CN112251517B - Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof - Google Patents
Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof Download PDFInfo
- Publication number
- CN112251517B CN112251517B CN202011133074.4A CN202011133074A CN112251517B CN 112251517 B CN112251517 B CN 112251517B CN 202011133074 A CN202011133074 A CN 202011133074A CN 112251517 B CN112251517 B CN 112251517B
- Authority
- CN
- China
- Prior art keywords
- dis3l2
- gene
- genetic marker
- litter size
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a genetic marker using a DIS3L2 gene as a litter size of a growing binary sow and a detection method and application thereof, the invention uses a DIS3L2 gene as a genetic marker of the litter size of the growing binary sow, and a nucleotide sequence of the genetic marker using a DIS3L2 gene as the litter size of the growing binary sow is shown in SEQ ID No. 1. The invention can be used for developing diagnosis methods or kits, so that the methods are utilized in breeding programs to select the growing binary sows carrying favorable alleles, thereby achieving better selection effect; by selecting and reserving the individuals of the growing binary sow whose DIS3L2 gene locus contains the A allele as the breeding stock, the total litter size of the offspring of the growing binary sow can be increased.
Description
Technical Field
The invention relates to the technical field of pig genetic marker preparation, in particular to a genetic marker taking a DIS3L2 (DIS3 mitotic control homolog (S. cerevisiae) -like 2) gene as the litter size of a growing binary sow.
Background
China is a traditional pig-raising and pork-consuming country, the pig-raising industry plays an extremely important role in the animal husbandry of China, the number born of the sows is actively and reasonably increased, more piglets can be provided for people, the high-yield and stable-yield foundation of the pig-raising industry can be laid, more meat products are provided for people, and the method is particularly worthy of attention and research. In the large-scale commercial pig farm in China, most basic sow groups are the growing binary sows, so that the discovery and screening of genes and molecular markers related to the high-yield litter size of the growing binary sows has important significance for actively using the genes or the molecular markers to promote the pig raising production in China. At present, no report on marker-assisted breeding of the litter size of the growing binary sows by using the DIS3L2 gene of the pigs as a genetic marker of the litter size of the growing binary sows is found in the market.
Disclosure of Invention
The invention aims to provide a genetic marker taking DIS3L2 gene as the litter size of a growing binary sow and a detection method and application thereof aiming at the defects of the existing marker-assisted breeding technology of the growing binary sow.
In order to achieve the purpose, the invention adopts the following technical scheme: the invention relates to a genetic marker for litter size of a growing binary sow by using a DIS3L2 gene, wherein the nucleotide sequence of the genetic marker for the litter size of the growing binary sow by using the DIS3L2 gene is shown as SEQ ID No.1, and N in the nucleotide sequence is c or a, so that PCR-TaqI-RFLP genotype polymorphism and polymorphism are caused.
Further, the specific primer for PCR amplification by using the DIS3L2 gene as a genetic marker of the farrowing number of the large binary sow comprises a first primer, and the nucleotide sequence of the first primer is shown as SEQ ID No. 2.
Further, the specific primer for PCR amplification by taking the DIS3L2 gene as a genetic marker of the farrowing of the large binary sow comprises a second primer, and the nucleotide sequence of the second primer is shown as SEQ ID No. 3.
The invention relates to a detection method of genetic markers for the litter size of a growing binary sow by using a DIS3L2 gene, which comprises the following steps:
(1) extracting genome DNA from pig ear tissues, and carrying out PCR amplification in the pig genome DNA by using two primers according to a pig DIS3L2 gene sequence and the two genetic marker specific primers to obtain a PCR product;
(2) performing enzyme digestion on the PCR product obtained in the step (1) by using a restriction enzyme TaqI, detecting the enzyme digestion result in 2% agarose gel electrophoresis containing ethidium bromide, and observing and recording the genotype by using a gel imaging system; according to the band difference, the gene can be divided into three genotypes, wherein the two bands with 228bp and 176bp are AA types, only one band with 404bp is CC type, and the three bands with 404bp, 228bp and 176bp are AC types.
Further, in step (1), the PCR procedure is: 94 ℃ for 4min, 35 cycles of 94 ℃ for 50s, 57 ℃ for 45s, 72 ℃ for 50s, then 72 ℃ for 10min, and finally 4 ℃ for terminating the reaction, wherein the PCR reaction system comprises: 2.0. mu.L of DNA (100ng), 2.5. mu.L of 2mM mixed dNTPs, 2.5. mu.L of 10 XTaq DNA polymerase buffer, 2.5. mu.L of 25mM MgCl21 μ L of 20 μ M primer 1, 1 μ L of 20 μ M second primer, 2unit of Taq DNA polymerase (1U/. mu.L), 11.5 μ L sterile water.
Further, in the step (2), the TaqI enzyme digestion reaction system of the PCR product is as follows: 10 μ L of PCR product, 7 μ L of sterile water, 1 μ L of Taq I (10U),2 μ L of 10 × buffer. The PCR product TaqI enzyme digestion reaction conditions are as follows: the mixture is heated in a water bath kettle at the constant temperature of 65 ℃ for 4 h.
The invention relates to application of a DIS3L2 gene as a genetic marker of farrowing of a growing binary sow in the auxiliary selection of a farrowing trait marker of the growing binary sow.
Has the advantages that: the invention can be used for developing diagnosis methods or kits, so that the methods are utilized in breeding programs to select the growing binary sows carrying favorable alleles, thereby achieving better selection effect; by selecting and reserving the individuals of the growing binary sow whose DIS3L2 gene locus contains the A allele as the breeding stock, the total litter size of the offspring of the growing binary sow can be increased.
Drawings
In order to more clearly illustrate the technical solution used in the present invention, the drawings used in the description of the embodiment or the prior art will be briefly described below.
FIG. 1 is a schematic diagram of C-A mutation at 2146-bp of porcine DIS3L2 gene mRNA;
FIG. 2 is a schematic diagram of the PCR-TaqI-RFLP typing detection result of the pig DIS3L2 gene.
Description of the drawings: in fig. 2: m is a DL2000 molecular marker; the sizes of the AA genotype fragments are 228bp and 176bp respectively; the sizes of the fragments of the AC genotype are 404bp, 228bp and 176bp respectively; the fragment size of the CC genotype was 404 bp.
Detailed Description
The present invention will be described in further detail with reference to the accompanying drawings.
The drawings and examples of the invention are intended to illustrate in greater detail certain embodiments of the invention so that the aspects and advantages of the invention, as well as aspects thereof, may be better understood and are not intended to limit the invention.
Example 1
As shown in figures 1-2, the gene DIS3L2 is used as the genetic marker of the litter size of the growing binary sow, the nucleotide sequence of the genetic marker of the litter size of the growing binary sow using the gene DIS3L2 is shown as SEQ ID No.1, and N in the nucleotide sequence is c or a, so that PCR-TaqI-RFLP genotype polymorphism and polymorphism are caused. SEQ ID No. 1:
tgacctttcctccccagagcagggtctcagatgacgagcgggggacaagggccccagaacctc gccccgagcctgactgcataccccttgggcttgcttctagaaaagtctgaccgaaacatttggagatgac aagtactccctggcgcgcaaggaggtgctcactaacatgtgctcgNggcccatgcaggtgaggaagc cgccctcgcccctcctgctcctggagcagccggggcccctgcgcctcagccagcctgagggcagtct gggggagcatgtccccaggccactcccgggacagatggtccctgggctcctgagcctcatcccctcct cctgctcagacttgcctgccccgctgcccccctgcatggccgctggggctctatctctggcagccagca ；
the specific primer for PCR amplification by taking the DIS3L2 gene as a genetic marker of the litter size of the growing binary sow comprises a first primer, and the nucleotide sequence of the first primer is shown as SEQ ID No. 2.
The SEQ ID No.2 is 5'-TGACCTTTCCTCCCCAGA-3',
the specific primer for PCR amplification by taking the DIS3L2 gene as the genetic marker of the litter size of the growing binary sow comprises a second primer, and the nucleotide sequence of the second primer is shown as SEQ ID No. 3.
The SEQ ID No.3 is 5'-TGCTGGCTGCCAGAGATA-3'.
The invention relates to a detection method of genetic markers for the litter size of a growing binary sow by using a DIS3L2 gene, which comprises the following steps:
(1) extracting genome DNA from pig ear tissues, and carrying out PCR amplification in the pig genome DNA by using two primers according to a pig DIS3L2 gene sequence and the two genetic marker specific primers to obtain a PCR product; the PCR program is as follows: 94 ℃ for 4min, 35 cycles of 94 ℃ for 50s, 57 ℃ for 45s, 72 ℃ for 50s, then 72 ℃ for 10min, and finally 4 ℃ to terminate the reaction. And (3) PCR reaction system: 2.0. mu.L of DNA (100ng), 2.5. mu.L of 2mM mixed dNTPs, 2.5. mu.L of 10 XTaq DNA polymerase buffer, 2.5. mu.L of 25mM MgCl21 μ L of 20 μ M primer 1, 1 μ L of 20 μ M second primer, 2unit of Taq DNA polymerase (1U/. mu.L), 11.5 μ L sterile water.
(2) Performing enzyme digestion on the PCR product obtained in the step (1) by using a restriction enzyme TaqI, detecting the enzyme digestion result in 2% agarose gel electrophoresis containing ethidium bromide, and observing and recording the genotype by using a gel imaging system; according to the band difference, the gene can be divided into three genotypes, wherein the two bands with 228bp and 176bp are AA types, only one band with 404bp is CC type, and the three bands with 404bp, 228bp and 176bp are AC types. The PCR product TaqI enzyme digestion reaction system is as follows: 10 μ L of PCR product, 7 μ L of sterile water, 1 μ L of Taq I (10U),2 μ L of 10 × buffer. The PCR product TaqI enzyme digestion reaction conditions are as follows: the mixture is heated in a water bath kettle at the constant temperature of 65 ℃ for 4 h.
The invention relates to application of a DIS3L2 gene as a genetic marker of farrowing of a growing binary sow in the auxiliary selection of a farrowing trait marker of the growing binary sow.
Test example 1
The genetic marker prepared by the method is applied to the associated selection of the litter size of the growing binary sow:
in order to determine whether DIS3L2 gene PCR-TaqI-RFLP polymorphic sites are related to litter size differences of the growing binary sows, 200 growing binary sows with 7 gestational ages are selected as test materials, the PCR-TaqI-RFLP method established in the first step and the second step is adopted to carry out polymorphism detection, and the related relation between different genotypes of the pigs and live litter sizes is analyzed. Adopting a GLM program of SAS statistical software to carry out single-label variance analysis and significance test, wherein the adopted model is as follows: y isijk＝μ+Gi+Yi+Pk+eijk，YijkIs a phenotypic value, μ is the mean value, GiIs genotype effect (including gene additive effect and dominant effect; additive effect uses 1, 0 and-1 to represent AA, AC and CC genotypes respectively, and dominant effect uses 1, -1 and 1 to represent AA, AC and CC genotypes respectively); y isj、PkFor the fixed effect, the annual and fetal effects, respectively; e.g. of the typeijkIs the residual effect. Correlation analysis between different genotypes and litter size was performed in 200-head-long binary sow herds, and the statistical analysis results are summarized in table 1. The correlation analysis of DIS3L2 genotype with litter size of long binary sows is shown in table 1:
TABLE 1
Note: the above numerical values are the least square mean value plus or minus standard error; capital letters on the shoulder indicate that the difference level was extremely significant (P < 0.01).
As can be seen from table 1, in the growing binary sows, the total parity litter size and total parity live litter size were significantly higher for genotype AA and AC individuals than for the CC genotype individuals (P < 0.01). By selecting the growing binary sow individual containing the A allele at the DIS3L2 gene locus as the breeding stock, the total fetal secondary litter size and the total fetal secondary live litter size can be increased.
After the technical scheme is adopted, the invention has the beneficial effects that: can be used for developing diagnosis methods or kits, so that pigs carrying favorable alleles can be selected by using the methods in breeding programs, and a better selection effect can be achieved; by selecting and reserving an individual containing A allele at DIS3L2 gene locus of the growing binary sow as a breeding stock, the total number born in fetal secondary and the total number born in fetal secondary of the growing binary sow can be increased.
The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the foregoing description only for the purpose of illustrating the principles of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims, specification, and equivalents thereof.
Sequence listing
<110> Hainan Rouzu mountain boar Breeding Co Ltd
<120> genetic marker using DIS3L2 gene as litter size of growing binary sow and detection method thereof
<130> 2019
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 404
<212> DNA
<213> Artificial sequence (genetic marker nucleotide sequence)
<220>
<221> misc_feature
<222> (179)..(179)
<223> n is a, c, g, t or u
<400> 1
tgacctttcc tccccagagc agggtctcag atgacgagcg ggggacaagg gccccagaac 60
ctcgccccga gcctgactgc ataccccttg ggcttgcttc tagaaaagtc tgaccgaaac 120
atttggagat gacaagtact ccctggcgcg caaggaggtg ctcactaaca tgtgctcgng 180
gcccatgcag gtgaggaagc cgccctcgcc cctcctgctc ctggagcagc cggggcccct 240
gcgcctcagc cagcctgagg gcagtctggg ggagcatgtc cccaggccac tcccgggaca 300
gatggtccct gggctcctga gcctcatccc ctcctcctgc tcagacttgc ctgccccgct 360
gcccccctgc atggccgctg gggctctatc tctggcagcc agca 404
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence (primer sequence 1)
<400> 2
tgacctttcc tccccaga 18
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence (primer sequence 2)
<400> 3
tgctggctgc cagagata 18
Claims (3)
1. The genetic marker taking the DIS3L2 gene as the litter size of the growing binary sow is characterized in that the nucleotide sequence taking the DIS3L2 gene as the genetic marker of the growing binary sow is shown as SEQ ID No.1, and the genetic marker is characterized in that: the specific primer for PCR amplification by taking the DIS3L2 gene as the genetic marker of the litter size of the growing binary sow comprises a first primer, the nucleotide sequence of the first primer is shown as SEQ ID No.2, the specific primer for PCR amplification by taking the DIS3L2 gene as the genetic marker of the litter size of the growing binary sow comprises a second primer, and the nucleotide sequence of the second primer is shown as SEQ ID No. 3.
2. The method of claim 1 for detecting the genetic marker of the litter size of a growing binary sow comprising the DIS3L2 gene as a marker, wherein the method comprises the steps of:
(1) extracting genome DNA from the tissue of pig ear,
performing PCR amplification in pig genomic DNA by using the two genetic marker specific primers in claim 1 to obtain a PCR product; the PCR procedure was: 94 ℃ for 4min, 35 cycles of 94 ℃ for 50s, 57 ℃ for 45s, 72 ℃ for 50s, then 72 ℃ for 10min, and finally 4 ℃ for terminating the reaction, wherein the PCR reaction system comprises: 2.0. mu.L of 100ng DNA, 2.5. mu.L of 2mM mixed dNTPs, 2.5. mu.L of 10 XTaq DNA polymerase buffer, 2.5. mu.L of 25mM MgCl21 mu L of 20 mu M first primer, 1 mu L of 20 mu M second primer, 2U of Taq DNA polymerase with the concentration of 1U/mu L and 11.5 mu L of sterile water;
(2) performing enzyme digestion on the PCR product obtained in the step (1) by using a restriction enzyme TaqI, detecting the enzyme digestion result in 2% agarose gel electrophoresis containing ethidium bromide, and observing and recording the genotype by using a gel imaging system; according to the band difference, the PCR product can be divided into three genotypes, wherein two bands of 228bp and 176bp are AA types, only one band of 404bp is CC type, and three bands of 404bp, 228bp and 176bp are AC types, and the TaqI enzyme digestion reaction system of the PCR product is as follows: 10 mu L of PCR product, 7 mu L of sterile water, 1 mu L of 10U Taq I, 2 mu L of 10 XBuffer, and the enzyme digestion reaction conditions of the PCR product TaqI are as follows: the mixture is heated in a water bath kettle at the constant temperature of 65 ℃ for 4 h.
3. Use of the DIS3L2 gene as a genetic marker for the litter size of growing binary sows according to claim 1 for trait marker assisted selection of the litter size of growing binary sows.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011133074.4A CN112251517B (en) | 2020-10-21 | 2020-10-21 | Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011133074.4A CN112251517B (en) | 2020-10-21 | 2020-10-21 | Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251517A CN112251517A (en) | 2021-01-22 |
| CN112251517B true CN112251517B (en) | 2021-08-17 |
Family
ID=74264492
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011133074.4A Active CN112251517B (en) | 2020-10-21 | 2020-10-21 | Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251517B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421771A (en) * | 2012-12-05 | 2013-12-04 | 华中农业大学 | Genetic marker for character of litter size of pig utilizing WIF1 gene |
| CN104313156A (en) * | 2014-10-27 | 2015-01-28 | 湖北省农业科学院畜牧兽医研究所 | Genetic marker for porcine litter size character and application of genetic marker |
-
2020
- 2020-10-21 CN CN202011133074.4A patent/CN112251517B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103421771A (en) * | 2012-12-05 | 2013-12-04 | 华中农业大学 | Genetic marker for character of litter size of pig utilizing WIF1 gene |
| CN104313156A (en) * | 2014-10-27 | 2015-01-28 | 湖北省农业科学院畜牧兽医研究所 | Genetic marker for porcine litter size character and application of genetic marker |
Non-Patent Citations (5)
| Title |
|---|
| Integrated ovarian mRNA and miRNA transcriptome profiling characterizes the genetic basis of prolificacy traits in sheep (Ovis aries);Kisun Pokharel等;《BMC Genomics》;20181231;第19卷;摘要、第5页左栏第2段 * |
| Kisun Pokharel等.Integrated ovarian mRNA and miRNA transcriptome profiling characterizes the genetic basis of prolificacy traits in sheep (Ovis aries).《BMC Genomics》.2018,第19卷 * |
| Molecular Cloning of Porcine DIS3L2 Gene and Association between a SNP with Litter Size Trait;Liu Zang等;《Biomed J Sci & Tech Res》;20201223;第32卷(第5期);第25306-25310页 * |
| Molecular Cloning of Porcine SUN5 Gene and Association between a SNP with Litter Size Trait;Zhenhua Zhao等;《Animal Biotechnology》;20170330;第28卷(第4期);摘要、第2页右栏第3段、第3页右栏第4-5段、图4、表1-3 * |
| Zhenhua Zhao等.Molecular Cloning of Porcine SUN5 Gene and Association between a SNP with Litter Size Trait.《Animal Biotechnology》.2017,第28卷(第4期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251517A (en) | 2021-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110541038A (en) | SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application | |
| CN110846422A (en) | Molecular marker associated with pig number of live piglets and application thereof | |
| CN111996264A (en) | Application of pig SNP molecular marker in pig breeding character screening and pig breeding | |
| CN107815498B (en) | SNP molecular marker related to multiple economic traits of pig and application thereof | |
| CN110144408B (en) | SNP molecular marker located on pig chromosome 7 and related to total papilla number and application | |
| CN110468212B (en) | SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application | |
| CN110714082B (en) | SNP (Single nucleotide polymorphism) locus related to number of pig breasts as well as detection method and application thereof | |
| CN113699246B (en) | SNP molecular marker affecting pig feed conversion efficiency character and application thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN115927667B (en) | Molecular marker and primer related to intramuscular fat traits of pigs and application of molecular marker and primer | |
| CN112251517B (en) | Genetic marker using DIS3L2 gene as litter size of growing binary sow as well as detection method and application thereof | |
| CN113637768B (en) | SNP molecular marker related to number of sow-produced malformed piglets on chromosome 13 of pig and application thereof | |
| CN113736890B (en) | SNP molecular marker related to healthy number and living number rate and application thereof | |
| CN115011704A (en) | SNP molecular marker influencing litter interval traits and application thereof | |
| CN112760387B (en) | SNP molecular marker related to total nipple number of pigs and application | |
| CN110438238B (en) | SNP (single nucleotide polymorphism) site related to premna ungula weight on chromosome 6 of meat Simmental cattle and application | |
| CN113736889A (en) | SNP molecular marker related to pig stillbirth number and survival rate on pig chromosome 7 and application thereof | |
| CN113699248A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN107937558B (en) | SNP (Single nucleotide polymorphism) locus related to average daily feed intake of pig and application thereof | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application | |
| CN113930521B (en) | Porcine semen quality trait associated C7H15orf39 gene SNP molecular marker and application | |
| CN114085914B (en) | SNP molecular marker located on chromosome 9 of pig and related to litter size and application thereof | |
| CN114350820B (en) | Molecular marker related to pig carcass traits and application thereof | |
| CN110760594B (en) | SNP (single nucleotide polymorphism) locus related to hind leg length on chromosome 6 of meat Simmental cattle and application | |
| CN111500743B (en) | Method for increasing weight of Chinese and cattle loin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liao Zhu Inventor after: Wang Dalin Inventor after: Xie Hongtao Inventor after: Dong Xujia Inventor after: Yue Jun Inventor after: Jin Zhuang Inventor after: Tian Jiaying Inventor after: Yang Guojun Inventor after: Liu Yonggang Inventor before: Wang Dalin Inventor before: Xie Hongtao Inventor before: Dong Xujia Inventor before: Yue Jun Inventor before: Jin Zhuang Inventor before: Tian Jiaying Inventor before: Yang Guojun Inventor before: Liu Yonggang Inventor before: Liao Zhu |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |