CN109266761A - One kind molecular labeling relevant to Baoshan pig number born character and its application - Google Patents
One kind molecular labeling relevant to Baoshan pig number born character and its application Download PDFInfo
- Publication number
- CN109266761A CN109266761A CN201811500071.2A CN201811500071A CN109266761A CN 109266761 A CN109266761 A CN 109266761A CN 201811500071 A CN201811500071 A CN 201811500071A CN 109266761 A CN109266761 A CN 109266761A
- Authority
- CN
- China
- Prior art keywords
- sow
- molecular labeling
- measured
- genotype
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the molecular labeling of pig and applied technical fields, more particularly to a kind of molecular labeling relevant to Baoshan pig number born character and its application, the molecular labeling its be made of two allele of A, B, the base sequence of allele A is as shown in SEQ ID NO:3, the base sequence of allele B is as shown in SEQ ID NO:4, wherein, the litter size of AB genotype individuals is significantly higher than AA genotype or BB genotype individuals.Molecular labeling of the invention can be used as the molecular labeling of characters of number born of sow assisted Selection.
Description
Technical field
The invention belongs to the molecular labeling of pig and applied technical fields, and in particular to one kind and Baoshan pig number born character phase
The molecular labeling of pass and its application.
Background technique
Baoshan pig, the big ear pig in the former name Baoshan, is listed in national Genetic Resources of Domestic Animal register for 1986, originates in Baoshan City
Longyang District, Shidian, Changning, Tengchong, Longling County are distributed in the part counties and cities of Dehong prefecture on a small quantity.Baoshan pig adaptability, premunition
By force, resistance to crude feed, early sexual maturity, conception rate is high, and sow utilization periods are long, and obvious with adventive heterosis, hybrid vigor, meat is thin
It is tender, fragrant and sweet, raciness.
The characters of number born of pig is to be controlled by multiple genes, and ESR gene was just found its polymorphism early in 1991
Related (the Rothschild et al. Pvu II polymorphisms at the porcine oestrogen with litter size
receptor locus(ESR). Animal Genetics, 1991, 22:448-448).ESR gene is located at No. 1 dye of pig
On colour solid, overall length 6Kb, including 8 exons and 8 intrones.Rothschild etc. is with the ESR gene about 1.3Kb's of people
CDNA is probe, analyzes the ESR gene of pigPvuII polymorphism, it was found that 1 4.3Kb (being named as A) and a 3.7Kb (life
Entitled B) special band.Simultaneously, as experimental material, to be probed into 161 sows in 50% plum mountain pig blood edge, two synthesis systems
ESR gene polynorphisms, discovery B allele can make the first tire litter size increase by 20%, BB type in plum mountain pig synthesis system
1.2 more than AA type, B allele is advantage allele (Rothschild for sow primiparity total yield coefficient and number born alive
et al. The estrogen receptor locus is associated with a major gene
influencing litter size in pigs .Proceedings of the National Academy of
Sciences, 1996, 93:201-205).Wang et al. (2006) and Humpolieck et al. (2006) is respectively
Have using PCR-RFLP method discovery ESR gene with the total yield coefficient of Suprapubic arch sling and number born alive and is significantly associated with (Wang et
al. Effects of ESR1, FSHB and RBP4 genes on litter size in a Large White and
a Landrace herd. Archiv Fur Tierzucht, 2006, 49:64-70；Humpolieck et al.
Influence of ESR1 and FSHB genes on litter size in Czech Large White sows.
Archiv Fur Tierzucht, 2006, 49:152-157).And studies have found that the gene can also influence boar
Semen quality (Gunawan et al. Association study and expression analysis of porcine
ESR1 as a candidate gene for boar fertility and sperm quality. Animal
Reproduction Science, 2011, 128:11-21)。
Therefore, polymorphism of the variant sites in group on ESR gene is studied, and is closed with characters of number born of sow
Connection analysis can provide useful molecular labeling to improve number born of sow by marker assisted selection.
Summary of the invention
It is an object of the invention to overcome defect of the existing technology, according to ESR gene known array, ESR base is found
Because of upper single nucleotide polymorphism (SNPs), inventor by association analysis, unexpectedly issue a kind of SNP on ESR gene with
The significant correlation of Baoshan pig number born character, can be used as the molecular labeling of Baoshan pig breeding.
For this purpose, an aspect of of the present present invention provides a kind of molecular labeling relevant to characters of number born of sow, by A, B two
Allele composition, wherein the base sequence of allele A is as shown in SEQ ID NO:3, and the base sequence of allele B is such as
Shown in SEQ ID NO:4.
In embodiments of the invention, the litter size of the AB genotype individuals of molecular labeling be significantly higher than AA genotype or
BB genotype individuals.
The second aspect of the present invention provides a kind of primer pair for molecular labeling described in first aspect present invention, this draws
Object is to nucleotide sequence shown in SEQ ID NO:1-2.
The third aspect of the present invention provides a kind of kit for molecular labeling described in first aspect present invention, includes
Primer pair described in second aspect of the present invention.
The fourth aspect of the present invention provides molecular labeling described in first aspect present invention, primer pair described in second aspect
Or purposes of the kit described in the third aspect in sow breeding.
The fifth aspect of the present invention provides a kind of method for detecting sows farrowing ability, specifically, by sow to be measured
The detection for carrying out molecular labeling described in first aspect present invention, determines the sows farrowing ability to be measured.
In embodiments of the invention, by carrying out molecular labeling described in first aspect present invention sow to be measured
Detection, determines the sows farrowing ability to be measured, further comprises:
1) genomic DNA of sow to be measured is extracted；
2) primer pair as claimed in claim 3 is utilized, the genomic DNA of the sow to be measured is subjected to PCR amplification, to obtain
Pcr amplification product；
3) pcr amplification product that analysis obtains, determines the genotype of the molecular labeling of the sow to be measured；
4) genotype of the molecular labeling based on the sow to be measured, determines the bearing capacity of the sow to be measured.
The pcr amplification product that acquisition is analyzed in one embodiment of the invention, described in step 3) refers to pair
The pcr amplification product is sequenced, and to obtain sequencing result, the genotype of sow to be measured is determined according to sequencing result.
The pcr amplification product that acquisition is analyzed in one embodiment of the invention, described in step 3) refers to benefit
WithPvuII carries out digestion to the pcr amplification product, and the genotype of sow to be measured is determined according to digestion result.
In the present invention, if the genotype of sow to be measured is AB type, bearing capacity is higher, otherwise, bearing capacity phase
To lower.
Beneficial effects of the present invention
The present invention provides new label for the molecule assisted Selection of pig.
Molecular labeling of the invention can be applied in characters of number born of sow assisted Selection.
Detailed description of the invention
Fig. 1 shows three kinds of genotype digestion rear electrophoresis figures of Baoshan pig ESR gene in the present invention.
Specific embodiment
In order to which the technical problems, technical solutions and beneficial effects solved by the present invention is more clearly understood, below in conjunction with
Embodiment, the present invention will be described in further detail.
Embodiment
Following example is used herein to demonstration the preferred embodiments of the invention.Those skilled in the art, it will be appreciated that under
State the technology disclosed in example represent inventor discovery can be used for implementing technology of the invention, therefore can be considered as implementation this
The preferred embodiment of invention.But those skilled in the art should be understood that specific reality disclosed herein according to this specification
Many modifications can be made by applying example, still can be obtained identical or similar as a result, rather than away from the spirit or scope of the present invention.
Unless otherwise defined, the term of all technologies as used herein and science, and the technology in fields of the present invention
Personnel institute is normally understood equivalent in meaning, and being disclosed reference and their materials of reference will all be incorporated.
Those skilled in the art will recognize or just will appreciate that by routine test many described here
Invention specific embodiment many equivalent technologies.These will equally be comprised in claims.
