CN107574250A - A kind of examination and application of the molecular labeling related to characters of number born of sow - Google Patents

Abstract

The invention belongs to livestock molecular marker triage techniques field, and in particular to a kind of the molecular labeling examination and application related to characters of number born of sow.Described molecular labeling site be No. 1 chromosome of international 10.2 version reference sequences of pig genome on 16779229 (g.16779229A>G, SNP ID：Rs81237273), i.e., at the 92nd bit base of the extron of ESR1 genes the 6th, it is A/G nucleotide variations, and corresponds to SEQ ID NO：The mutation of the 163rd allele in 1 sequence table.The variant sites cause PCR AluI RFLP polymorphisms.Application the invention also discloses the screening method of the molecular labeling and its with characters of number born of sow association analysis.The molecular labeling of the present invention can be as the molecular labeling of characters of number born of sow assisted Selection.

Description

A kind of examination and application of the molecular labeling related to characters of number born of sow

Technical field

The invention belongs to the examination of the molecular labeling of pig and applied technical field, and in particular to a kind of and number born of sow The related molecular labeling of shape and application.The molecular labeling that the present invention screens and pig ESR1 gene-correlations, the present invention utilize ESR1 bases Because of the code area SNP molecular labelings related as characters of number born of sow, including ESR1 coding sequences mutational site Detection method and application.

Background technology

Chinese pig industry flourishes, and breeding stock and the amount of delivering for sale of pig are sure to occupy first place in the world for many years.Related data shows, China's pork yield in 2015 is up to 54,870,000 tons, and year end live pig livestock on hand 451,130,000, live pig delivers 708,250,000 for sale, accounts for the same period Countries in the world live pig delivers flow control one for sale.But the InterPIG whole world pig that association of Swine Practitioners of Britain BPEX issues in December, 2014 Data reporting shows that it is 30 that every sow of Denmark, which provides number pigs weaned (sow productivity per year, PSY), The PSY of Holland has reached 28.87, and Canadian PSY also has 22.95, but the PSY in China only has 14.5 or so, with Also there is a big difference for other countries.As can be seen here, China is qualified pig big country, but is not made the country prosperous.And the farrowing of pig Number is the important character for influenceing pig economic benefit, is the important indicator for weighing sow productivity.Because only that selection litter size High sow is bred, and can just be obtained higher productivity effect under identical rearing conditions into original with relatively low, carry Its high production efficiency.Therefore the litter size of increase sow is respectively provided with important meaning to reducing feeding cost or even increasing economic efficiency Justice.

The characters of number born of pig is controlled by multiple genes, and ESR1 genes were just found its polymorphism early in 1991 (Rothschild et al.PvuII polymorphisms at the porcine oestrogen relevant with litter size receptor locus(ESR).Animal Genetics,1991,22:448-448).ESR1 genes are located at No. 1 dyeing of pig On body, total length 6Kb, including 8 extrons and 8 intrones.Rothschild etc. is with the ESR1 genes about 1.3Kb of people cDNA For probe, the ESR1 gene PvuII polymorphisms of pig are analyzed, it was found that 1 4.3Kb (being named as A) and a 3.7Kb (are named as B special band).Simultaneously, as experiment material, to have probed into ESR1 with 161 sows in 50% plum mountain pig blood edge, two synthesis systems Gene polynorphisms, it is found that B allele can make the first tire litter size increase by 20%, BB type sows in plum mountain pig synthesis system 1.2 more than AA type, B allele is advantage allele (Rothschild et for primiparity total yield coefficient and number born alive al.The estrogen receptor locus is associated with a major gene influencing litter size in pigs.Proceedings of the National Academy of Sciences,1996,93: 201-205).Wang et al. (2006) and Humpolieck et al. (2006) are utilized respectively the discovery of PCR-RFLP methods ESR1 genes have with the total yield coefficient and number born alive of Suprapubic arch sling and significantly associate (Wang et al.Effects of ESR1, FSHB and RBP4genes on litter size in a Large White and a Landrace herd.Archiv Fur Tierzucht,2006,49:64-70；Humpolieck et al.Influence of ESR1and FSHB genes on litter size in Czech Large White sows.Archiv Fur Tierzucht,2006,49:152- 157).And studies have found that the gene can also influence semen quality (the Gunawan et al.Association of boar study and expression analysis of porcine ESR1as a candidate gene for boar fertility and sperm quality.Animal Reproduction Science,2011,128:11-21).Application People seminar finds another change dystopy on ESR1 genes be present when carrying out the genomic sequence analysis of Tongcheng pig and European pig Point, i.e. A>G mutational sites (Wang et al.Genome-wide analysis reveals artificial selection on coat colour and reproductive traits in Chinese domestic pigs.Molecular Ecology Resources,2015,15:414-424).Analyzed through comparing, the variant sites occur in No. 1 chromosome 16779229 (g.16779229A>G, SNP ID：Rs81237273), i.e. the 92nd bit base of the extron of ESR1 genes the 6th Place, is same sense mutation.The site and highly chain (the Gloria et al.Association with litter in PvuII sites size of new polymorphisms on ESR1and ESR2genes in a Chinese-European pig line.Genetics Selection Evolution.2007,39:195-206), the site is prompted to be also possible to participate in regulation and control The reproductive trait of sow.

