab company and Promega company; DIG mark and detection kit are from German BM company; Fluorescent mark and detection test agent box are from Amersham company; Nylon membrane is from Amersham company; The X-ray sheet is from Tianjin Photosensitive Material Co..The PCR primer is synthetic by Shanghai bio-engineering corporation and Xi'an Mei Lian company.Other conventional reagent is from material supply section of China Agricultural University.1.5.DNA analysis software

Homology analysis software: GENETYX-MAX8.5,

PCR primer-design software: OLIG04.0,

The preparation of data analysis software: SAS (6.12 version) .2, experimental technique (Methods) 2.1 damping fluids and common agents

TE damping fluid: 10mM TrisCl, 1mM EDTA, pH8.0, autoclaving.The autoclaving condition is 1.034 * 10 ⁵Pa, 20 minutes.

STE damping fluid: 0.1M NaCl, 10mM TrisCl, 1mMEDTA pH8.0, autoclaving.

50X TAE damping fluid: Tris alkali 242g, 57.1 milliliters of glacial acetic acids, 100 milliliters of 0.5MEDTA (pH8.0) add water to 1L.

5 * tbe buffer liquid: Tris alkali 54g, boric acid 27.5g, 20 milliliters of 0.5M EDTA (pH8.0) add water to 1L.

Plasmid DNA is extracted solution I: 50mm glucose, and 2.5mM TrisCl (pH8.0),

10mM EDTA (pH8.0), 10 pounds of autoclavings 15 minutes are stored in 4 ℃.

Plasmid DNA is extracted solution II: 0.2M NaOH, and 1%SDS, now with the current.

Plasmid DNA is extracted solution III: 60 milliliters of 5M potassium acetate solutions, 11.5 milliliters of glacial acetic acids, 28.5 milliliters of aqua sterilisas.

Fluorescent hybridization diluent (dilution buffer A): 100mM TrisCl, 300mMNaCl, pH9.5, autoclaving.

IPTG solution: IPTG 1g is dissolved in 50 milliliters of distilled waters, and filtration sterilization, packing are stored in-20 ℃.

1M TrisCl:121.14g Tris alkali is dissolved in 800 milliliters of distilled waters, with hydrochloric acid adjust pH to 8.0, is settled to 1000 milliliters, autoclaving.

0.5M EDTA:EDTA 186.1g is dissolved in 800 milliliters of distilled waters, with NaOH adjust pH to 8.0, is settled to 1000 milliliters, autoclaving.

3M NaAc (pH7.0): NaAc3H ₂O 408.1g is dissolved in 800 milliliters of distilled waters, transfers pH to 7.0 with glacial acetic acid, is settled to 1000 milliliters, autoclaving.

3M NaAc (pH5.2): NaAc3H ₂O 408.1g is dissolved in 800 milliliters of distilled waters, transfers pH to 5.2 with glacial acetic acid, is settled to 1000 milliliters, autoclaving.

20 * SSC:NaCl 175.3g, Trisodium Citrate 88.2g are dissolved in 800 ml waters, and adjust pH to 7.0 is settled to 1000 milliliters, autoclaving.

1M CaCl ₂: CaCl ₂6H ₂O 27g adds water to 100 milliliters, and filtration sterilization is stored in-20 ℃.

10%SDS:SDS 100g is dissolved in 900 milliliters of distilled waters, is heated to 68 ℃ of hydrotropies, with HCl adjust pH to 7.2, is settled to 1000 milliliters.

Alkaline denaturation liquid: 0.5N NaOH, 1.5N NaCl

Neutralizer: 3N NaCl, 0.5M TrisCl (pH7.4)

RNaseA solution: the 100mg/ milliliter is dissolved in 10mM TrisCl (pH7.5), and 100 ℃ were boiled 10 minutes among the 15mMNaCl, after the room temperature cooling, is stored in-20 ℃.

Lithium chloride: 212g LiCl is dissolved in 1L distilled water, autoclaving.

The using method of photographic developer and fixing salt is with reference to the operation instruction preparation of Shijiazhuang City chemical industry ten factories.

Hybridization buffer: 5 * SSC, 0.1% (W/V) SDS, 5% dextran, 1/20V blocking agent.

Blood DNA extracting solution: 10mM TrisCl (pH8.0), 0.1M EDTA (pH8.0), 20 μ g/ milliliter Pancreatic RNases, 0.5%SDS.

The tissue DNA extracting solution:

	The concentration of storage liquid	The concentration of using
			Rnase	The 10mg/ milliliter	The 20ug/ milliliter
Proteinase K	The 10mg/ milliliter	100～200g/ milliliter
			Tissue DNA extracts solution	?????1CK(pH8.0)	?????50mM
?????0.5MEDTA(pH8.0)	?????100mM
		?????2MNaCl		?????100mM
?????10％SDS	?????1％

2.2. the preparation (CaCl of competent cell ₂Method) picking DH5 α or JM109 intestinal bacteria original seed are streak culture on the LB agar plate, and picking is cultured fresh single bacterium colony just, is inoculated in 100 milliliters of LB substratum, and 37 ℃ are cultured to OD600 and reach 0.4～0.5.Bacterium is transferred in 100 milliliters of centrifuge tubes of sterilization of a precooling, ice bath 10～15 minutes, 4000rpm, 4 ℃ centrifugal 10 minutes, to reclaim bacterial precipitation, adds 20 milliliters of 0.1M CaCl that ice precooling ₂The suspension bacterial precipitation, ice bath is 10～15 minutes then, 4000rpm, 4 ℃ centrifugal 10 minutes, reclaim bacterial precipitation, add 4 milliliters of 0.1M CaCl ₂The resuspended bacterial precipitation of solution, cell at this moment can be directly used in transformation experiment.Glycerol adding to final concentration is 15%～20%, and mixing is distributed into 200 μ l-aliquots, and is frozen in-70 ℃.2.3. the small-scale of plasmid DNA is extracted---alkaline lysis

(1) inoculation one single bacterium colony is in 3 milliliters of LB liquid nutrient mediums that contain 70ug/ milliliter Amp, 220rpm, 37 ℃ of shaking culture spend the night (8-10 hour).

(2) 10,000rpm, 4 ℃ centrifugal 5 minutes (do not have 4 ℃ of condition normal temperature also can) collects thalline.

(3) an amount of resuspended bacterial precipitation of STE, 3 milliliters of cultures are deposited in 1.5 milliliters of centrifuge tubes, 4 ℃ centrifugal 5 minutes, collect thalline.

(4) use up STE liquid, add the 200ul solution I, vibrate abundant suspension cell in solution I.

(5) add the new solution II 200ul for preparing, will manage and put upside down mixing rapidly 10 times, room temperature left standstill 5 minutes.

(6) add solution III 200ul, will manage and be inverted vibration 1 minute, ice bath 5 minutes.

Centrifugal 8 minutes of (7) 1,2000rpm carefully get supernatant in centrifuge tube.

(8) use with the saturated phenol of the isopyknic Tris of supernatant, phenol/chloroform, chloroform in turn extracting once keep water.

(9) add the 3M NaAc of the pH5.2 of 1/10 volume, add the dehydrated alcohol of 2 volumes again, precipitation is 15 minutes in-70 ℃ of refrigerators.

(10) the centrifugal supernatant of abandoning adds 70% washing with alcohol precipitation.

(11) the centrifugal supernatant of abandoning, vacuum is drained, and removes trace ethanol.

(12) add 50ul TE add simultaneously 1ul RNase put into 37 ℃ 2 hours.

(13) electrophoretic examinations content.2.4. a large amount of preparations of plasmid DNA

The single bacterium colony of inoculation intestinal bacteria is in 100 milliliters of LB liquid nutrient mediums, 37 ℃ of overnight incubation, with 4000rpm, 4 ℃ centrifugal 10 minutes, collect thalline, abandon supernatant, bacterial precipitation is resuspended with the STE solution of 20 milliliters of ice precooling, again centrifugal as stated above, remove supernatant, be inverted, blot debris, the plasmid that adds the ice precooling extracts 2 milliliters of solution I, and bacterial precipitation is resuspended, and (the 10mg/ milliliter is dissolved in 10mM TrisCl to add the new lysozyme soln of preparing of 200 μ l, pH8.0), mixing, the plasmid that adds 4 milliliters of new preparations extracts solution II, covers tight centrifuge tube lid, slowly put upside down for several times, fully the mixing content was placed 5～10 minutes in room temperature, added 2 milliliters of ice-cold plasmids and extracted solution III, centrifuge tube is put upside down for several times, ice bath 15 minutes can see that the adularescent flocks produces 12,000rpm, 4 ℃ centrifugal 20 minutes, supernatant is transferred in another centrifuge tube, add 0.6 times of volume Virahol, abundant mixing, placed 10 minutes 10000rpm, centrifugal 15 minutes of room temperature in room temperature, recovery plasmid precipitation, remove supernatant, wash precipitation once, drain slightly with 70% ethanol, be dissolved among 1 milliliter of TE, add 5 μ l RNaseA (5mg/ milliliter), 37 ℃ digested 1 hour, and were transferred to little centrifuge tube, use isopyknic phenol, phenol: chloroform, chloroform, each extracting is once, the 10M NH4AC that adds 1/5 volume, the dehydrated alcohol that adds 2 times of volumes again, mixing, room temperature was placed 30 minutes, 12,000rpm, centrifugal 10 minutes of room temperature is abandoned supernatant, wash precipitation twice with 70% ethanol, vacuum is drained, and is dissolved among an amount of TE, is stored in-20 ℃.

2.5. the Rapid identification of recombinant plasmid size---Cracking method picking transforms the back at the dull and stereotyped white colony of cultivating of x-gal, the LB lining out that contains Amp at another piece was cultivated 12～16 hours, choose a locus coeruleus simultaneously and do contrast, with a small amount of thalline of toothpick picking, be applied in the centrifuge tube that contains 20 μ l aqua sterilisas, vibration, fully behind the suspension thalline, 2 * Cracking the buffer that adds equal-volume 20 μ l, thermal agitation 2 minutes, 12, behind centrifugal 5 minutes of the 000rpm, whether get sample electrophoresis on supernatant 10～20 μ l, compare with the lysate of locus coeruleus, detecting plasmid has and inserts and approximate size.

2.6. the extraction of pig blood DNA

Collect about 10 milliliters of fresh bloods, add 1.5 milliliters of ACD, mixing, fresh blood with 1300g centrifugal 15 minutes are abandoned upper plasma, and the yellowish layer of intermediary is moved in the pipe; Frozen blood then after room temperature is melted, moves in the centrifuge tube, adds equal-volume PBS damping fluid, in room temperature centrifugal 15 minutes with 3500g, and abandoning supernatant.Add 5 milliliters of DNA extraction buffers, resuspended throw out, in 37 ℃ of incubations 1～2 hour, adding proteolytic enzyme k is 100 μ g/ milliliters to final concentration, mixing, and 55 ℃ digested 6～10 hours, in solution, no longer include the heavy-gravity agglomerate, solution is cooled to room temperature, adds equal-volume phenol, put upside down centrifuge tube repeatedly, mix formation emulsion until two-phase, 12,000rpm, centrifugal 15 minutes of room temperature, get supernatant, use equal-volume phenol again: chloroform, each extracting of chloroform 1 time is got and is reset and added 1/10 volume NaAc (3M, pH5.2) and 2 times of volume dehydrated alcohol deposit D NA, DNA chosen be put in one 1.5 milliliters of centrifuge tubes, wash twice, (attention can not be too dried) after the DNA drying is dissolved in an amount of TE or the sterilization distilled water with 70% ethanol.

2.7. porcine tissue DNA extraction

1. shred tissue block as possible;

2. (10 minutes) are drained in being organized in the vacuum machine of will shredding;

3. add 600ul tissue DNA extracting solution, mixing;

4. adding RNase is the 20ug/ milliliter to final concentration, and 37 ℃ digested 1-2 hour;

5. adding Proteinase K to final concentration is 100～200ug/ milliliter, and 55 ℃ digested 12～24 hours;

6. phenol chloroform (1: 1) extracting is twice;

7. the chloroform extracting once;

8.2 doubly the NaAc of volume dehydrated alcohol and 0.1 volume (3M, pH 5.2) precipitates;

9. precipitation is changed in another pipe;

10.70% ethanol is washed once;

11. vacuum is drained or is dried naturally;

12. an amount of sterilized water or TE dissolving DNA;

13. electrophoresis detection DNA concentration;

14.-20 ℃ preservation.

2.8. the segmental preparation of purpose (freeze-thaw method)

1. get 10 μ g plasmid DNA, 200 μ l systems, 37 ℃ of enzymes of 10u restriction endonuclease were cut 3 hours.

2. add 25.8 μ l 1M Tris Cl (pH7.5), the 10u restriction endonuclease adds ddH ₂37 ℃ of enzymes of O to 300 μ l were cut 2 hours.

3. the enzyme that takes a morsel is cut product inspection enzyme and is cut effect.

4.0.8% agarose, electrophoretic separation purpose fragment on the glue.

5. cutting-out contains purpose fragment gel, and chopping places 1.5 milliliters of centrifuge tubes.

6. add equal-volume phenol mixing.

7. placed 3-5 minute in the liquid nitrogen, room temperature is thawed, and repeats secondary.

8. 8000g, centrifugal 8 minutes.

9. get that to reset and add equivalance phenol imitative, chloroform is respectively taken out one time.

10. add 2 times of volume dehydrated alcohols, 1/10 times of volume 3M NaAc (pH5.2), put 20 minutes in-20 ℃.11. 1, centrifugal 10 minutes of 2000rpm.12. 70% ethanol is washed one time, drains to be dissolved in 20 μ l TE (pH8.0).13. survey the OD value, electrophoretic examinations.

2.9. luciferin gene image probe mark

1. getting 1 μ g purpose fragment is diluted to 20 μ l and seals.

2. 100 ℃ of water-bath sex change are 10 minutes, ice bath 10 minutes.

3. add the mixture of ribonucleotides 10 μ l in the luciferin gene imaging labelling kit successively, primer 5 μ l, Klenow (4u/ μ l) 1 μ l adds water to 50 μ l.

4. mixing is instantaneous centrifugal, and 37 ℃ of water-bath marks spend the night.

5. add EDTA (pH8.0) to final concentration 20mM, termination reaction.

6.-20 ℃ keep in Dark Place.2.10. probe mass is identified

1. will contrast probe dilution to 5,1,0.5,0.2,0.1pg/ μ l.

2. each point 1 μ l is on nylon membrane, with contrasting probe on the time point, 0.000625 μ l, 0.0025 μ l, 0.025 μ l, 0.25 μ l, 0.5 μ l.

3. take out film and put into GS.Gene Linker ^TMUse C among the UV chamber ₃Program baking 1-2 time.

4. with 2 * SSC, washed 15 minutes for 60 ℃.

5. film is put on the filter paper and blotted, in the darkroom, press an X-ray sheet.

6. after exposing 30 minutes, developed photographic fixing 10 minutes 5 minutes.

7. estimate the concentration of label probe.2.11. hybridization

1. prehybridization solution is heated to 60 ℃.

2. film is sealed, added 22 milliliters of prehybridization solutions, 60 ℃ of jogs 3 hours.

3. with the probe sex change, be added in the prehybridization solution, make the probe final concentration reach the 30pg/ milliliter.

4. 60 ℃ of hybridization are spent the night.2.12. wash film

1. 200 milliliters of 1 * SSC, 0.1%SDS, 60 ℃ of jogs 15 minutes.

2. 200 milliliters of 0.5 * SSC, 0.1%SDS, 60 ℃ of jogs 15 minutes.

3. it is wetting film to be put into dilution buffer liquid.

4. jog 1 hour in 15 milliliters of dilution buffer liquid A that contain the 1/10V blocking agent.

5. repeating step (3) once.

6. with 3 milliliters of dilution buffer liquid A, add BSA to 0.5% (w/v), dilution fluorescein antibody

10,000 times, film was at room temperature shaken 1 hour.

7. with the dilution buffer liquid A that contains 0.3% (V/V) Tween20, washed film 10 minutes.

8. repeat (7) twice.

9. repeat (3) once.2.13. signal produces and detects

1. Xi Hao film drains unnecessary dilution buffer liquid A.

2. nylon membrane is enclosed in the plastics bag, sample faces up.

3. add 0.5 milliliter of detection reagent, applied.

4. go to the darkroom and press the X-ray sheet, exposed 2 hours.

5. developed photographic fixing 10 minutes 5 minutes.