The screening of 1 ESR gene SNP s of embodiment
1.1 extract total DNA using phenol extraction method
A small amount of Baoshan pig ear tissue block is taken, is placed in 2mL centrifuge tube, is shredded with operating scissors, 1mL Tissue lysates, 10 μ L are added
Proteinase K overturns for several times repeatedly, is digested overnight in 56 DEG C of water-baths, is transparent mixed liquor；Isometric saturated phenol is added,
Slowly reverse centrifuge tube 10min, 4 DEG C of 12000r/min are centrifuged 10min, transfer supernatant (1mL or so) to another centrifuge tube；So
After repeat it is primary；Above-mentioned extraction steps are repeated with isometric phenol/chloroform/isoamyl alcohol (volume ratio 25:24:1)；With equal bodies
Product chloroform/isoamyl alcohol (volume ratio 24:1) repeats above-mentioned extraction steps, and supernatant is transferred in the EP pipe of 2ml；In supernatant
Add the 3M NaAC (100 μ l of ≈) of 1/10 volume and the dehydrated alcohol (2 .5ml of ≈, -20 DEG C of pre-coolings) of 2 .5 volumes, gently overturns
Agglomerating to DNA aggregation, transfer DNA is into new centrifuge tube；75% ethyl alcohol (- 20 DEG C of pre-coolings) is added, is suspended in DNA precipitating molten
Liquid 10 minutes, 4 DEG C of 12000r/min were centrifuged 2min, outwelled residual liquid after centrifugation, repeated and wash twice；4℃12000r/
Min is centrifuged 2min, and residual liquid is sucked out after of short duration centrifugation again after outwelling after centrifugation, after natural drying by DNA, 100 μ L TE is added
Dissolution, detection and dilution packing after in -20 DEG C or -70 DEG C of long-term preservations, stoste avoid multigelation (referring to:
Sambrook et al Molecular Cloning:A Laboratory guide, third edition Huang Peitang etc. are translated；Beijing: Science Press, 2002:468-
470)。
1.2 design of primers
According to the sequence information of pig ESR gene in Ensembl database (number of logging in: NP_999385ESR1), pair of primers is designed
(primer combination), for cloning pig ESR gene, the sequence of primer combination is as follows:
Forward primer ESR_seq-F:5'-CACTTCGAGGGTCAGTC-3'(SEQ ID NO:1),
Reverse primer ESR_seq-R:5'-CCTGTTTTTACAGTGAC-3'(SEQ ID NO:2).
1.3 PCR amplification
It is 20 μ L that PCR, which reacts total volume, and system is specific as follows: 2 μ L, the 2 × Power Taq PCR of genomic DNA of 50ng
10 μ L of Master Mix, the 0.4 μ L of forward primer of step 1.2,4 μ L of reverse primer.PCR amplification program is as follows: 94 DEG C of 5min；
94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1min 40s, 34 circulations；Last 72 DEG C are continued to extend 5min.
The purifying of 1.4 PCR products
The purifying of PCR product: the gel containing target fragment is cut from low melting-point agarose gel in the UV lamp, is put into
In 1.5mL centrifuge tube, then (it is purchased from hundred Tyke Bioisystech Co., Ltd of Beijing, by the reagent with PCR product purification kit
The specification of box operates) purified pcr product, gained purified pcr product saves backup at -20 DEG C.
The sequencing of 1.5 PCR products
Sequencing is held up Kechuang neoformation Science and Technology Ltd. by Wuhan and is completed.There are two types of PCR product sequence results, respectively
As shown in SEQ ID NO:3 or shown in SEQ ID NO:4.
SEQ ID NO: 3
5'-CACTTCGAGGGTCAGTCCAATTAGAATAGGGTGGAATGGGGACTTGACAAGAACAGCTGGTCTCATAAA
ACTTGATTCTGCATCTTTAGATATACTCTGTAAAAGTCACTGTAAAAACAGG-3'
SEQ ID NO: 4
5'-CACTTCGAGGGTCAGTCCAATTAGAATAGGGTGGAATGGGGACTTGACAAGAAAAGTTGGTCTCATAAA
ACTTGATTCTGCATCTTTAGATATACTCTGTAAAAGTCACTGTAAAAACAGG-3'
From the foregoing, it will be observed that there are two types of types for the nucleotide sequence of ESR gene, specifically, the 54th bit base is A or C, the 57th alkali
Base is T or C.When it is also C that the 54th bit base of the nucleotide sequence of ESR gene, which is the 57th bit base of C, 54-57 alkali
Base is CAGCTG, as restriction enzymePvuThe recognition site of II.
The foundation of 2 ESR gene PCR-RFLP detection method of embodiment
2.1 primer sequence
It is expanded using primer shown in SEQ ID NO:1 and SEQ ID NO:2.
2.2 PCR amplification conditions
PCR reacts 10 μ L of total volume, wherein pig genomic DNA about 50ng, (ends purchased from Beijing containing 2 × Taq PCR Mix 5ul μ L
De Lai Biotechnology Co., Ltd), with the 0.2 μ L of forward primer (concentration is 10 μM) described in step 2.1,0.2 μ of reverse primer
L, aqua sterilisa: 3.6 μ L.PCR amplification program is as follows: 95 DEG C of 5min；95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 35 circulations；Most
Continue to extend 10min for 72 DEG C afterwards.PCR reaction product is detected with 2% agarose gel electrophoresis, obtains specific amplified segment.
2.3 PCR-RFLP testing conditions
PCR product endonuclease reaction volume is 10 μ L；Wherein 10 × CutSmart Buffer, 1 μ L, PCR product 5 μ L, it is restricted in
Enzyme cuttingPvuII is 0.1 μ L (1U), is settled to 10 μ L with the distilled water of sterilizing, will be centrifuged after sample blending, 37 DEG C of incubation 12h,
With the detection digestion of 2.5% agarose gel electrophoresis as a result, taking pictures in gel imaging system and recording genotype.The band of genotype
Type is respectively as follows: AA (54bp+63bp), and AB (54bp+63bp+121bp), BB (121bp), genotyping result is as shown in Figure 1.
2.4 molecular labelings of the invention with the application in characters of number born of sow association analysis
Test has detected the ESR gene polymorphism sites of 180 Baoshan pig sows altogether, wherein 180 have phenotypic record.
1 ESR gene polynorphisms site of table genotype frequency and gene frequency distribution in group
2 ESR gene polymorphism sites of table and litter size of pig association analysis result
Note: Superscript letters difference indicates significant difference (P < 0.05) in same row.*P<0.05；**P<0.01；***P<0.001
ESR genePvuII restriction enzyme site detects that tri- genotype of AA, AB, BB, frequency are respectively as follows: in the pig groups of the Baoshan
0.2056,0.4722,0.3222.The frequency of allele A, B are respectively 0.4417,0.5583, and wherein AB genotype is advantage
Genotype, B allele are advantage allele.Baoshan pig ESR gene polymorphism information content is 0.3720, and it is more to belong to moderate
State, heterozygosity 0.4939, genetic variation degree is higher, chi-square value 0.1626, is in Hardy-Weinberg dynamic equilibrium
State.AB genotype litter size difference between Yield Genes type, with AA genotype and BB genotype is extremely significant (P < 0.01).
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims
It encloses.