Therefore, polymorphism of the variant sites in colony on ESR1 genes is studied, and is entered with characters of number born of sow Row association analysis, useful molecular labeling is provided to improve number born of sow by marker assisted selection.

The content of the invention

The defects of it is an object of the invention to overcome prior art to exist, according to ESR1 gene known arrays, find ESR1 The detection method of the mutational site and gene pleiomorphism on gene, useful molecule mark is provided for characters of number born of sow detection Note and association analysis method.

The present invention is achieved through the following technical solutions：

By the random picking individual in " Large White " colony, ESR1 gene DNA fragments are cloned, carry out mixed pond sequencing to sieve Look into SNPs.The partial nucleotide sequence of the SNPs such as SEQ ID NO:(sequence is as related to characters of number born of sow shown in 1 Molecular labeling, its nucleotide sequence is as follows：

ATGGAAAGCACCTGCCCTAGGTGATAGACAGGACATGCACGGCAGGCAGGCGCCTGGAGCCCAGTACCTACCCCCTT TCATCATGCCCACTTCGTAGCACTTGCGTAGCCGGCAGGCCTGACAGCTCTTCCTCCTGTTCTTATCAATTGTGCAC TGGTTGGTR(A/G)GCTGGACACATGTAGTCATTATGTCCTATCAAAAGCAAGAGGACAGAATTAGTATTATTTCAG CAAATTTAGCCGGTCAGAATCTGCAGGGAAGCTGTCTGGAGGATGTTTTCCTGTCACTTACTGGGACCTCCCTGTGG TTGCTACCTCAGTCCGCCATCCTTCTTCTGCCCTTC, the R at 163 bit bases of above-mentioned sequence is A or G, and the mutation is led Cause PCR-AluI-RFLP polymorphisms), in the presence of an A/G base mutation, (site is at the 163rd bit base of the sequence At 92nd bit base of the 6th extron of ESR1 genes, it fails the change for causing coded amino acid), but the mutation is led Cause AluI-RFLP digestion polymorphisms.

A kind of clone's (examination) ESR1 genetic fragments are applicant provided to verify that SNPs primer combines (such as SEQ ID NO:2 and SEQ ID NO:Shown in 3), the sequence of primer combination is as follows：

Forward primer ESR1_seq-F 5'-ATGGAAAGCACCTGCCCTAG-3',

Reverse primer ESR1_seq-R 5'-GAAGGGCAGAAGAAGGATGG-3'.

It is a kind of to combine (such as SEQ ID for detecting the above-mentioned primer with characters of number born of sow related molecular marker polymorphism NO:4 and SEQ ID NO:Described in 5), its sequence is as follows：

Forward primer ESR1_SNP-F 5'-GCTCTTCCTCCTGTTCTTATC-3',

Reverse primer ESR1_SNP-R 5'-TTGCTGAAATAATACTAATTCTGTC-3'.

Applicant provide a kind of method for detecting the molecular labeling related to characters of number born of sow, described method bag Include following steps：

The sequence of pig ESR1 genes is obtained from Ensembl databases, designs primer, extracts the genome of sow respectively DNA, using genomic DNA as template design primer (SEQ ID NO:2 and SEQ ID NO:3) 10 amplification ESR1, are selected at random The DNA fragmentation of gene, cloned and mixed pond sequencing.Analysis sequencing result is shown, in the 6th extron of ESR1 gene orders An allelic mutation (A/G) be present in the 92nd bit base.According to SEQ ID NO:1 gene order, design primer is (see SEQ ID NO:4 and SEQ ID NO:5), enter performing PCR amplification, the variant sites are detected in colony using PCR-AluI-RFLP method Polymorphism, to being associated analysis between the mutational site and characters of number born of sow.

The present invention provides new mark for the molecule assisted Selection of pig.

The molecular labeling of the present invention can be applied in characters of number born of sow assisted Selection.

Brief description of the drawings

Sequence table SEQ ID NO:1 is that the present invention detects above-mentioned and characters of number born of sow related molecular marker polymorphism DNA sequence dna.The sequence is also the sequence for the molecular labeling that the present invention screens.

Sequence table SEQ ID NO:2 be examination SEQ ID NO:The forward primer of base mutation (A/G) in 1 genetic fragment.

Sequence table SEQ ID NO:3 be examination SEQ ID NO:The reverse primer of base mutation (A/G) in 1 genetic fragment.

Sequence table SEQ ID NO:4 be present invention detection SEQ ID NO:Forward primer used in 1 gene-specific fragments, It is the forward primer for implementing pig A/G variation PCR-AluI-RFLP genotyping methods.

Sequence table SEQ ID NO:5 be present invention detection SEQ ID NO:Reverse primer used in 1 gene-specific fragments, It is the reverse primer for implementing pig A/G variation PCR-AluI-RFLP genotyping methods.

Fig. 1：Examination pig ESR1 gene SNPs s sequencing peak figure (arrow meaning base is mutational site).

Fig. 2：Pig ESR1 genes are used to detect above-mentioned and characters of number born of sow related molecular marker polymorphism in the present invention DNA fragmentation, i.e. the obtained molecular labeling of present invention screening.

Fig. 3：It is three kinds of genotype electrophoresis results of pig ESR1 genes in the present invention.Description of reference numerals：DNA in Fig. 3 The standard of molecular weight is DL2000.

Embodiment

The screening of embodiment 1, ESR1 gene SNPs s

1.1 utilize phenol extraction method extraction STb gene

Claim a small amount of Large White (genetic resources comes from Wuhan Hua Zhong Agriculture University experiment pig farm, is conventional variety) pig ear group Block is knitted, is placed in 2ml centrifuge tubes, is shredded with operating scissors, 1ml Tissue lysates is added, 10 μ l Proteinase Ks, overturns repeatedly for several times, It is digested overnight in 56 DEG C of water-baths, makes the transparent shape of mixed liquor；Isometric saturated phenol is added, slowly reverse centrifuge tube 10min, 4 DEG C 12000r/min centrifugation 10min, transfer supernatant (1ml or so) to another centrifuge tube；Then repeat once；With isometric benzene Phenol/chloroform/isoamyl alcohol (volume ratio 25：24：1) above-mentioned extraction steps are repeated；With isometric chloroform/isoamyl alcohol, (volume ratio is 24：1) above-mentioned extraction steps are repeated, supernatant is transferred in 2ml EP pipes；Add the 3M NaAC (≈ of 1/10 volume in supernatant 100 μ l) and 2.5 volumes absolute ethyl alcohol (≈ 2.5ml, -20 DEG C of precoolings), gently overturn to DNA assemble it is agglomerating, transfer DNA is extremely In new centrifuge tube；75% ethanol (- 20 DEG C of precoolings) is added, DNA precipitations is suspended in solution 10 minutes, 4 DEG C of 12000r/min 2min is centrifuged, residual liquid is outwelled after centrifugation, repeats and wash twice；4 DEG C of 12000r/min centrifuge 2min, after being outwelled after centrifugation Residual liquid is suctioned out after of short duration centrifugation again, after DNA naturally dries, adds 100 μ l TE dissolvings, detection and dilution packing finish Preserved after -20 DEG C or -70 DEG C long-term, stoste avoid multigelation (referring to：Sambrook et al. Molecular Cloning: A Laboratories refer to South, third edition Huang Peitangs etc. is translated；Beijing：Science Press, 2002：468-470).

1.2 design of primers

According to the pig ESR1 gene (numbers of logging in Ensembl databases：NP_999385ESR1 sequence information), design one To primer (primer combination), for clone pig ESR1 genes, the sequence of primer combination is as follows：

Forward primer ES1R_seq-F 5'-ATGGAAAGCACCTGCCCTAG-3',

Reverse primer ES1R_seq-R 5'-GAAGGGCAGAAGAAGGATGG-3'.

1.3PCR amplification

PCR reaction cumulative volumes are 20 μ l, and system is specific as follows：50ng μ l, the 2 × Power Taq PCR of genomic DNA 2 The μ l of Master Mix 10, the μ l of forward primer 0.4 of step 1.2, the μ l of reverse primer 0.4.PCR amplification programs are as follows：94℃ 5min；94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1min 40s, 34 circulations；Last 72 DEG C are continued to extend 5min.

The purifying of 1.4PCR products

The purifying of PCR primer：The gel containing purpose fragment is cut from low melting-point agarose gel under uviol lamp, is put into In 1.5ml centrifuge tubes, then (the Tyke Bioisystech Co., Ltd of Beijing hundred is purchased from, by the reagent with PCR primer purification kit The specification operation of box) purified pcr product, gained purified pcr product saves backup at -20 DEG C.

The sequencing of 1.5PCR products

Sequencing is held up Kechuang neoformation Science and Technology Ltd. by Wuhan and completed.PCR primer sequence peak figure result is shown in Fig. 1.

The foundation of embodiment 2ESR1 gene PCR-RFLP detection methods

2.1 primer sequence

A primer combination for the rs81237273 sites of ESR1 genetic fragments is devised, the variant sites is detected and exists Polymorphism in colony.The particular sequence of primer combination is as follows：

Forward primer ESR1_SNP-F 5'-GCTCTTCCTCCTGTTCTTATC-3',

Reverse primer ESR1_SNP-R 5'-TTGCTGAAATAATACTAATTCTGTC-3'.

2.2PCR amplification condition

PCR reacts the μ l of cumulative volume 10, and wherein pig genomic DNA about 50ng, the PCR Mix of Taq containing 2x 5ul (are purchased from Beijing Ai Delai bio tech ltd), with the μ l of forward primer 0.2 (concentration is 10 μM) described in step 2.1, the μ of reverse primer 0.2 L, aqua sterilisa：3.6μL.PCR amplification programs are as follows：95℃5min；95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 35 circulations；Finally 72 DEG C are continued to extend 10min.PCR reaction products are detected with 2% agarose gel electrophoresis, obtain specific amplified fragment.

2.3PCR-RFLP testing conditions

PCR primer endonuclease reaction volume is 10 μ l, wherein the μ l of 10x CutSmart Buffer 1, the μ l of PCR primer 5, limitation Property restriction endonuclease be 0.1 μ l (1U), be settled to 10 μ l with the distilled water of sterilizing, will be centrifuged after sample blending, 37 DEG C incubation 12h, use 2.5% agarose gel electrophoresis detects digestion result, is taken pictures in gel imaging system and records genotype.The banding pattern of genotype Respectively：AA (65bp+41bp), AG (65bp+41bp+106bp), GG (106bp), genotyping result is as shown in Figure 3.

2.4 the present invention molecular labelings with the application in characters of number born of sow association analysis

G.16779229A experiment have detected the ESR1 genes of 566 large white sows on one spring of Fujian pig farm altogether>G polymorphisms Site, wherein 544 there is phenotype to record.ESR1 gene of the applicant using SAS softwares to 544 sows g.16779229A>G pleomorphism sites are associated analysis with litter size (including total yield coefficient and number born alive).Establish as follows Described fixed-effect model：

Primiparity：Y_i=u+S_i+YS_i+G_i+ε_i

Through production：Y_i=u+S_i+P_i+YS_i+G_i+ε_i

Wherein, Y_iFor character observation value, S_iFor paternal effect, YS_iFor year-seasonal effect, P_iFor parity effect, G_iFor base Because of type effect, ε_iFor random error, it is assumed that obey N (0, σ²) distribution.

Table 1ESR1 genes are g.16779229A>G sites genotype frequency and gene frequency distribution in colony

Table 2ESR1 genes are g.16779229A>G sites and litter size of pig association analysis result

The explanation of table 2：Superscript letters are different in same row represents significant difference (P<0.05).

*P<0.05；**P<0.01；***P<0.001

Allele G is shown in Table 1 with distribution situations of the allele A in colony, and genotype call results show at 566 In individual, AA genotype has 105 individuals, accounts for 18.55%；AG genotype has 284 individuals, accounts for 50.18%；GG genotype has 177 individuals, account for 31.27%；.The result that ESR1 gene polymorphics site is analyzed with trait associations is：ESR1 genes exist g.16779229A>G polymorphic sites significantly associate with the total yield coefficient and number born alive of Suprapubic arch sling, and have significant additivity Hereditary effect (is shown in Table 2).Wherein the every Litter size and number born alive of GG genotype sow are respectively than AA and AG genotype Body more 1.04,0.9 and 0.92,0.76 (P<0.05).By Tables 1 and 2 it can be seen that in large white sow colony, GG Genotype is preponderant genotype, and G allele is advantage allele.

SEQUENCE LISTING

<110>Hua Zhong Agriculture University

<120>A kind of examination and application of the molecular labeling related to characters of number born of sow

<130>

<141> 2017-07-19

<160> 5

<170> PatentIn version 3.1

<210> 1

<211> 339

<212> DNA

<213>Pig（Sus scrofa）

<220>

<221> gene

<222> (1)..(339)

<223>

<220>

<221> mutation

<222> (163)..(163)

<223>

<400> 1

atggaaagca cctgccctag gtgatagaca ggacatgcac ggcaggcagg cgcctggagc 60

ccagtaccta ccccctttca tcatgcccac ttcgtagcac ttgcgtagcc ggcaggcctg 120

acagctcttc ctcctgttct tatcaattgt gcactggttg gtggctggac acatgtagtc 180

attatgtcct atcaaaagca agaggacaga attagtatta tttcagcaaa tttagccggt 240

cagaatctgc agggaagctg tctggaggat gttttcctgt cacttactgg gacctccctg 300

tggttgctac ctcagtccgc catccttctt ctgcccttc 339

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<221> primer_bind

<222> (1)..(20)

<223>

<400> 2

atggaaagca cctgccctag 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<221> primer_bind

<222> (1)..(20)

<223>

<400> 3

gaagggcaga agaaggatgg 20

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> primer_bind

<222> (1)..(21)

<223>

<400> 4

gctcttcctc ctgttcttat c 21

<210> 5

<211> 25

<212> DNA

<213>Artificial sequence

<220>

<221> primer_bind

<222> (1)..(25)

<223>

<400> 5

ttgctgaaat aatactaatt ctgtc 25

Claims (5)

1. a kind of molecular labeling related to characters of number born of sow, its nucleotide sequence are as follows：

ATGGAAAGCACCTGCCCTAGGTGATAGACAGGACATGCACGGCAGGCAGGCGCCTGGAGCCCAGTACCTACCC CCTTTCATCATGCCCACTTCGTAGCACTTGCGTAGCCGGCAGGCCTGACAGCTCTTCCTCCTGTTCTTATCAATTGT GCACTGGTTGGTR(A/G)GCTGGACACATGTAGTCATTATGTCCTATCAAAAGCAAGAGGACAGAATTAGTATTATT TCAGCAAATTTAGCCGGTCAGAATCTGCAGGGAAGCTGTCTGGAGGATGTTTTCCTGTCACTTACTGGGACCTCCCT GTGGTTGCTACCTCAGTCCGCCATCCTTCTTCTGCCCTTC,

R at 163 bit bases of above-mentioned sequence is A or G, and the mutation causes PCR-AluI-RFLP polymorphisms.

2. the molecule related to characters of number born of sow described in a kind of examination in mutational site and genotype detection claim 1 The primer combination of mark, it is characterised in that the sequence of primer combination is as follows：

The primer combination of the examination in mutational site：

Forward primer ESR1_seq-F ATGGAAAGCACCTGCCCTAG,

Reverse primer ESR1_seq-R GAAGGGCAGAAGAAGGATGG；

The primer combination of the polymorphic detection in mutational site：

Forward primer ESR1_SNP-F GCTCTTCCTCCTGTTCTTATC,

Reverse primer ESR1_SNP-R TTGCTGAAATAATACTAATTCTGTC.

A kind of 3. method of examination molecular labeling related to characters of number born of sow, it is characterised in that following steps：

DNA is extracted from the ear tissue of pig, in the number of logging in：NP_999385ESR1 genes are located at the 92nd bit base of the 6th extron Location proximate designs pair of primers, the sequence such as SEQ ID NO of primer combination：2 and SEQ ID NO：Shown in 3, pig DNA is entered Performing PCR expands and sequencing, obtains such as SEQ ID NO：Genetic fragment shown in 1；By sequence alignment, examination SNP, then profit With SEQ ID NO：4 and SEQ ID NO：Primer combination shown in 5 carries out PCR amplifications, performing PCR-AluI-RFLP digestions of going forward side by side point Type and detection.

4. application of the molecular labeling in characters of number born of sow assisted Selection described in claim 1.

5. the primer described in claim 2 combines the application in characters of number born of sow assisted Selection.