6. contrast X-ray sheet and electrophoresis photo are analyzed.2.14. denatured DNA is transferred to after the DNA electrophoresis finishes on the nylon membrane, take out gel, with the soaking with sodium hydroxide gel of 0.25M 20 minutes.Remove the gel nonuseable part, with one greater than the synthetic glass of gel or plate as platform, put into a big plate, put 3 thick filter paper of 20 * SSC wetted above and make paper bridge, attention is caught up with except that bubble.On filter paper, put gel successively, the nylon membrane onesize with gel, 3 bed thickness filter paper, one pile of paper handkerchief is poured 20 * SSC in big plate, make liquid level a little less than platform surface.Total system adds a weight after sealing with preservative film on paper handkerchief.Shift after 6～12 hours, take out nylon membrane,, film is placed on the clean filter paper dries with 5 * SSC solution soaking filter membrane 5 minutes.

120 ℃ were toasted 30 minutes or with after the UV crosslinker irradiation, hybridized.2.15.DIG the mark of probe and hybridization detect the I. probe mark with 1 μ g dna profiling, are dissolved in the 16 μ l aqua sterilisas, boil in boiling water 10 minutes, are inserted in 10 minutes on ice.Add 4 μ l DIG High Primer solution, mixing, centrifugal.37 ℃ of marks spend the night, and add 2 μ l 5M LiCl, 80 μ l ethanol, and-70 ℃ precipitate 2 hours.Centrifugal, after the precipitation drying, be dissolved among the 50 μ l TE, measure labeling effciency.The hybridization of II.DIG label probe is put into hybridization bag with film and is added DIG mark hybridization solution, and volume is 20 milliliters/100cm ²Film was 42 ℃ of constant temperature shaking bath prehybridizations 2 hours.Prehybridization solution is outwelled, added (5 milliliters/100cm of hybridization solutions containing label probe ²Film), after sealing, 42 ℃ of water-bath hybridization 16 hours.Reclaim hybridization solution, with 2 * SSC, the film washing liquid of 0.1%SDS was washed 2 * 5 minutes in room temperature, used 0.1 * SSC then with film, and the film washing liquid of 0.1%SDS was 68 ℃ of rinsings 2 * 15 minutes.

Film is placed among the DIG Buffer I simple rinsing once, is placed among an amount of DIG Buffer II, shake frequently in room temperature incubation 30 minutes.Film is put into an amount of antibody diluent (the DIG Buffer II that contains 150mU/ milliliter antibody) soaked 30 minutes, rock gently constantly.Washed film 2 * 15 minutes with DIG Buffer I.Film was put into Buffer III balance 2 minutes.Take out film, put into a plastics bag, add an amount of developer, in the dark carry out color reaction.A2.16. the recycling 1.5 * SSC of Hybond membrane washed film 1-2 minute.

2. the 0.1%SDS solution that will boil waters on film, shakes on shaking table and washes film 15 minutes.

3. repeat 2 twice, with washed film store in 4 ℃ standby.2.17. the dephosphorylation of cloning vector

1. with SmaI digestion 20ug pGEM7zf (+), be cut into linear back with isopyknic phenol/chloroform extracting DNA once.

2. the 3M NaAc (pH7.0) that adds 0.1 volume in the supernatant liquor, the dehydrated alcohol of 2 times of volumes, place 15 minutes on ice after, 1, centrifugal 15 minutes of 2000rpm, abandon supernatant, the washing with alcohol with 70%, centrifugal, precipitate with 90ul 10mM Tris.cl (pH8.3) dissolving DNA after the dry ethanol evaporation under the room temperature, take out about 200ng DNA ,-20 ℃ of preservations, the control group when connecting test as DNA.

3. remaining DNA (1ul point sample detectable level, 4ul does contrast).Add 10 * CIP buffer10ul, add CIP 1ul (1u), add 4ul H ₂O, 37 ℃ are incubated 15 minutes, (2ug 5Kb size linear DNA approximately contained 5 ' phosphate group about 1.4pmol/ in 45 minutes at 55 ℃ of water bath heat preservations then to add 0.5ul CIP, the 5 '-outstanding every 100pmol/L 5 ' phosphate group of DNA adds the CIP of 1 unit, 37 ℃ were reacted 30 minutes, and flat end or 3 '-outstanding every 2pmol5 ' phosphate group of DNA adds 1u CIP reaction conditions and sees before).

4. reacted the back at 75 ℃, 10 minutes deactivation CIP.

5. after being chilled to room temperature, add isopyknic phenol, phenol/imitate extracting respectively once.

6. supernatant moves in the Eppendoff pipe, adds the dehydrated alcohol mixing of 2 times of volumes of 3M NaAc (pH7.0) of 0.1 volume.Placed 15 minutes for 0 ℃, centrifugal.

7. remove supernatant, precipitation is washed with 70% ethanol, and is centrifugal, removes supernatant.

8. vacuum-drying, TE dissolving ,-20 ℃ of storages.2.18. the screening of positive colony---bacterium colony in situ hybridization

1. will transform the back cultured flat board put into 4 ℃ 2 hours.

2. with film shop onboard, push away flatly with glass rod, put 10 minutes.

3. on film, do 3 asymmetric holes with pin, in the hole, put aseptic blue ink again and carefully take out film, on another Amp plate, duplicate portion, the Amp plate is placed on 37 ℃ of cultivations.

4. film is placed on the filter paper that soaks into 10%SDS, bacterium colony was handled 3 minutes towards last.

5. film is placed on the filter paper that sex change liquid soaks into, bacterium colony faces up, and handles 5 minutes.

6. film being put into neutralizer handled 10 minutes.

7. putting into 2 * SSC handled 10 minutes.

8. take out film and put into GS.Gene Linker ^TMUse C among the UV chamber ₃Program baking 1-2 time.

9. hybridizing method is with 2.14 fluorescent hybridization hybridizing methods.2.19. the PCR product is linked linked system on the T carrier: 10 * T4 dna ligase damping fluid, 1 μ lT4DNA ligase enzyme (3u/ μ l), 1 μ lT carrier (30ng/ μ l), 1 μ lPCR product 60ng adds ddH ₂O to 10 μ l

16 ℃ of water-baths 2.20. that spends the night transforms

1. from-70 ℃ of competent cells that take out preservation, ice bath helps and melts.

2. 200 μ l competent cells add 5 μ l and connect product, ice bath 30 minutes.

3. 42 ℃ of water-bath heat shocks are 90 seconds, ice bath 2 minutes.

4. add 800 μ lLB, 37 ℃ of water-baths brought back to life 50 minutes.

5. spread 200 μ l in containing X-gal, IPTG, the LB flat board of Amp.

6. cultivated 9-16 hour for 37 ℃.2.21. screening recon

1. the picking hickie lines and scribbles X-gal, IPTG, the flat board of Amp.

2. connect the line bacterium in 2 milliliters of LB, incubated overnight.

3. alkaline denaturation extracts recombinant plasmid.

4. restriction endonuclease digests 0.5 μ g DNA.

5. electrophoretic examinations.A2.22. prepare template

1. alkaline denaturation prepares template.

2. transfer concentration to 0.1-0.2 μ g/ μ l.2.23.Dye Primer does the part order-checking to positive colony

1. alkaline lysis is prepared template, is diluted to 0.1-0.2 μ g/ μ l

2.PCR sequencing reaction system:

Base	A????C????G????T
		Template (μ l)	1????1????2????2
Premix(μl)	4????4????8????8
		Cumulative volume (μ l)	5????5????10???10

3.PE9600 PCR reaction

(1) .95 ℃, 30 seconds; 55 ℃, 30 seconds; 70 ℃, 1 minute; 15 circulations.

(2) .95 ℃, 30 seconds; 70 ℃, 1 minute, 15 circulations.

4. precipitate the PCR product

(1). reactant joined contain 100 μ l, 95% ethanol, in 1.5 milliliters of centrifuge tubes.

(2). placed on ice 15 minutes.

(3) .12,000rpm, centrifugal 15 minutes.

(4) ethanol of .250 μ l70% is washed one time.

(5). drain ,-20 ℃ of preservations are prepared order-checking and are gone up sample.2.24. utilize glass milk elution method to reclaim the PCR product

1. downcut required dna fragmentation from sepharose, be placed on 1.5 milliliters

Smash to pieces in the Eppendorff pipe, action is soft.

2. the sol solutions that adds 3 times of volumes is placed (or 50 ℃ of insulations 3 in 5 minutes under the room temperature

Minute), jog Eppendorff pipe dissolves glue several times fully therebetween.

3. add 10 μ l glass milk, put upside down mixing, ice bath was placed 10 minutes down.And

Every 2-3 minute mixing once.

4. 12, centrifugal 30 seconds of 000rpm inhales and abandons supernatant.

5. add 250 μ l rinsing liquids, inhale rinsing liquid with sample injector and gently glass milk is broken up all

Even, the centrifugal supernatant of abandoning.

6. repeated for the 5th step once.After having drawn rinsing liquid, in centrifugal again 10 seconds, use Tip

Head blots last a little rinsing liquid only.Then, be positioned over 37 ℃ of incubator dryings 20

Minute.

7. add an amount of sterile distilled water or TE (10-30 μ l), mixing.60 ℃ of water-baths 5 minutes.

8.12, centrifugal 1 minute of 000rpm, it is standby to reclaim supernatant, repeats 7-8 and goes on foot 1-2 time.Two, experimental result

1.ESR the clone of the RFLPs specific fragment of gene and partial sequence are analyzed the preparation of 1.1 probes

Have people ESR gene 1.8Kb cDNA plasmid (PSG5-EHO) after the EcoRI enzyme is cut,, reclaim the fragment of 1.8Kb through electrophoretic separation.Enzyme is cut and be the results are shown in Figure 5, reclaims and the results are shown in Figure 6.1.2. the preparation of genomic dna

From pig ear tissue piece, extract genomic dna, can be directly used in pcr amplification.Be used to do molecular hybridization if desired, should be through electrophoresis detection, determine tentatively whether the size of the purity of DNA and molecular weight and DNA degrade etc., and purity height, molecular weight genomic dna completely are the committed steps that guarantees Success in Experiment, and DNA is pure more good more.The DNA that purity is not high is difficult to the digestion of being limited property restriction endonuclease, the directly later experiment of influence.Pig ear tissue DNA sees Fig. 7.

Because the ESR gene is a single copy gene, when the RFLPs hybridization analysis, in order to obtain comparatively ideal hybridization signal, the genomic dna amount that enzyme is cut should be about 10ug-20ug, make fully dna digestion of enzyme, preferably DNA is divided into the 5ug/ pipe, in the 50ul reaction system, digest then, at last several enzyme Pipe Cutting Digestive systems are merged in 1 pipe, use ethanol sedimentation then, again dissolve with TE or sterilization distilled water, use in order to electrophoresis.Electrophoretic voltage is: 30V, the time is: 18 hours, enzyme was cut good genomic dna, should be for digesting uniform enzyme slitting band behind the electrophoresis.Enzyme is cut genomic dna and be the results are shown in Figure 9.

1.4. results of hybridization

Show by the southern results of hybridization to different varieties pig genomic dna: main polymorphism appears at size and is 3.7Kb, the band about 4.3Kb.Because genomic dna is selected, and in these 6 DNA samples, does not detect AA type (promptly have only the 4.3Kb band, and the 3.7Kb band do not occur).

1.5. the screening of positive colony and evaluation

The pig genomic dna of selecting to include the 3.7kb band in the above-mentioned hybridization reclaims size in 3.0Kb-4.0Kb left and right sides fragment after the PvuII complete digestion.Be connected to through linearizing and dephosphorylized PGEM-7zf+) on the carrier, filter out positive colony with the method for bacterium colony in situ hybridization, cut evaluation as enzyme then.By to 4 flat boards, the screening of about 600 single bacterium colonies filters out 3 positive colonies.After cutting evaluation, enzyme carries out sequential analysis then.

1.6. partial sequence analysis

To the 3.7Kb positive colony that filters out, utilize Dye Prime Kit to make forward and backward sequencing. ( 1 ) 3.7Kb：1 CTGTTCTTGT CAAGTCCCCA TTCCACCCTA TTCTAATTGG ACTGACCCTC GAAGTGTTTC TGCATGTGGT71 GCTGCTCTTG GGAGTGAATA GCTGCAGATG GGGCACAGGT GAGATGCTGG TTCGAGCCGA GGTGAGCAAG141 GGACTTGCCA ATGCCCCTTA GCATTGATTT GCTCTCAACT GATCTCTGCT TGTCATGAAA CAAGACTGGT211 TTATTTTTGT TTTTATTTCC ATTTCCCAAG GTGATGGAAC CAAAAAGATA TTGCTGTGAT TTATGGCAGA281 GTGTTCTGCC TATGTTTTCC TCTAAGAGTT TATAATACCT GGTTTTGCAT TTAGGTTTTT GATCTGCTTG351 AGTTTATTTT GTGTGTGGTG TTAGCATTCT CATCATTATT TTATATGTAT TGCGGTCCAC TTTCCAAGCA421 CCACTGCATG ATATGGCTTA ATGCAGAATA TAAAAAATGA TACAAATGAG CTAATTACAA AACAGAATAG491 ACTCACAGGA CATTGAAACA AACTATGGTA CCAAGGGGGA AAGTGAGGGN GAATAATAAG ACTTGGGATA561 ACAGATACNC CTGATATATA TAATNAGGGG GGTANCCAAA NGGCCAATGG CATACNCAGG GNGCGGACCC631 AAAACCTGGA AAACCCACAA NGGNAAGAAC NAAGAAGATT NTTATGCCNN NANGATACCG GNCNCTTGGA701 NAACCTGNAC CA ( 2 ) 3.7Kb：001 ATTTATGTGA CACTATAGAA TACTCAAGCT ATGCATCCAA CGCGTTGGGA GCTCTCCGGA TCCAATCTTA071 TCGATTTCGA ACCCCTGTGG CTCCAATTCA ACCCCTAGGC TGGGAACTTC CATATGCCAC AGGTATGGCC141 CTGAAAAGCA AAAAAAGCAA AAAAAATAAA AAATAGATAA GCAAACAAAC AGACAAAAGC AAACAAAAAG211 AAGCATAGGT CGTACACCTG AAACTAACAC AATATTGTAA ATCTACTATA TTTTTTTCNA AAAAAAGAAG281 CAAAGGTAGA AACATCAAGG GTTAAACATA GAATGTTATT GTCAAATTCT TAAACAGTTA AAGAATAATA351 TTCTAAATGA CAAAAAAGAC ATTCCTTGAA CAAGTTGTAA TAGGCATAAA AATTTATACA CTAAAAAATA421 GCTAAGAGCA AAATCTCTTG GAAATGAAGA GAATTCAATA AAAAAGGGNA ACCATATTGA GAGTCTAAAA491 TACCTCTCTT CCAATTTTTT AATTAAACAG CCAAAAAGGG GTATGTATAT AAATANNTTT GACAGCATAT561 TACCCATCTT GNTTTATGGG NTTTGGAANG GGGATCCCAT CNCTAAAGGG GGATTATCCT TTNNCCCNTA631 AGNTTGAAAA

At present the complete sequence of pig ESR gene is not also known, by with GenBank in the known array comparative analysis of pig and other animal ESR gene (known array of pig ESR gene has: hormone binding domain Exon5-8, the sequence of 5 ' flanking region Exonl), its homology very low (all about 40-50%).Thereby this section sequence is a unknown nucleotide sequence.

Embodiment 2

The optimization of the PCR-RFLPs polymorphism analysis one .PCR reaction conditions of ESR gene

The PCR reaction system: the reaction cumulative volume is 25 μ l, and 10 * damping fluid composition is 100mmol/LTrisCl, pH8.0,500mmol/L KCl, 15mmoLMgCl ₂, 0.1% gelatin.The dNTPs final concentration is 200 μ mol/L, and the primer final concentration is 0.5 μ mol/L, 1u Taq archaeal dna polymerase.The amount of DNA is 50-100ng.

The PCR reaction conditions:

72 ℃ of 8 minutes → 4 ℃ ∞ PCR instrument are Gene Amp PCR System 9700,9600 or 2400.

The pcr amplification of pig ESR gene is with reference to Short, the primer sequence synthetic primer that people such as TH (1997) are delivered.

Primer I: 5 '--CCT, GTT, TTT, ACA, GTG, ACT, TTT, ACA, GAG--3 '

Primer I I:5 '--CAC, TTC, GAG, GGT, CAG, TCC, AAT, TAG--3 '

Genomic dna to painted face in Beijing opera pig, Large White, landrace, fragrant pig, duroc, two flesh stern pigs carries out pcr amplification, all obtains one and longly is the band of 121bp.Two, the enzyme of the optimization PCR product of PCR-RFLPs reaction conditions is cut: get 10 μ l PCR products, add 0.5ul (10u/ul) PvuII restriction endonuclease, 37 ℃ of digestion are spent the night (5-12 hour), and 4% agarose gel electrophoresis detects.Pig ESR gene PCR product P vuII enzyme is cut the result, and (unified standard that the PvuII enzyme is cut: CAGCTG), be two bands after having the PCR product enzyme of PvuII restriction enzyme site to cut, size is respectively 56bp, 65bp.Three, the cloning and sequencing of pcr amplification product

Owing to there is not the relevant report of this sequence among the Genbank, simultaneously for proving that further the 3.7Kb clone is the correct foundation that reaches new ESR gene tester, we are connected to PCR product (is the PCR product of template with the genes of individuals group that has the PvuII restriction enzyme site in the PCR product) on the T-vector, positive colony is made double digestion identify.Plasmid DNA: 5ul

Buffer4：????3ul

NcoI：???????1ul

SalI：???????1ul

DdH ₂O:20ul37 ℃ digested 4-5 hour, then electrophoresis detection.

Utilize Dye Prime Kit that positive colony is checked order.The sequencing result in pcr amplification district:

10????????20????????30????????40????????50????????605’?CACTTCGAGGGTCAGTCCAATTAGAATAGGGTGGAATGGGGACTTGACAAGAACAGCTGG

70????????80????????90????????100???????110???????120

The position of TCTCATAAAACTTGATTCTGCATCTTTAGATATACTCTGTAAAAGTCACTGTAAAA ACAG G3 ' PvuII restriction enzyme site: DNASIS * * * * * RESTRICTION ENZYME SITE MAP LIST * * * * * FILE NAME: 121. SEQ ENZYME FILE: DNASIS CAT STYLE: LINEAR INDICATION MODE: ACTUAL CUTTING SITE

***?RESTRICTION?ENZYME?SITE?***??NORMAL????????????1-121

10????????20????????30????????40?????????50???????60

5’?CACTTCGAGGGTCAGTCCAATTAGAATAGGGTGGAATGGGGACTTGACAAGAACAGCTGG

∧^

PvuII

70????????80????????90????????100???????110??????120

TCTCATAAAACTTGATTCTGCATCTTTAGATATACTCTGTAAAAGTCACTGTAAAAACAG

G3’[GENETYX-MAC：Search?Restriction?Fragment]Filename?????????：！120.?rev.?SEQSequence?Size????：121Sequence?Position：1-121(1)PvuII?????????：CAGCTG????????????：1?Sites

1-????65：????65?base

The comparative analysis of 66-121:56 base homology

The comparative analysis of pcr amplification region sequence and 3.7Kb specificity RFLPs fragment positive colony forward sequence.The homology comparative analysis shows: the PvuII endonuclease bamhi of pcr amplification district 56bp is positioned at the start-up portion of 3.7Kb forward sequence.[GENETYX-MAC:Nucleotide Sequence Homology Data] lst Nucleotide Sequence File Name:! 0737SEQ Sequence Size: 7122nd Nucleotide Sequence File Name:! 56.SEQ Sequence Size: 56[100.0%/56 bp] OPT. Score:＜224〉1 ' CTGTTCTTGTCAAGTCCCCATTCCACCCTATTCTAATTGGACTGACCCTCGAAGTG TTTC * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * 1 " CTGTTCTTGTCAAGTCCCCATTCCACCCTATTCTAATTGGACTGACCCTCGAAGTG four, design of primers

In order to detect the genotype of ESR more easily, the concentration of sepharose when reducing electrophoresis, according to the sequencing result of forward and reverse sequencing result of 3.7Kb specificity RFLPs fragment and 121bpPCR amplification region, we have designed a PCR reverse primer:

Primer I II:5 '--CAG, TTG, AGA, GCA, AAT, CAA, TGC, TAA, G--3 ' merges use with aforementioned primer I, and expanding fragment length is 246bp, then only produces the dna fragmentation of a 246bp for no PvuII site in 181bp and 65bp such as the PCR product after the PvuII enzyme is cut.So, the concentration of sepharose was reduced to 2.5-3.0% and improves the readability that band is differentiated simultaneously when we can be with electrophoresis, made the genotypic detection of ESR more economical and simply.

The PCR reaction system: the reaction cumulative volume is 25 μ l, and 10 * damping fluid composition is 100mmol/LTrisCl, pH8.0,500mmol/L KCl, mmoLMgCl ₂, 0.1% gelatin.The dNTPs final concentration is 200 μ mol/L, and the primer final concentration is 0.5 μ mol/L, 1u Taq archaeal dna polymerase.The amount of DNA is 50-100ng.

The PCR reaction conditions:

60 ℃ of 31 circulations in 1 minute

72 ℃ 1 minute

72 ℃ of 8 minutes → 4 ℃ ∞ PCR instrument are Gene Amp PCR System 9700,9600 or 2400.Five, ESR and FSH-Beta gene frequency are analyzed

Table 2-1: the distribution frequency of different varieties pig FSH-Beta and ESR gene

	???York	???Duro	???Land	???Doub	???Erhua	??Xiang	?????Wuzhi
								FSH- BETA ????A ????B ESR ????A ????B	? *226? ? ??0.1252 ??0.8748 ? *186 ??0.5282 ??0.4718	? *76? ? ??0.2248 ??0.7852 ? *68 ??0.8140 ??0.1860	? *152? ? ??0.8012 ??0.1982 ? *81 ??0.8419 ??0.1591	? *124? ? ??0.1353 ??0.8647 ? *124 ??0.5834 ??0.4166	? *108? ? ??1.0000 ??0 ? *87 ??0.0000 ??1.0000	? *127? ? ??1.0000 ??0 ? *70 ??0.3983 ??0.6017	??? *85? ? ????0.3417 ????0.6583 ??? *55 ????0.2602 ????0.7308

Annotate: York: big yorker, Duro: duroc, Land: landrace, Doub: two flesh stern pigs, Erhua: painted face in Beijing opera pig, Xiang: fragrant pig, Wuzhi: Wuzhi Mountain pig. ^*: the detection head number.Six, the PCR polymorphism analysis of FSH-Beta gene

The PCR primer is wanted the wind Ph D dissertation referring to Zhao.

Primer I V:5 '--ACT, GGT, CTA, TTC, ATC, CTC, TC--3 '

Primer V:5 '--CCT, TTA, AGA, CAG, TCA, ATG, GC--3 '

The PCR reaction system: the reaction cumulative volume is 25 μ l, and 10 * damping fluid composition is 100mmol/LTrisCl, pH8.0,500mmol/L KCl, 15mmoLMgCl ₂, 0.1% gelatin.The DNTPs final concentration is 200 μ mol/L, and the primer final concentration is 0.5 μ mol/L, 1u Taq archaeal dna polymerase.The amount of DNA is 50-100ng.

The PCR reaction conditions:

94 ℃ 4 minutes

94℃????30s

30 circulations of 58 ℃ of 30s

72℃????30s

72 ℃ of 8 minutes → 4 ℃ ∞ PCR instrument are Gene Amp PCR System 9700,9600 or 2400.

Embodiment 3

The haplotype analysis of ESR gene and FSH-Beta gene

One, the optimization of PCR reaction conditions

The PCR reaction system: the reaction cumulative volume is 25 μ l, and 10 * damping fluid composition is 100mmol/LTrisCl, pH8.0,500mmol/L KCl, 20mmoLMgCl ₂, 0.1% gelatin.The DNTPs final concentration is 200 μ mol/L, and the primer final concentration is 0.5 μ mol/L, 1u Taq archaeal dna polymerase.The amount of DNA is 50-100ng.The PCR reaction conditions: The optimization of 72 ℃ of 8 minutes → 4 ℃ ∞ two, PCR-RFLPs reaction conditions

The enzyme of PCR product is cut: get 10 μ l PCR products, add 0.5ul (10u/ul) PvuII restriction endonuclease, 37 ℃ of digestion are spent the night (5-12 hour), and 4% agarose gel electrophoresis detects.Three, ESR gene and FSH-Beta gene pairs litter size influences 1. linear shape model Y ₁=square root of the variance+FSH-Beta genotype+ESR genotype+FSH-Beta gene and ESR base

Reach effect+residual error (Y between kind between the mutual work+field between cause ₁=μ+sows+FSH-Beta genotype+ESR genotype+FSH-Beta ^*ESR

Interaction+farm/breed+residuals) Y ₂Reach effect+residual error (Y between kind between=square root of the variance+maternal effect+haplotype+field ₂=μ+sows+haplotypes+farm/breed+residuals.)

The least square mean is the farrowing achievement of this genotype sow, and simple mean then is the influence that comprises factors such as environment, farm, lists both, and the effect that can assess various influences has much.

Table 5-1: genotype distribution of Chinese local pig and simple mean, standard deviation

?Genotype	??N	????f	?????????????????First?Parity				??????????????Later?parities
											????TNB?mean	???SD	??NBA?mean	???SD	?TNB?mean	??SD	??NBA?mean	??SD
			ESR ????AA ????AB ????BB FSH- BETA ????AA ????AB ????BB	? ??5 ?35 ?44? ? ? ?29 ?54 ?1	? ??0.06 ??0.42 ??0.52? ? ? ??0.35 ??0.64 ??0.01	? ?????5.20 ?????7.03 ?????12.73? ? ? ?????11.17 ?????9.17 ?????13.00	? ??1.79 ??1.89 ??3.88? ? ? ??4.96 ??3.78 ??0.00	? ????4?20 ????6.17 ????11.55? ? ? ????9.97 ????8.20 ????13.00	? ??0.84 ??2.02 ??3.71? ? ? ??4.95 ??3.50 ??0.00	? ???7.25 ???7.65 ???13.75? ? ? ???12.58 ???9.76 ???17.30									? ?0.89 ?1.74 ?2.83? ? ? ?4.60 ?3.75 ?0.00	? ????6.81 ????7.23 ????12.94? ? ? ????11.69 ????8.94 ????16.83	? ?0.94 ?1.73 ?3.66? ? ? ?4.59 ?3.66 ?0.00

Table 5-2: haplotype distribution of Chinese local pig and simple mean, standard deviation

Haplotypes FSH-BETA ESR	??N	???f	?????????????????First?Parity				??????????????Later?parities
											??TNB?mean	???SD	??NBA?mean	???SD	??TNB?mean	???SD	??NBA?mean	??SD
			AA??AA AA??AB AA??BB AB??AA AB??AB AB??BB	??2 ??8 ??9 ??3 ??27 ??24	??0.02 ??0.10 ??0.23 ??0.04 ??0.32 ??0.29	????6.00 ????6.13 ????13.84 ????4.67 ????7.30 ????11.83	??2.83 ??2.17 ??3.78 ??1.15 ??1.75 ??3.90	????4.50 ????4.88 ????12.68 ????4.00 ????6.56 ????10.58	??0.71 ??1.96 ??3.74 ??1.00. ??1.91 ??3.55	????8.00 ????7.41 ????15.24 ????6.76 ????7.73 ????12.43									??0.00 ??2.28 ??3.04 ??0.80 ??1.59 ??4.00	????7.50 ????6?32 ????14.4 ????6.34 ????6.85 ????11.63	?0.71 ?1.82 ?2.99 ?0.85 ?1.72 ?3.73

Table 5-3: the genotype distribution of foreign pig kind and simple mean, standard deviation

Genotype	??N	????f	????????????????First?Parity				????????????Later?parities
											??TNB?mean	???SD	??NBA?mean	???SD	?TNB?mean	??SD	?NBA?mean	??SD
			ESR ????AA ????AB ????BB FSH- BETA ????AA ????AB ????BB	? ??74 ??85 ??19? ? ? ??2 ??51 ??125	? ???0.42 ???0.48 ???0.10? ? ? ???0.01 ???0.29. ???0.70	? ????9.57 ????10.67 ????12.32? ? ? ????7.00 ????9.92 ????10.63	? ??2.47 ??2.83 ??2.29? ? ? ??1.41 ??2?50 ??2.81	? ????8.99 ????10.12 ????11.53? ? ? ????7.00 ????9.39 ????10.01	? ??2.61 ??2.60 ??1.78? ? ? ??1.41 ??2.29 ??2.76	? ??10.40 ??11.13 ??12?35? ? ? ??8?92 ??10.83 ??11.04									? ?1.50 ?1.86 ?1.64? ? ? ?0.59 ?1.74 ?1.80	? ???9.58 ???10.37 ???11.45? ? ? ???8.44 ???10.01 ???10.25	? ?1.49 ?1.78 ?1.56? ? ? ?0.80 ?1.55 ?1.81

Table 5-4: the haplotype distribution of foreign pig kind and simple mean, standard deviation

Haplotypes FSH-BETA ESR	?N	???f	???????????????????First?Parity				?????????????Later??parities
											?TNB?mean	????SD	??NBA?mean	???SD	??TNB?mean	???SD	??NBA?mean	???SD
			AB??AA AB??AB AB??BB BB??AA BB??AB BB??BB	?20 ?25 ?6 ?54 ?58 ?13	?0.11 ?0.14 ?0.03 ?0.31 ?0.33 ?0.07	??9.05 ??10.24 ??11.50 ??9.76 ??10.98 ??12.69	???1.88. ???2.60 ???3.21 ???2.64 ???2.87 ???1.75	????8.60 ????9.76 ????10.50 ????9.13 ????10.38 ????12.00	??2.21 ??2.35 ??1.64 ??2.75 ??2.67 ??1.68	????10.17 ????10.94 ????12.55 ????10.48 ????11.29 ????12.30									??1.21 ??1.87 ??1.62 ??1.60 ??1.84 ??1.71	????9.42 ????10.10 ????11.60 ????9.64 ????10.56 ????11.38	??1.10 ??1.70 ??1.25 ??1.62 ??1.81 ??1.73

Table 5-5: the least square mean of genotypic total litter size of adventive pig FSH-BETA and ESR and product young number alive

????Genotype	????N	??????First?parity		???????Later?parities
						????TNB	???NBA	????TNB	????NBA
		????ESRLocus ????AA ????AB	???74 ???85	????9.53 ????10.40	????8.85 ????9.80					????10.30 ????10.95	????9.45 ????10.21

???????BB ??FSH-BETA?Locus ???????AA ???????AB ???????BB

??19? ? ??2 ??51 ??125

???12.32? ? ???7.81 ???10.11 ???10.31

???11.51? ? ???7.46 ???9.40 ???9.67

????12.30? ? ????8.93 ????10.75 ????10.87

???11.36? ? ???8.13 ???9.82 ???10.11

Landrace, Large White, two flesh stern pigs are respectively from Changshu, Jiangsu farms producing good poultry and animal strains and kind pig farm, Nanchang table 5-6: the least square mean of Chinese local pig FSH-BETA and the genotypic total litter size of ESR and product young number alive

????Genotype	????N	???????First?parity		??????Later?parities
						????TNB	????NBA	????TNB	????NBA
		????ESRLocus ????AA ????AB ????BB ??FSH-BETALocus ????AA ????AB ????BB	? ????5 ????35 ????44? ? ????29 ????54 ????1	? ????8.25 ????10.08 ????11.62? ? ????10.50 ????11.32 ????9.12	? ????6.96 ????8.93 ????10.54? ? ????9.34 ????10.21 ????9.89					? ????10.99 ????11.39 ????12.39? ? ????11.08 ????12.07 ????12.15	? ????10.33 ????10.25 ????10.96? ? ????10.99 ????11.19 ????12.78

The painted face in Beijing opera pig is from Changshu, Jiangsu farms producing good poultry and animal strains, and fragrant pig is from Changping, Chinese agricultural university Beijing experiment centre table 5-7: total litter size of adventive pig haplotype and produce the least square mean of the young number of living

????Haplotypes FSH-BETA ESR	???N	???????First?parity		???????Later?parities
						????TNB	????NBA	????TNB	????NBA
		??AB????AA ??AB????AB ??AB????BB ??BB????AA ??BB????AB ??BB????BB	??20 ??25 ??6 ??54 ??58 ??13	????9.32 ????10.21 ????12.20 ????9.57 ????10.55 ????12.33	????8.70 ????9.55 ????11.01 ????8.87 ????9.97 ????11.70					????10.13 ????10.75 ????12.69 ????10.33 ????11.08 ????12.08	????9.24 ????9.83 ????11.52 ????9.49 ????10.42 ????11.24

Landrace, Large White, two flesh stern pigs are respectively from Changshu, Jiangsu farms producing good poultry and animal strains and kind pig farm, Nanchang

Table 5-8: the least square mean of total litter size of Chinese local pig kind haplotype and product young number alive

????Haplotypes FSH-BETA??ESR	????N	???????First?parity		?????Later?parities
						????TNB	????NBA	????TNB	????NBA
		??AA????AA ??AA????AB ??AA????BB ??AB????AA ??AB????AB ??AB????BB	????2 ????8 ????19 ????3 ????27 ????24	????9.19 ????9.31 ????11.32 ????7.86 ????10.49 ????11.83	????7.28 ????7.66 ????10.49 ????6.78 ????9.34 ????10.58					????11.75 ????11.16 ????12.28 ????10.51 ????11.48 ????12.43	??10.99 ??9.81 ??10.64 ??9.84 ??10.34 ??11.63

The painted face in Beijing opera pig is from Changshu, Jiangsu farms producing good poultry and animal strains, and fragrant pig is from Changping, Chinese agricultural university Beijing experiment centre four, conclusion and analysis

1, follows the genomic dna of different varieties pig to carry out southern hybridization to contain people ESR gene 1.8Kb cDNA plasmid as probe, RFLPs result is analyzed.Its main polymorphism appears at 3.7Kb and 4.3Kb band, report in conjunction with Rothschild in 1996, the gene that contains the 3.7Kb band is B gene (protogene), cloned the 3.7Kb specificity RFLPs fragment of pig ESR gene, positive colony is carried out forward and reverse order-checking (the about 712bp of forward, oppositely about 640bp).At present the complete sequence of pig ESR gene is not also known, by with GeneBank in the known array comparative analysis of pig and other animal ESR gene, its homology very low (all about 40-50%).Thereby this section sequence is that unknown nucleotide sequence is that we have cloned this gene order first, and we also still belong to the first time to the mensuration of 121bp sequence in pcr amplification district in the people's such as Short.TH in 1997 of pig the polymorphic method of detection ESR gene PCR-RFLPs in addition.These sequences are the important references information of the exploitation ESR gene polymorphic mark relevant with the litter size of pig.

2, the 121bp fragment of clone pig ESR gene PCR amplification region is carried out sequential analysis.Find that the allelic difference of ESR locus is because B allelotrope origination point suddenlys change, thereby produced a PvuII restriction enzyme site.By to 121bp fragment and the segmental homology comparative analysis of 3.7Kb, the result shows that the PvuII endonuclease bamhi of pcr amplification district 56bp is positioned at the start-up portion of 3.7Kb forward sequence.Therefore, design a reverse primer, improved the detection method of the PCR-RFLPs of ESR gene.The concentration of sepharose also improves the readability that the PCR-RFLPs band is differentiated simultaneously when detecting to reduce, and makes the genotypic detection of ESR more economical and simple.

3, set up the detection system that a cover stably detects ESR site and FSH-BETA site haplotype simultaneously, can save a large amount of time and funds, the while has also been improved the information content of analytical results.

4, adopt the method for PCR-RFLPs, the genotype detection of different varieties pig is found that the gene frequency distributional difference of ESR gene and FSH-BETA gene is (P＜0.01) extremely significantly.The frequency of ESR gene and FSH-BETA gene protogene (B) is respectively: big yorker is 0.4718,0.8748; Landrace is 0.1591,0.1982; Duroc is 0.1860,0.7852; The painted face in Beijing opera pig is 1.0000,0; Wuzhi Mountain pig is 0.7308,0.6583; Two flesh stern pigs are 0.4166,0.8647; Fragrant pig is 0.6017,0.The ESR gene frequency of different varieties pig distributes and does not see relevant report; Zhao wanted the wind report in 1998 ⁽¹⁸⁾, the frequency of different varieties pig FSH-BETA gene protogene (B) is respectively: big York is 0.9074; Landrace is 0.8196; Duroc is 0.8163; The painted face in Beijing opera pig is 0; Fragrant pig is 0; People pig is 0.5385.

5, show by correlation analysis ESR gene and FSH-BETA gene genotype and litter size: ESR gene and FSH-Beta gene in commercial pig kind, be control pig high litter size major gene or with the major gene close linkage of the high litter size of control pig, but they exist between significant and the product difference between species to the influence of litter size.Total litter size/the tire of ESR site BB genotype sow average specific AA genotype sow many 1.40-3.37 head, the 0.63-3.58 head produces the young number/tire of living; Total litter size/the tire of FSH-Beta site BB genotype sow average specific AA genotype sow many 1.07-2.40 head, 0.55-2.21 head produces the young number/tire of living, this was with Rothschild study group (the about 0.44-1.15 head of ESR Gene Handling produces the young number/tire of living) and Li Ning study group (the about 1.5-2.0 of FSH-BETAeta Gene Handling litter size/tire) were consistent to the report result of these two genes in the past.

Total litter size/the tire of haplotype BBBB sow average specific ABAA sow many 1.85-3.01 head of these two locus, the 2.0-3.0 head produces the young number/tire of living.Obviously, the allelic effect of the advantage of these two locus is enough to be used in the characters of number born that breeding practice is improved pig.

6, by conventional breeding technique, the many important production traits of pig has all obtained good improvement in heredity, as lean ratio, back fat etc., but the change to characters of number born is very limited, major cause is that the heritability of litter size is very low, having only about 0.1, is again the sex-limited proterties (having only sows farrowing) of not expressing simultaneously.FSH-Beta and ESR gene have all proved influences the major gene that pig is supported young number, but the frequency of these two kinds of genes has than big difference in the distribution of foreign commercial variety and Chinese native breed.FSH-Beta locus particularly, showing extreme skewness distributes, in foreign country commercial kind swinery, lack the AA genotype, and in Chinese indigenous species swinery, then rare BB genotype, this also is to cause in this research the inapparent reason of influence farrowing effect between variance test FSH-BETA genotype, and a proper explanations comparatively is in foreign commercial variety, owing to for a long time litter size is selected (special Yorkshire kind), has caused the genotypic accumulation of BB.

The effect of haplotype is not the simple addition of genotype effect separately, but want a little higher than single best genotype effect, this conclusion is meaningful especially for utilizing dna marker to carry out assisted Selection, show that the improvement of assessment kind or population genetic must be as the criterion with the effect that influences of haplotype, also will consider the distribution frequency of haplotype simultaneously.No matter be FSH-Beta or ESR individual gene type or haplotype, the difference of kind, it is also incomplete same to influence effect, because the genetic background of each kind is not the same.In addition, each genotype and haplotype are also variant between parity to the influence of litter size, and normally the influence to the first-born litter size is higher than other multiparity parity significantly.In addition, there is not mutual work between ESR gene and FSH-Beta locus, therefore can comes breeding is selected in the boar queuing according to the effect value of haplotype simply.In the cultivating process of " China super big yorker ", utilizing FSH-Beta and ESR gene type assay method to choose seeds, and clearly observed each from generation to generation in to the remarkable improved effect of litter size.

7, FSH-Beta and the ESR genotype least square mean that calculates according to model I is summarized in table 5-5, table 5-6; The haplotype least square mean that calculates according to model II is summarized in table 5-7, table 5-8.Haplotype and ESR genotype are extremely significantly (P＜0.001) to the influence of the total litter size and the young number of produce living, and FSH-Beta and FSH-Beta and ESR gene make effect mutually to total litter size and the influence of producing young number alive all not remarkable (P＞0.05).No matter be in place of china kind swinery or in the foreign commodities kind swinery, FSH-Beta and ESR genotype BB are the excellent genes type, and haplotype BBBB is classic haplotype.Replacement effect from gene, in foreign market pig kind, the FSH-Beta genotype is that the sow of BB is than voluminous 2 piglets of AA genotype sow, the ESR genotype is that the sow of BB is also than 2 piglets of the genotypic sow of AA fecund, yet haplotype be the sow of BBBB also only than 2 bull piglets of sow fecund of ABAA haplotype, obviously the hereditary effect of haplotype is not the simple sum of each genotype effect.

In the local pig variety of China, although the effect of genotype or haplotype has fine distinction, trend and conclusion are identical.

8, the degree of dominance of ESR gene and FSH-BETA gene

Table 6-1:ESR gene and the degree of dominance of FSH-BETA gene in the adventive pig

??Genotype	??????????First?parity		???????Later?parities
					????TNB	??????NBA	????TNB	????NBA
	??ESR?Locus ????A ????d ????D ?FSH-BETA ???Locus ????A ????d ????D	? ?????1.395 ????-0.525 ????-0.376? ? ? ?????1.25 ?????1.05 ?????0.84	? ?????1.33 ????-0.38 ????-0.286? ? ? ?????1.105 ?????0.835 ?????0.756	? ????1.0 ???-0.35 ???-0.35? ? ? ????0.97 ????0.85 ????0.876					? ????0.955 ???-0.195 ???-0.204? ? ? ????0.99 ????0.7 ????0.707

a＝(BB-AA)/2；d＝AB-(AA+BB)/2；D＝d/a.

Table 6-2:ESR gene and the degree of dominance of FSH-BETA gene in Chinese native pig breed

??Genotype	??????First?parity		??????Later?parities
					????TNB	????NBA	????TNB	????NBA
	??ESR?Locus ????A ????d ????D ??FSH-BETA ???Locus ????A ????d	? ????1.685 ????0.145 ????0.086? ? ? ???-0.69 ????1.51	? ????1.79 ????0.18 ????0.101? ? ? ????0.275 ????0.595	? ????0.7 ???-0.3 ??-0.429? ? ? ???0.535 ???0.455					? ????0.315 ???-0.395 ???-1.254? ? ? ????0.895 ???-0.695

???D

????-2.188

??2.164

??0.850

????-0.777

a＝(BB-AA)/2；d＝AB-(AA+BB)/2；D＝d/a.

These results are little consistent with result's (seeing Table 4) of U.S. Rothschild study group,

May be owing to the big inadequately reason of the sample of this experiment causes.Also show simultaneously:

The not analysis on certain population size basis, its result has bigger difference,

Reference value size to conclusion is also different.

9, the relation of (thickness of backfat, the speed of growth) will await research between ESR gene and FSH-Beta gene haplotype and other reproductive trait (nascent litter weight, weight of weaning litter, effectively number of nipples) and the production traits.

10, the haplotype from ESR and FSH-Beta gene distributes, clearly the sample number of each haplotype is big not enough, and in the place of china pig, do not detect the AAA haplotype, in the adventive pig, do not detect the BBBB haplotype, thereby also should enlarged sample content, carry out a large amount of haplotype analysis, to obtain stronger statistical data analysis.

From the new ESR gene pleiomorphism detecting method of above-mentioned our exploitation and the practical situations that ESR gene and FSH-Beta gene pleiomorphism merge the method that detects, these two kinds of methods have good stability and accuracy.And compared with former method have simple fast, low, the efficient advantages of higher of cost, the latter also has the high distinct advantages of polymorphism information content, and therefore the litter size breeding work for pig provides good marker assisted selection or auxiliary certification mark and the method for infiltrating of mark.The partial sequence of the ESR gene that we measured provides good reference information for the exploitation of the molecule marker that the ESR gene pleiomorphism detects.

Description of drawings:

Fig. 1: the forward sequencing result of 3.7kb positive colony.

Fig. 2: the result of 3.7kb positive colony backward sequencing.

Fig. 3: 121bp PCR product sequencing result.

Fig. 4: different detection methods detect ESR gene and FSH-Beta gene pleiomorphism result.

Fig. 5: PSG5-EHO plasmid PvuII enzyme is cut.

Fig. 6: the 1.8Kb probe reclaims the result.

Fig. 7: the detection of DIG label probe efficient.

Fig. 8: pig ear tissue genomic dna.

Fig. 9: genomic dna/PvuII enzyme is cut the result;

M1：1Kb?ladder，M2：λDNA/HindIII?Marker。

Figure 10: the southern results of hybridization of different varieties pig genomic dna;

M:1Kb Ladder, P:positive controling (PSG5-EHO/EcoRI 1.8Kb reclaims fragment);

1: the Wuzhi Mountain, 2: big York, 3: painted face in Beijing opera, 4: landrace, 5: fragrant pig, 6: Du Luoke).

Figure 11: the PCR result of pig ESR gene;

M: be dna molecular amount object of reference (PBR322/HaeIII Marker) that other each swimming lane is the PCR result of different varieties pig.

(PBR322/HaeIIIMarker：587，540，504，458，434//267，234，213，192，184//124，123，109，89，80//64，57，51//21，18，11，8).

Figure 12: the PCR-RFLPs result of pig ESR gene

M: be dna molecular amount object of reference (PBR322/HaeIII Marker) 1-11: the PCR-RFLPs result of different varieties pig ESR gene

(wherein 3,10,11,12 swimming lanes are the AA type; 1,2,4,8,9 swimming lanes are the AB type; 5,6,7 swimming lanes are the BB type).

Figure 13: the positive gram in the pcr amplification district of ESR gene falls enzyme and cuts evaluation.

M1:1kb Ladder, M2:PBR322/HaeIII Marker, 1: positive colony, 2: positive control (locus coeruleus).

Figure 14: the PCR-RFLPs result of pig ESR gene

1：AA，2：AB，3：BB，4：AA，5：AB，M：PBR322/HaeIII?Marker。

Figure 15: FSH-Beta gene PCR polymorphism analysis result.

(annotate: 1Kb Ladder:12.216kb, 11.198kb, 10.180kb, 9.162kb, 8.144kb, 7.126kb, 6.108kb, 5.090kb, 4.072kb, 3.054kb, 2.036kb, 1.636kb, 1.018kb, 506bp, 396bp, 344bp, 298bp, 200bp, 154bp, 134bp).

Figure 16: the PCR result of ESR gene and FSH-Beta gene.

Figure 17: the PCR-RFLPs result of ESR gene and FSH-Beta gene.

1:ABAB, 2:BBAB, 3:AABB, 4:ABAA, 5:BBBB, 6:AAAB, 7:AAAA, 8:BBAA, 9:ABBB, 10:AAAB, 11:ABAB, M:PBR322/HaeIII Marker. (genotype: FSH-BETA/ESR).

Claims (5)

1. the partial sequence of the estrogen receptor of pig (ESR) gene, it is accompanying drawing 1 or 2 described sequences.

2. detect the PCR-RFLPs method of the ESR gene pleiomorphism of pig, one of its feature with the forward primer sequence (primer I: 5 '-CCTGTTTTTACAGTGACTTTTACAGAG-3 ', (primer I II:5 '-CAGTTGAGAGCAAATCAATGCTAAG-3 ') combines with a reverse primer, utilize conventional PCR reaction system, the PCR reaction conditions, endonuclease reaction system and reaction conditions and PCR product are with restriction enzyme PvuII cracking, in the PCR-RFLPs polymorphism of the agarose gel electrophoresis detection ESR of 2.5-3% gene.

3. method according to claim 2, wherein the PCR reaction system is: 2.5 μ l, 10 * Taq dna polymerase buffer liquid (500mmol/L KCl, 100mmol/L TrisCl, 15mmol/L MgCl ₂, 0.01% gelatin), 2 μ l dNTPs (2.5mmol/L for each), primer final concentration 0.5 μ mol/L, 1U Taq archaeal dna polymerase, template DNA 50-100ng, final volume 25 μ l;

The PCR reaction conditions: 94 ℃ 4 minutes, 60 ℃ 1 minute, 72 ℃ of 2 circulations in 1 minute, then 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ of 31 circulations in 1 minute, last 72 ℃ 8 minutes, 4 ℃ of prolonged preservation;

Endonuclease reaction system and reaction conditions: 10 μ l PCR products add the PvuII restriction enzyme of 0.5 μ l (10U), 37 ℃ of digestion spend the night (5-12 hour).

4. detect the method for the polymorphism of the ESR gene of pig and FSH-Beta gene simultaneously, it is characterized in that synthetic two pairs are detected the polymorphic primers of FSH-beta gene PCR-RFLPs:

Primer I V:5 '-ACTGGTCTATTCATCCTCTC-3 '

Primer V:5 '-CCTTTAAGACAGTCAATGGC-3 '

The described ESR gene polymorphic of claim 2 is detected primer I, III and FSH-beta gene polymorphic detect primer I V, V merging, two pairs of primers are put in carry out PCR reaction in the same reaction system, use suitable PCR reaction conditions, use this reaction system and under described PCR reaction conditions, carry out the PCR reaction, then the PCR reaction product being carried out enzyme with PvuII cuts, agarose gel electrophoresis with 4% detects enzyme and cuts the result, thereby the colony of different varieties pig is analyzed.

5. method according to claim 4, wherein the PCR reaction system is: 2.5 μ l, 10 * Taq dna polymerase buffer liquid (500mmol/L KCl, 100mmol/L TrisCl, 15mmol/L MgCl ₂, 0.01% gelatin), 2 μ l dNTPs (2.5mmol/L for each), primer final concentration 0.5 μ mol/L, 1U Taq archaeal dna polymerase, template DNA 50-100ng.Final volume 25 μ l;

The PCR reaction conditions: 94 ℃ of 58 ℃ of 70 ℃ of 1 circulations in 1 minute in 1 minute in 4 minutes, 94 ℃ of 58 ℃ of 70 ℃ of 31 circulations in 1 minute in 1 minute in 1 minute then, last 72 ℃ 8 minutes, 4 ℃ of prolonged preservation;

Endonuclease reaction system and reaction conditions: 10 μ l PCR products add the PvuII restriction enzyme of 0.5 μ l (10U), 37 ℃ of digestion spend the night (5-12 hour).

Images