Sequence table
<110>Zhao Guiying
<120>a kind of molecular labeling relevant to Baoshan pig number born character and its application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
cacttcgagg gtcagtc 17
<210> 2
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cctgttttta cagtgac 17
<210> 3
<211> 121
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cacttcgagg gtcagtccaa ttagaatagg gtggaatggg gacttgacaa gaacagctgg 60
tctcataaaa cttgattctg catctttaga tatactctgt aaaagtcact gtaaaaacag 120
g 121
<210> 4
<211> 121
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cacttcgagg gtcagtccaa ttagaatagg gtggaatggg gacttgacaa gaaaagttgg 60
tctcataaaa cttgattctg catctttaga tatactctgt aaaagtcact gtaaaaacag 120
g 121
Claims (10)
1. a kind of molecular labeling relevant to characters of number born of sow, is made of, wherein equipotential base two allele of A, B
Because the base sequence of A is as shown in SEQ ID NO:3, the base sequence of allele B is as shown in SEQ ID NO:4.
2. the molecular labeling according to claim, which is characterized in that the farrowing of the AB genotype individuals of the molecular labeling
Number is significantly higher than AA genotype or BB genotype individuals.
3. a kind of primer pair for molecular labeling described in detecting as claimed in claim 1 or 22, which is characterized in that the primer pair tool
There is nucleotide sequence shown in SEQ ID NO:1-2.
4. a kind of kit for molecular labeling described in detecting as claimed in claim 1 or 22 is, characterized by comprising: claim
Primer pair described in 3.
5. molecular labeling of any of claims 1 or 2, primer pair as claimed in claim 3 or kit as claimed in claim 4
Purposes in sow breeding.
6. a kind of method for detecting sows farrowing ability, which is characterized in that by carrying out claims 1 or 2 institute to sow to be measured
The detection for the molecular labeling stated determines the sows farrowing ability to be measured.
7. according to the method described in claim 6, it is characterized in that, of any of claims 1 or 2 by being carried out to sow to be measured
The detection of molecular labeling determines the bearing capacity of the sow to be measured, further comprises:
1) genomic DNA of sow to be measured is extracted；
2) primer pair as claimed in claim 3 is utilized, the genomic DNA of the sow to be measured is subjected to PCR amplification, to obtain
Pcr amplification product；
3) pcr amplification product that analysis obtains, determines the genotype of the molecular labeling of the sow to be measured；
4) genotype of the molecular labeling based on the sow to be measured, determines the bearing capacity of the sow to be measured.
8. the method according to the description of claim 7 is characterized in that analyzing the pcr amplification product of acquisition described in step 3) is
The pcr amplification product is sequenced in finger, and to obtain sequencing result, the gene of sow to be measured is determined according to sequencing result
Type.
9. the method according to the description of claim 7 is characterized in that analyzing the pcr amplification product of acquisition described in step 3) is
Refer to and digestion is carried out to the pcr amplification product using Pvu II, the genotype of sow to be measured is determined according to digestion result.
10. according to any method of claim 6-9, which is characterized in that if the genotype of sow to be measured is AB type,
Bearing capacity is higher.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811500071.2A CN109266761A (en) | 2018-12-07 | 2018-12-07 | One kind molecular labeling relevant to Baoshan pig number born character and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811500071.2A CN109266761A (en) | 2018-12-07 | 2018-12-07 | One kind molecular labeling relevant to Baoshan pig number born character and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109266761A true CN109266761A (en) | 2019-01-25 |
Family
ID=65186840
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811500071.2A Pending CN109266761A (en) | 2018-12-07 | 2018-12-07 | One kind molecular labeling relevant to Baoshan pig number born character and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109266761A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5550024A (en) * | 1991-04-19 | 1996-08-27 | Biotechnology Research & Development Corporation | Genetic markers for pig litter size |
| CN1357625A (en) * | 2000-12-08 | 2002-07-10 | 李宁 | Partial ESR gene sequence, swine farrowing characteristic related ESR gene and polymorphic FSH-Beta gene determination technology |
| TW201137355A (en) * | 2010-04-30 | 2011-11-01 | Nat Univ Chung Hsing | Methods and kits for genotyping molecular markers in pigs |
| CN103589715A (en) * | 2012-08-17 | 2014-02-19 | 上海市农业科学院 | SNP molecular marker in porcine AMY2 gene for tracing and detection method thereof |
| CN103589716A (en) * | 2012-08-17 | 2014-02-19 | 上海市农业科学院 | SNP molecular marker in porcine SNCG gene for tracing and detection method thereof |
-
2018
- 2018-12-07 CN CN201811500071.2A patent/CN109266761A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5550024A (en) * | 1991-04-19 | 1996-08-27 | Biotechnology Research & Development Corporation | Genetic markers for pig litter size |
| CN1357625A (en) * | 2000-12-08 | 2002-07-10 | 李宁 | Partial ESR gene sequence, swine farrowing characteristic related ESR gene and polymorphic FSH-Beta gene determination technology |
| TW201137355A (en) * | 2010-04-30 | 2011-11-01 | Nat Univ Chung Hsing | Methods and kits for genotyping molecular markers in pigs |
| CN103589715A (en) * | 2012-08-17 | 2014-02-19 | 上海市农业科学院 | SNP molecular marker in porcine AMY2 gene for tracing and detection method thereof |
| CN103589716A (en) * | 2012-08-17 | 2014-02-19 | 上海市农业科学院 | SNP molecular marker in porcine SNCG gene for tracing and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 柳淑芳 等: "猪雌激素受体基因Pvu II多态性与产仔数性状的关系", 《遗传》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434932B (en) | A kind of structure variation SV200 molecular labeling identifying Native pig breeds | |
| CN108998547B (en) | Microsatellite marking method for paternity test of cupfish | |
| CN107937556B (en) | SNP (Single nucleotide polymorphism) site related to pig feed conversion rate and application thereof | |
| AU1917692A (en) | Genetic markers for pig litter size | |
| CN107815498B (en) | SNP molecular marker related to multiple economic traits of pig and application thereof | |
| CN109680070A (en) | It is a kind of to the extremely significant relevant SNP marker of the white sheep hoof color in Australia, molecular labeling and application | |
| CN107828897A (en) | To pig up to the related SNP marker of 100kg body weight age in days characters and its application | |
| CN103103182B (en) | Haliotis discus hannai Ino microsatellite molecular marker and preparation method | |
| CN109266761A (en) | One kind molecular labeling relevant to Baoshan pig number born character and its application | |
| CN111269990A (en) | Marker of multiparous sheep, product for detecting multiparous sheep and detection method | |
| CN107828895B (en) | SNP molecular marker related to day age of pig with weight of 100kg and application thereof | |
| CN114703293B (en) | Application of InDel marker of cattle CRY1 gene in early selection of reproductive traits | |
| CN107815499B (en) | SNP (single nucleotide polymorphism) locus related to 100kg body weight backfat thickness of pig and application thereof | |
| CN113817841B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof | |
| CN113151497B (en) | COL6A1 gene SNPs marker for detecting milk production traits of dairy cows and application thereof | |
| CN104846080B (en) | A kind of CNV marks relevant with litter size of pig and its application | |
| CN107574250A (en) | A kind of examination and application of the molecular labeling related to characters of number born of sow | |
| CN101875977B (en) | Method for detecting mononucleotide polymorphism of scalper SREBP1c gene | |
| CN102286480A (en) | Susceptible/ resistant MUC13 (mucoprotein) gene key sign locus affecting piglet F4ac diarrhea and application thereof | |
| CN112029868A (en) | Portunus trituberculatus microsatellite markers and application thereof in growth trait association analysis | |
| CN104278083A (en) | Method for detecting single nucleotide polymorphisms of cattle 17HSDB8 gene | |
| CN111850140B (en) | Detection method of goat PPP3CA gene InDel marker and application thereof | |
| CN111304353B (en) | Method for breeding rice east field type three-line maintainer line by using outcross gene linkage markers | |
| CN111763716B (en) | Method for auxiliary selection of growth traits of cattle by using MOGAT1 gene SNP marker and application | |
| CN113718039B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to pig rib number character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |