TW201137355A - Methods and kits for genotyping molecular markers in pigs - Google Patents

Abstract

The present invention relates to a method for simultaneously genotyping multiple molecular markers in pigs, comprising performing extension reactions for different molecular markers using multiple primer sets in the same reaction to obtain an reaction product, and analyzing said reaction product for the genotypes of the multiple molecular markers. According to the present invention, the multiple molecular markers to be tested comprises those located in the genes of estrogen receptor (ESR), retinol binding protein 4 (RBP4), calcium release channel receptor (CRC), prolactin receptor (PRLR), calpastatin (CAST), α 1-fucosyltransferase (FUT1), melanocortin 4 receptor (MC4R), rendement napole (RN), and heart-fatty acid binding protein, H-FABP. Kits for conducting the method of the invention are also provided.

Description

201137355 Description of the invention: [Technical field to which the invention pertains] The present invention is a method for molecular labeling only [previous technique] The locomotive of the animal husbandry industry, the advanced country of animal husbandry | L t L species selection, in the past relied on the individual J-type, the comprehensive performance of the transmission and the environment, if only based on the individual's body surface species: traditional quantitative genetic techniques for selection, when needed to improve the plateau, Due to the selection change*, it is impossible to obtain sufficient genetic improvement. In recent years, mutations in genes have been discovered, resulting in single nucleotide p〇lymorphisms (SNp), and some changes in f-types have affected the production traits and become molecular selection markers. ^Molecular marker assisted selection (MAS), which can quickly and accurately screen out breeds of poultry with excellent genotypes for breeding. Many genetic molecular markers are known to be involved in important economic traits in pigs, such as 'calcium release channei receptor (CRC), rendene gene (rendementnapc^RN), calpastatin inhibitory protein (calpastatin) , CAST), and the genotype of molecular markers such as heart-fatty acid binding protein (H-FABP) are related to the meat quality traits of the body; and the estrogen receptor (estr〇gen recept〇r, Esr), prolactin receptor (PRLR), retinol-binding protein 4 (RBP4), leptin (LEP), complement factor protein B (BF) , leptin receptor (LEPR), leukemia inhibitory factor (LIF), erythropoietin receptor (EPOR), promoted 201137355 follicle stimulating hormone receptor (FSHR) And molecular markers on genes such as gonadotr〇pin rdeasing h〇rm〇ne receptor (GNRHR) The genotype is related to the reproductive traits. In addition, the melanocortin 4 receptor (Nicuo) and the "Rhotochaine transferase FUT1 (5) also (3) other annihilation) are well-recognized and grown. The genotypic screening of molecular markers related to the important economic traits of pigs is of great benefit to the breeding efficiency and production performance of pigs. Currently, the genotypes of molecular markers of pigs are generally analyzed. The method used is a polymerase chain reaction and a restriction fragment polymorphism (PCR-j^PLP) analysis method, which is a method of PCR-proliferating a gene fragment and performing restriction enzyme cleavage, and then performing electrophoresis, and its HI property. PCR-RFLP The method is simple, but the lack of analysis is slow. Usually, the analysis is only for a single marker, and in order to improve its accuracy, if the electrophoresis loop is not clear enough, repeat the same test multiple times to confirm. The DNA fragment to be detected lacks the appropriate restriction enzyme cutting position, which is difficult to carry out. In terms of the 2009 Yusheng data, there are (7) and 539 households in the Taihu area. There are 25,796 boars in the breeding, and 672,511 sows. For this huge number of breeding pigs, the genotypes related to the important economic traits of the breeding pigs should be universally screened in the traditional way: (11_1^1^). It is really difficult.曰 Therefore, there is a need to develop more rapid and accurate detection methods, especially for the simultaneous detection of a variety of molecular markers related to the economic traits of the important economic traits to improve the selection efficiency of breeding pigs. SUMMARY OF THE INVENTION ☆ The present invention is directed to a plurality of mononuclear and multi-dead molecular marker design primer sets related to bribe traits, which can be used to carry out an extension reaction in the same reaction, generate a reaction product, and then analyze the reaction product, and detect The genotype of the marker. The invention successfully overcomes the problem that the use of multiple primer groups in the same reaction is easy to cause mutual interference and the result is difficult to interpret, and can simultaneously detect a variety of 201137355 important pig molecular marker genotypes, and achieve the purpose of detecting multiple molecular markers. One of the notes can simultaneously detect a variety of molecules (A) using a nucleic acid sample from a pig as a template, and using a plurality of primer sets for the primer extension reaction in the same reaction to generate a reaction product, wherein the plurality of primer sets are selected Any combination of four or more of the following groups consisting of the first to the ninth introduction group: (1) The first introduction group, which includes:

(a) a first PCR primer pair comprising two primers, each having the nucleotide sequence of SEQid NOS: 1 and 2, and (b) a first extension reaction primer having the nucleotide sequence of SEQ IDN::3 Wherein the 'first primer set is used to detect a single nucleotide polymorphism of the esculin receptor (ESR), which is located at the 65th base position of SEQ ID NO: 28 (ESR-A65G); a second primer set comprising: (a) a first PCR primer pair 'which contains two primers' having a nucleotide sequence of seq id NOS: 4 and 5, respectively, and (b) a first extension reaction primer a nucleotide sequence having SEQ ID NO: 6; wherein the 'different primer set is a single nucleotide polymorphism for detecting retinol binding protein 4 (R3P4)' which is located at the 29th base of SEQ ID NO: Base position (RBP4-G29C); (3) A third primer set comprising: (a) a third PCR primer pair, which contains two primers, each having a nucleotide sequence of sEQ melon NOS: 7 and 8, and (b) a third extension reaction primer having the nucleobase of SEQ ID NO: 9

Column; X where the third primer set is used to detect the single nucleotide polymorphism of the calcium ion release channel acceptor (CRC) 201137355, which is located at the 33rd base position of SEQ ID NO: 30 (CRC-C33T) (4) A fourth primer set comprising: (a) a fourth PCR primer pair comprising 'two primers, each having a seqid NOS: nucleotide sequence of 10 and 11, and (b) a fourth extension reaction a primer having a nucleotide sequence of SEqIDN〇: 12; wherein, the fourth primer set is used to detect a single nucleotide polymorphism of a single nucleotide polymorphism of the prolactin receptor (PRLR), which is located SEq ID N〇: 77th base position of 31 (PRLR-A77G); (5) Fifth primer set, which includes: (a) A fifth PCR primer pair containing two primers, respectively having SEqid NOS: a nucleotide sequence of 13 and 14, and (b) a fifth extension reaction primer having a nucleotide sequence of SEqIDN〇: 15; wherein the fifth primer set is for detecting | arc-activated protease inhibitory protein (CAST) Single nucleotide polymorphism, the mSEqIDN〇: the 47th base position of 32 (CAST-G47A); (6) The sixth introduction group, which includes: (a) A six-PCR primer pair comprising two primers, each having a SEqid NOS: nucleotide sequence of 16 and 17, and (b) a sixth extension reaction primer having a nucleotide sequence of SEqIDN〇: 18; The six primer set is used to detect the single nucleotide polymorphism of the activated protease inhibitory protein (CAST), which is located at the 143th base position of SEQ ID NO: 33 (CAST-C143A); (7) The seventh primer set , comprising: U) a seventh PCR primer pair comprising two primers, each having a SEqid NOS: nucleotide sequence of 19 and 20, and (b) a seventh extension reaction primer having a core of SEqIDN〇: 21 a sequence of the glycoside 201137355; wherein the seventh primer set is used to detect a single nucleotide polymorphism of 〇α fucosyltransferase (futi), which is located at the 156th base position of SEQ ID NO: 34 ( FUT1-G66A); (8) an eighth primer set comprising: (a) an eighth PCR primer pair comprising two primers having nucleotide sequences of SEQ ID NOS: 22 and 23, respectively, and (b) An eighth extension reaction primer having the nucleotide sequence of SEQ ID NO: 24; wherein the 'eighth primer set is for detecting melanin a single nucleotide polymorphism of the receptor 4 (MC4R), which is located at the 156th base position of SEQ ID NO: 35 (MC4R-G156A); and (9) the ninth introduction group, which includes: a ninth PCR primer pair having a seq id NOS: nucleotide sequence of 25 and 26, respectively, and a nucleic acid sequence of seq id NOS: 25 and 26, respectively, and (b) a ninth extension reaction primer having the nucleotide sequence of SEQ ID NO: 27. The 'ninth primer set is used to detect the mononucleotide acid polymorphism of the sour meat gene (RN), which is located at the 216th base position of SEq ID N0: 36 (RN-G216A); and (B) The aforementioned reaction product is analyzed to obtain a signal representing the genotype of the aforementioned single nucleotide polymorphism 'where the signals can be distinguished from each other. The present invention also provides a kit of genotypes capable of simultaneously detecting a plurality of pig molecular markers, comprising a combination of any four or more selected from the group consisting of the first primer group and the ninth primer group. . In a second aspect, the invention provides a method for simultaneously detecting a genotype of a plurality of molecular markers of heart-fatty acid binding protein (H-FABP), comprising: not (A) from a pig The nucleic acid sample is a template, and the primer extension reaction is performed in the same reaction using a plurality of primer sets 201137355 to generate a reaction product, wherein the plurality of primer set systems include: (Ο10th introduction group, which includes: U) the tenth PCR primer pair , which comprises two primers, each having the nucleotide sequence of SEQ ID NOS: 37 and 38, and (b) a tenth extension reaction primer having the nucleotide sequence of SEQ ID NO: 39; wherein the 'tenth introduction group Is used to detect a single nucleotide polymorphism of H-FABP, which is located at the 204th base position of SEQ ID NO: 44 (H-FABP-T204C); (2) the eleventh introduction group, which includes : U) the eleventh PCR primer pair, which contains two primers, having the nucleotide sequences of SEQ ID NOS: 40 and 41, respectively, and (b) the eleventh extension reaction primer having SEQ ID NO: 42 Nuclear acid sequence; wherein 'the eleventh introduction group is used for detection The mononucleic acid polymorphism of H-FABP is located at the 89th base position of SEQ ID NO: 45 (H-FABP-T89C); (3) The twelfth primer set includes: (a) A 12-PCR primer pair containing two primers, each having a SEq K) NOS: nucleotide sequence of 40 and 41, and (b) a twelfth extension reaction primer, which has a nuclear nucleic acid sequence of SEqidn〇: 43 Wherein the twelfth primer set is used for detecting the mononuclearity of H_FABp, which is located at 411 (H-FABP-G411C) of SEQ ID NO: 45; and (B) is a reaction product of the deuteration to obtain the foregoing A signal of a genotype of a mononucleotide acid polymorphism in which the signals can be distinguished from one another. A variety of molecular markers of the heart. The present invention also provides a kit for simultaneously detecting the genotype of H-FABP, which includes the aforementioned tenth introduction group to 201137355. Each of the specific examples of the present invention will be exemplified by the following. Other details of the invention are apparent. The Secretary of the Treasury and the scope of the patent application are generally known as: ί;: ί 述 ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' . The present invention designs nine primer sets for nine nuclear micro-multiple molecular markers related to the important economic traits of pigs. Scale molecules = including ESR-A65G, RBP4-G29C, CRC-C33T, PRLR-A77G, CAST -G47A, CAST-G143A, FUT1-G66A, MC4R-G156A, and RN-G216A. Table 1 lists the primer sets, corresponding molecular markers, and related sequence numbers of the design of the present invention.

Molecular marker (1) First primer set (a) First PCR primer pair (SEQ IDNOS: 1 and 2) (b) First extension reaction primer set (SEQ ID NO: 3) (2) Second primer set (a) First PCR primer pair (SEQ IDNOS: 4 and 5) (b) First extension reaction primer set (SRO ID NOS: 6)

ESR-A65G Molecular marker corresponding sequence and position SEQ ID NO: 28 65th test position

RBP4-G29C SEQ ID NO: 29 29th base position (3) Third primer set (a) First PCR primer pair

CRC-C33T SEQ ID NO: 30 33rd base position 201137355 (SEQ IDNOS: 7 and 8) (b) First extension reaction primer set (SEQ IDNOS: 9) ------ too y 丄, W 〆 / ( 4) Fourth primer set (a) First PCR primer pair (SEQ IDNOS: 10 and 11) (b) First extension reaction primer set s__JSEQIDNOS: 12) PRLR-A77G SEQ IDN0: 31 77th base position (s) Five primers (a) First PCR primer pair (SEQ ID NOS: 13 and 14) (b) First extension reaction primer set ___JSEQ ID NOS: 15) CAST-G47A SEQ ID NO: 32 47th base position (6) Sixth primer set (a) First PCR primer pair (SEQ ID NOS: 16 and Π) (b) First extension reaction primer set s_JSEQIDNOS: 18) CAST-C143A SEQ ID NO: 33 143th base Position (7) Seventh primer set (a) First PCR primer pair (SEQ IDNOS: 19 and 20) (b) First extension reaction primer set ^___ (SEQ ID NOS: 21) FUT1-G66A SEQ ID NO: 34 66 base positions (8) eighth primer set (a) first PCR primer pair (SEQ ID NOS: 22 and 23) (b) first extension reaction primer set ~s·___ (SEQ IDNOS: 24) MC4R- G156A SEQ ID NO: 35 156th base position ~~~多九引子组RN-G216A SEQ ID NO: 36 201137355 216th test position (a) First PCR primer pair (SEQ ID NOS: 25 and 26) (b) First extension reaction primer set (SEQ ID NOS: 27) Monthly 九 Nine molecular markers ESR-A65G, RBP4-G29C, CRr'UST, PRLR-A77G, CAST-G47A, CAST-G143A, FUT1_G66A,

y(^R-G156A, and RN-G216A are related to important economic traits of pigs. The sequences corresponding to these molecular markers can be referred to Figures i to 9. SEQ ID N〇: 28 is the first base shown in Figure 1. The base is the sequence from the beginning to the last base, a total of 121 test sites. SEQ ID NO: 29 is the '5' of the RBP4 gene sequence shown in Figure 2, and the first bribe based on the 4-F2 From the beginning to the end - the sequence of the test, a total of M0 bases. SEQ ID NO: 3 〇 图 CRC CRC CRC CRC CRC CRC CRC CRC CRC CRC CRC gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene gene The last base fj column, a total of 243 test bases. SEq ID N〇: 31 series shown in Figure 4 pRLR because of the 5, the end of the CAST249_F1 corresponding to the first test ^ Zhao. To the next sequence of test A total of 3 蛉 蛉.

= The ith test base corresponding to the 5' end of the sequence PRLR_F1 is the sequence from the beginning to the last - thiol group, a total of 166 test sites, N〇201137355 ''·,,, ' after analysis of the reaction product, obtained The signal representing the base of the aforementioned single nucleotide polymorphism = 3⁄4, wherein the signals can be distinguished from each other without interfering with each other, so that the purpose of detecting the genotypes of a plurality of molecular markers can be simultaneously detected. Accordingly, the present invention provides a method for simultaneously detecting genotypes of a plurality of pig molecular markers, comprising: (A) using a nucleic acid sample from a pig as a template, and using a plurality of primer sets for primer extension reaction in the same reaction a reaction product, wherein the plurality of primers, and are selected from any one or more of the group consisting of the first to the ninth primer groups: (1) the first primer group, It comprises: (a) a first PCR primer pair comprising two primers, each having the nucleotide sequence of SEQ ID N〇S: 1 and 2, and a column (b) a first extension reaction primer having SEQ IDN〇 A nucleotide sequence of 3, wherein the first primer set is used to detect a single-glycosidic acid polymorphism of the esculin receptor (ESR), which is located at the 65th base position of SEQ ID NO: 28 ( ESR-A65G); (2) A second primer set comprising: (a) a second PCR primer pair comprising two primers, each having a SE sequence of NOS: 4 and 5, and (b) a second extension reaction primer having the nucleotide sequence of SEQn)N0:6; wherein the first primer set is used for detection Depending sterile binding protein 8 (trans >

A single nucleotide polymorphism, which is located at the 29th test position of SEQ ID NO: 29 (RBP4-G29C); X (3) third primer set, which includes:

(a) A third PCR primer pair containing two primers, each having an SE

NOS: nucleotide sequences of 7 and 8, and ^MD (b) a third extension reaction primer having the SEQ ID NO: 9 < terminal tannic acid sequence; 201137355 wherein the second primer set is used to detect about ions The single nucleotide polymorphism of the release channel acceptor (CRC-C33T) is located at the 33rd base position of seq id NO: 30 (CRC-C33T); (4) The fourth primer set includes: a) a fourth PCR primer pair comprising two primers, each having a SEqid NOS: nucleotide sequence of 10 and 11, and (b) a fourth extension reaction primer having a core sequence of SEQ ID NO: Wherein the 'fourth primer set is a single nucleotide polymorphism for detecting a mononucleotide-glycosidic polymorphism of the prolactin receptor (PRLR), which is located at the 77th base position of SEQ ID NO: 31; (PRLR-A77G); (5) a fifth primer set comprising: (a) a fifth PCR primer pair 'which contains two primers, respectively having seq π) NOS: nucleotide sequences of 13 and 14, and b) a fifth extension reaction primer having the nucleotide sequence of SEQ ID NO: 15, wherein the fifth primer set is for detecting a single proteinase-inhibiting protein (CAST) a polymorphism, located at the 47th base position of SEQ ID NO: 32 (CAST-G47A); • (6) a sixth primer set comprising: (a) a sixth PCR primer pair, which contains two a primer having a nucleotide sequence of SEQ ID NOS: 16 and 17, respectively, and (b) a sixth extension reaction primer having the nucleotide sequence of SEQ ID NO: 18; wherein the 'sixth primer set is for detection a single nucleotide polymorphism of calpain inhibitory protein (CAST) located at the M3 base position of SEQ ID NO: 33 (CAST-C143A); (7) a seventh primer set comprising: a seventh PCR primer pair comprising two primers, each having the nucleotide sequences of SEQ ID NOS: 19 and 20, and 201137355 (b) a seventh extension reaction primer having the nucleotide of SEQ ID NO: a sequence; wherein, the seventh primer set is used to detect a single nucleotide polymorphism of α-fucosyltransferase (FUT1), which is located at the 66th base position of SEQ ID NO: 34 (FUT1-G66A) (8) an eighth primer set comprising: (a) an eighth PCR primer pair comprising two primers having nucleotide sequences of SEQ ID NOS: 22 and 23, respectively, and (b) An eighth extension reaction primer having the nucleotide sequence of SEQ ID NO: 24; wherein the eighth primer set is for detecting a single nucleotide polymorphism of melanocortin receptor 4 (MC4R), which is located in SEQ ID NO: the 156th home position of the 35th (MC4R-G156A); and (9) the ninth primer set, which includes: (a) a ninth PCR primer pair, which contains two primers, each having a seq id NOS: a nucleotide sequence of 25 and 26, and (b) a ninth extension reaction primer having the nucleotide sequence of SEQ ID NO: 27; wherein the 'ninth primer set is for detecting a single acid gene (leg) a nucleotide polymorphism, which is located at the 216th base of SEQ ID NO: 36 (RN-G216A); and (B) analyzes the reaction product to obtain a single nucleotide polymorphism A signal of a genotype in which the signals can be distinguished from one another. The term "-" as used herein, unless specifically stated otherwise, refers to one or more (i.e., at least one) of the words that are connected by the article. For example, "a component" means one element or more than one element. As used herein, "nucleic acid" or "oligonucleotide" is a history of a phase-nuclear acid monomer or a double-stranded, linear or cyclic, deoxyribose nucleus (N) or ribose machine (rnA)...nuclear (four) The body includes the Wei Ke part, 14 201137355 glycosyl part and the base part. Common bases of nucleotides include guano (G), adenine (A), cytosine (c), thymine (T), and uracil (U), in which adenine and thymine or uracil Pairing, as well as pairing of guano and cytosine.

As used herein, "nucleic acid sample" refers to any nucleic acid containing reagent or sample that can be isolated from a source of natural organism or produced by chemical synthesis or polymerase chain reaction (PCR) amplification techniques. Methods for purification of nucleic acids, chemical synthesis and PCR amplification can be found in Molecular Cloning: A Laboratory Manual 'First Edition, Cold Spring Harbor Laboratory Press, SambrookJ, eds. '1989 and Current Protocols in Molecular Biology', edited by Frederick M_A• et al. , 200 Bu John Wiley & Sons,

Inc. As used herein, "single nucleotide polymorphism (SNp)" refers to an alternating gene of DNA at the same locus between different individuals, with only a single nucleotide difference. The type of SNP can be a transition or a transversion, replaced by a substitution between a purine and a purine or a pyrimidine and a pyrimidine (A(a)G or c(a)τ), and a transversion is a substitution between purine and pyrimidine (AhC, A^). t, Gec or G(一)Τ) 、 , The "alternative gene" (allele) is also referred to as a dual gene or allele. The gene is located at a specific location on the chromosome (locus). The two sets of chromosomes are born, and the body is squatting. There are one pair of (two) alternating genes at the same locus. The two parental genes can be of the same or different forms. The same one is called the homozygous allele. ), different, called heteroezygous allele. The soil is also swallowed. The "single nucleotide polymorphism genotype" or rSNp genotype or other similar terms used herein refers to the sequence composition of the SNP alternate genes. The basis for the single-nuclear polymorphism of the nucleic acid sample from the individual can be used to test the money of the single-core thief. In the case of diploid organisms, there are two copies of C-like filaments for specific SNPs, the c-allele is 201137355, and the genotype is cc; and the individual A has the two A alleles. The homologous combination of genes whose genotype is AA; the individual with each one allele is a heterotypic combination, its genotype. * "Introduction" as used herein refers to a oligo-nucleic acid with a specific sequence, which can be used as a starting point for the action of fresh acid catalyzed by DNA polymerase. The "extension extension reaction" described herein mainly uses PCR and nucleic acid sequencing, and basically designs a PCR primer pair for a specific SNP, and uses the pCR primer pair to amplify the nucleic acid fragment covering the SNP by PCR technology, and then removes After the reagent is not added, the extension reaction primer is added to perform single base extension on the amplified nucleic acid fragment; wherein the extension end of the extension reaction primer is located upstream (5, end) or downstream of the SNP (3, In the direction of a test base, when adding a double deoxynucleotide (ddNTp) labeled with different fluorescent dyes for DNA polymerization, similar to the principle of sequencing, ddNTp will terminate the synthesis of DNa, and finally The genotype of the SNp to be detected is interpreted by the presentation of different luminescence. Soil The "same reaction" described herein, when describing the progress of the primer extension reaction, means that at least two different PCR primer pairs and/or extension reaction primers are simultaneously reacted in the same reaction chamber (e.g., a test tube). In one embodiment, a multiplex PCR reaction can be performed by adding multiple pairs of PCR primers in a single tube, and then a plurality of extension reaction primers are added to the same tube, followed by a single base extension reaction. In another embodiment, the PCR reaction may be performed separately in different test tubes in different sub-groups, and then the proliferating PCR product is integrated into a single test tube, and then multiple extension reaction primers are added to continue the single-base extension. reaction. A specific numbered nucleotide sequence as described herein includes a complementary sequence which has the same number of nucleotides as the specific numbered nucleotide sequence, and when aligned, the corresponding positions are Nucleotides are fully paired according to the aforementioned method of pairing. 16 201137355 The nuclear complex sequence described in this paper also includes its substantive sequence. The essence is the same as f= and the nuclear sequence of the specific job is the same in the prefecture structure and the quality of life. In the sequence structure, the same sequence of the same sequence may be the same or different from the length of the nucleotide sequence corresponding thereto, and in the case of sequence alignment, the corresponding J 60%, preferably 70%, more preferably 8〇%, even better, 9〇%, the second one is the same. Alternatively, the sequence of the mutually adjacent pie-cakes can be hybridized under appropriate conditions, that is, ^ at the corresponding positions, and a considerable proportion of nucleotides are combined with each other according to the aforementioned pairing method. The base pair is formed; the equivalent ratio is preferably 6%, preferably 7%, more preferably 80%, still more preferably 90%. The best is more than 95%. Sodium sequence alignments can be performed using techniques well known in the art, for example, the BLASTN program of the University of Wisconsin Gene Computer Group (GCG), or otherwise, in the field, various methods for performing nucleic acid manipulation have been disclosed. 'See Sam BlO〇u et al., M-ι α.—: A ^b〇ratory Manual and Frededck M a et al. (5) She is in Molecular Biology. Outside the structure of the coffee column, the essentially identical sequence described in this article The corresponding nuclear functions are substantially identical in function 'for example', and have the function of hybridization to the corresponding motif to perform polymerase chain reaction or primer extension reaction. Nine primer groups designed according to Ben Maoming's remote use Any of the four or four, = combination into the scorpion (four) reaction '峨 辑 辑 的 的 分子 分子 分子 分子 分子 分子 分子 分子 分子 分子 分子 分子 分子 分子 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体 具体Gu Ren _ introduction group, any five introduction groups, any six introductions i 1 seven introduction groups, any kind of introduction group, or all nine introduction groups for the induction reaction. - Generally speaking According to the choice According to the existing knowledge and technology, the appropriate reaction conditions are adjusted, and V (A) is performed. For example, the thermal melting point (Tm) is calculated according to the primer sequence, and the appropriate PCR and primer extension reaction conditions are adjusted in 201137355. In the specific financial, the present invention 3 ί : skill group introduction 'in which the pCR reaction conditions of the ApCR primer pair, 94 C for 7 minutes, then listen for 1 minute, grab 1 minute, H clock 'total 35 cycles Finally, carry out 72t: 7 minutes, and add B. The extension reaction conditions after stretching the reaction primer are 96 Ϊ 10 sec, 5 (TC 5 sec, 6 〇 ° C 30 sec, for 25 cycles. The following examples describe the remaining specific Reaction details. The present invention is carried out in the single-tube and continuous-selection primers. The PCR reaction is carried out, and then the extension reaction primer of the k-introduction group is added to the same tube, followed by single bases. Extension reaction. ^Step (B) 'A person of ordinary skill in the art may choose any of the products of the conventional primer extension reaction to detect the genotype of the molecular marker involved; in a specific embodiment, the step (8) of the present invention Make ^ Ice method (eapillaiy eleetrophQresis) 'Check the genotype. The inner diameter capillary (4) is purchased with a high voltage separation nucleic acid sample. 8. The sample size is small and the cost is transferred. Commercially, according to the present invention, in the step ( Β), analyzing the signal from the step (4) against the genotype of the single-nuclear polymorphism, and the Ιίίi step-by-step description, in the specific example, using the ordering step (B), wherein the representative represents each single core The peaks of Wei multi-state $丨n LI can be distinguished from each other, * will be 4 or interfere with each other, and successfully achieve the same genotype of the molecular markers of the same day. Genes = a group consisting of four groups of molecules, a group of seven, a group of seven, a group of people, or a group of all kinds of cockroaches 201137355 The group of the invention may further contain other Reagents such as buffers, enzymes, fluorescent labels, and dyes. In another aspect, the present invention contemplates three primer sets for single nucleotide polymorphism molecular markers of heart-fatty acid binding protein (H-FABP), and these molecular markers include H- FABP-T204C, H-FABP-T89C and H-FABP-G411C. Table 2 lists Table 2

Primer group The primer set, corresponding molecular markers, and related sequence numbers designed in the present invention.

Molecular marker (1) Tenth primer group (a) Tenth PCR primer pair (SEQIDNOS: 37 and 38) (b) - Tenth extension reaction primer group----(SEQ ID NO: 39) (2) Tenth A primer set (a) Eleventh PCR primer pair (SEQIDNOS: 40 and 41) (b) Eleventh extension reaction primer set molecular marker corresponding sequence_column and position H-FABP-T204C SEQ ID NO: 44第204 Base position H-FABP-T89C SEQ ID NO: 45 89th base position ____ (SEQ ID NOS: 42)__ (1) Twelfth primer group H-FABP-G411C SEQ ID NO: 45 (a) Twelfth PCR The 411th base position of the primer pair (SEQIDNOS: 40 and 41) (b) The twelfth extension reaction primer set (SEQ IDNOS: 43) The above three molecular markers H-FABP-T204C, H-FABP-T89C and 11C Pigs are related to important economic traits. The sequences corresponding to the molecular markers can be referred to Figures 12 and 13. SEQ ID NO: 44 is the sequence of the H-FABP gene sequence shown in Figure 11, and the first primer of H-FABPUPST-F2 corresponds to the sequence of the first 201137355 base from the beginning to the last base, a total of 7 〇 9 bases. The base of the H-FABP gene sequence shown in Figure J2, the first base of the H_FABpintr_F2 corresponds to the sequence of the first base to the last base, a total of 816 bases. According to the present invention, the designed tenth primer group to the twelfth primer group can be used to carry out the primer extension reaction in the same reaction to generate a reaction product; and then the reaction product is analyzed to obtain three molecular markers H_FABp_T2〇4c, H^ABP. The signal of the genotypes of -T89C and H-FABP-G411C, wherein the ticks can be distinguished from each other and do not interfere with each other, so that the genotypes of three H-FABP molecular markers can be simultaneously detected. Therefore, the present invention provides a method for simultaneously detecting a genotype of a plurality of molecular markers of pig H_FABp, which comprises: using (A) a nucleic acid sample from a pig as a template, and using a plurality of primer sets for primer extension reaction in the same reaction a reaction product, wherein the plurality of primer sets comprises: (1) a tenth primer set comprising: (a) a tenth PCR primer pair comprising two primers each having a SEqID NOS: a core of 37 and 38 a nucleotide sequence, and (b) a tenth extension reaction primer having a nucleotide sequence of SEqIDN〇: 39; wherein the tenth primer set is used to detect a single nucleotide polymorphism of H-FABP, which is located SEQ ID NO: 44 at position 204 (H-FABP-T204C); (2) Eleventh introduction, which comprises: (a) an eleventh PCR primer pair containing two primers, respectively a nucleotide sequence having SEQ ID NOS: 40 and 41, and (b) an eleventh extension reaction primer having a nucleotide sequence of SEqIDN0: 42; wherein the eleventh primer set is for detecting H-FABP Single nucleotide polymorphism' which is located at the 89th position of SEQ ID NO: 45 20 201137355 (H-FABP-T89C); (3) The twelfth primer group, which includes: (a) the twelfth PCR primer pair, which contains two primers, each having a seq ID NOS: 40 and 41 nucleosides The acid sequence, and (b) the twelfth extension reaction primer, which has the nucleotide sequence of SEQ ID NO: 43; wherein the 'twelfth primer set is used to detect the mononucleic acid polymorphism of H-FABP' It is located at the 411th base position of SEQ ID NO: 45 (H-FABP-G411C); and (B) analyzes the aforementioned reaction product to obtain a signal representing the genotype of the aforementioned single nucleotide polymorphism, wherein These signals can be distinguished from each other. In a specific embodiment, the PCR reaction of the tenth primer group to the twelfth primer group in different test tubes is performed separately, and then the proliferated PCR product is integrated into a single test tube, and the tenth introduction group is added. The extension reaction primer to the twelfth primer group is followed by a single base extension reaction. According to the present invention, the pCR reaction conditions in which the PCR primer pair is added in the step (A) are preferably 94 C for 7 minutes, and then further performed at 94 ° C for 1 minute and 60 °. 〇 1 minute, 72 ° C 1.5 minutes, a total of 35 cycles, the last 72 ° C for 7 minutes, or • 94 ° C for 7 minutes, then 94 ^ 1 minute, 56 ° C for 1 minute, 72. (: 1.5 minutes, a total of 35 cycles 'final 72 ° C for 7 minutes; and the extension reaction conditions for the extension reaction primer is best 96. (: 10 seconds, 5 (TC 5 seconds, 60 C30 seconds, for 25 cycles) Further, in the step (B), it is preferred to analyze the reaction product by capillary electrophoresis to detect the genotype of the molecular marker. According to the present invention, in the step (B), the reaction product from the step (A) is analyzed, Obtaining a signal representing the genotype of the aforementioned single nucleotide polymorphism, wherein the 5th signal can be mutually distinguished. For example, when performing step (b) by capillary electrophoresis, the obtained representative single nucleotide polymorphism The peaks of the genotypes can be distinguished from each other, do not overlap or interfere with each other, and successfully achieve the simultaneous detection of three kinds of pig molecular markers (H-FABP-T204C, H-FABP-T89C and H-FABP-G411C) ^ 201137355 The purpose of & H 'f(4) is also provided by - shot _ Η Η _ Ρ Ρ 分子 = = = = = = = = , , , , , , 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因 基因Agents, examples i,, sputum, enzymes, fluorescent markers and dyes, etc. Yang hereinafter described various specific embodiments of the present invention in detail by the following iv-paste rail «fiscal shaped Examples 1: Genomic DNA Extraction of pigs

Blood samples from pigs (fine lions) used in this example. Take pig blood 'add anticoagulant, put 50 plus M〇dified ai峨π solution (glucose 20.5 g, sodium citrate 8. 〇g, citric acid citrate, sodium sulphate 4.2 g, add 2dH20 to 1000 μM, adjust the pH to 7 2_7 4) in a centrifuge tube and centrifuge at 3,000 rpm for 15 minutes. Draw the white blood cells from the middle layer into another centrifuge tube, add 0.9% normal saline to 10 mi, and use a plastic pipette to absorb the cells several times to resuspend the white blood cells. After centrifugation for 15 minutes at 3 rpm, collect the white blood cells. A clean centrifuge tube. Add three volumes of 〇87% NH4C1 and mix well for 10 to 20 minutes to dissolve the red blood cells, then centrifuge with 3, 〇〇〇 (Model SCT5B, HITACHI) for 15 minutes to remove the supernatant. The precipitated white ok balls were washed twice with 10 ml of 〇_9 〇/0 physiological saline, and centrifuged for 3 minutes at 3, 〇〇〇 1 claws, and the supernatant was removed. The white blood cells were then resuspended by adding 3 ml of TNE buffer (1 mM Tris-Cl pH 8.0, 150 mM NaCl, 10 mM EDTA). 150 μl of 10% SDS, 50 μl of protease κ (10 mg/ml) and 45 μl of collagenase were placed in a 45 ° C shaking water bath for at least an hour. Each of the same volume of test, age / gas and chloroform was extracted r times, each time at 3,300 rpm for 20 minutes, the upper layer was taken. The above supernatant solution is prepared by adding twice the volume of isopropanol and 1/10 volume of 3MCH3COONa (pH 5.2) or 5 M NaCl, and then adding appropriate amount of TE buffer or sterile deionized water to dissolve the DNA for subsequent analysis. use. 22 201137355 Example 2: Identification of genotypes by capillary electrophoresis According to the nucleotide sequence of the gene mentioned in the previous literature, for ESR-A65G, RBP4-G29C, CRC-C33T, PRLR-A77G, CAST-G47A, CAST-C143A, FUT1 -G66A, MC4R-G156A, and RN-G216A and other molecular markers designed from the first primer group to the ninth primer group (Table 1 and Figures 1 to 9)' and for H-FABP-T204C, H-FABP-T89C and H Molecular markers such as FABP-G411C were designed from the tenth to the twelfth primer group (Table 2 and Figures 11 and 12) for multiplexed SNP genotype detection. For PCR proliferation, take 2 mL of sterile microcentrifuge tube and add 10X PCR reaction buffer, 2.5 mM dNTPs (dATP, dCTP, dGTP ^dTTP), one or more pairs of PCR primers, sputum, 2U. _DNA polymerization s# and the appropriate pig genomic DNA template, adjust the volume to ι〇 with sterile water

pL, gently mixed, placed in a centrifuge for a brief centrifugation. The pcR reaction was performed on a GeneAmp® pcR system 27® (Applied Biosystems) instrument. PCR reactions using different primer sets can be performed in the same reaction mode in the same tube as needed, or separately in different reaction modes in different tubes. The proliferated PCR product was taken as 2 (four) amount indicator, filled with % agar, and the electrophoresis conditions were i (8) volts, and the time was % = E-bonded dyeing. The length of DNa % ▼ was observed by ultraviolet * lamp irradiation. Multi-type SNp genotype detection = production: ί number reaction primers simultaneously enter the second 二 2 ^ product after the capillary capillary electrophoresis, determine the corresponding molecular marker gene such as ϋ Ϊ touch the first - primer group to the ninth The detailed reaction conditions of the PCR reaction, the extension reaction, and the capillary electrophoresis of the primer set. heart'

Esr: AA/46/green ΛΒ/45,46/ΜΜ Table 3 Gene PCR primer (name and sequence) ESR tbk-h 1. — fSECXN〇affCttttaCagaS·3 23 201137355 ESR-R1: 5'-cacttcgagggtcagtccaattag -3' ( SE〇ID NO: 2) (SEQ ID NO: 3) BB/45/Blue RBP4 RBP4-F2: 5 '-tctgactggggagggaaag-3, (SEQIDN0:4) RBP4(G29C)-n 5,-gactggggagggaaaggagaac cgc-3, (SEQ ID NO: 6) RBP4: AA/26/blue AB/26, 27/blue-black BB/27/black RBP4-R2: 5 *-tgtctgtaaaggtgcccac-35 (SE〇ID NO: 5) CRC Stress gene-Fl : 5'_gttccctgtgtgtgtgcaat -3' (SE〇ID NO: 7) CRC(C33T)-f2 5'-gactatgactatgtgcaatcgtgtg gccgtg -3 (SEQ ID NO: 9) CRC: AA/33/Black AB/33, 36/Black Red BB/36/Red Stress Gene-Rl: 5'-agcaagttctcagtaatgagat -3' (SEO ID NO: 8) PRLR PRLR-Fi: 5 *-cgtggctccgtttgaagaacc-3' (SEO ID NO: 10) PRLR(A77G)-0 5 '-gagctgcgaaagacctggcc ·3, (SEQ ID NO: 12) PRLR: AA/24/green AB/23, 24/blue-green BB/23/blue PRLR-R1: 5*-ctgaaaggagtgcataaagcc -3 (SE〇ID NO: 11 CAST CAST249-F1: 5-aaatctactggagaggttttgaa -3 (SEQIDNO: 13) CAST249(G47A)-rl 51 -gtggagcagcagcg Ctt-3 (SEQ ID NO: 15) CAST(249): C AST249Arg/249Arg/19 / black CAST249Arg/249Lys/l 9 , 21/black red CAST249 Lys /249 Lys/21/red CAST249-R1: 5 ' - Gacttctcccgaatcagttcc-3 * (SEQIDNO: 14) CAST CAST638-F1: 5-aaacctattttcagggatatggg -3 (SEQIDNO: 16) CAST638(C143A)-fl 5 * -gactgactctcaggggattttgaca g-3, (SEQ ID NO: 18) CAST(638): CAST638Arg/638Arg/30 /Green CAST638Arg/63 8Serg/3 0 Ή/里绿CAST638Ser/638Serg/31 /Black CAST638-R1: 5-ctttgttgtgttctctgagg -3 (SEQ ID NO: 17) FUT1 FUT1-F1: 5'-ggactatttacccggatggc -3' (SEO ID NO: 19) FUTl(G66A)-f3 5 '-gactgactgactgacttatgccac gctgctggccctg-3, (SEQ ID NO: 21) FUT1: GG/38/Blue GA/38, 39/Blue Green AA/39/ Green FUT1-R1: 5 '-atggcaggctggatgaag-3' (SEQ ID NO: 20) MC4R MC4R-F1: 5'-ccctgaccatct tgattg-3' (SEO ID NO: 22) MC4R(G156A)-G 5 '-gactagctgacttgatcatgtgtaat tccatcatc -3* (SEQ ID NO: 24) MC4R: 11/36/Blue 12/36, 37/Blue Green 22/37/Green MC4R-R1: 5'-gctagacaaatcacagagg-3 ' (SEO ID NO: 23) RN ( PRKAG3) γΑΜΡΚ-Fl: 5'-ggaacaaatgtgcagacaag- 3' (SEQ ID NO: 25) PRKAG3(G216A)-fl 5'-gactgactgactgactgactgact gactgactgactctggtggccaacgg cgtcc-3 (SEQ ID NO: 27) PRKA: (m+/m+)/55/blue (RN7m+)/55,56/blue-green (RN7 RN_ ) / 56 / green γ ΑΜΡΚ - Rl: 5, cccacgaagctctgcttctt - 3 * (SEQ ID NO: 26) PCR reaction conditions: 94 ° C 7 min - (94. (:1111111,59.〇1〇1丨11,72.(:丨.5111丨11) χ35 cycle—72°C 7min—25. 匚〇〇Initiator extension reaction conditions: (96°C, 10 sec, 50° C, 5 sec, 60 ° C, 30 sec) x 25 cycles - 25 ° C, capillary electrophoresis conditions: 45 min / time, SnaPshot product (0.5 uL), Hi-Di formamide (9.25 uL), LIZ-丨20 standard (0.25 uL). * * Genotype: an identical letter (such as AA) represents a homologous alternate gene, and different abundances (such as ab) represent a hybrid jjii alternation gene.

Table 4 shows the detailed reaction conditions of the PCR reaction, the primer extension reaction, and the capillary electrophoresis using the tenth primer group to the twelfth primer group. 24 201137355 Table 4 Gene PCR primer (name and sequence) PCR reaction pattern extension primer (name and sequence) genotype V position / peak color H-FABP (5 ^ upstream region) HFABPupst-F2: 5 '-aagaggaccaagatgcctacgcc gcggaga-3' (SEQ ID NO: 37) HFABPupst-R2: 5 *-ctgcatctttgaccaagagg-3 * (SEQ ID NO: 38) 1 H-FABPupst(T204C)-fl 5,-cagcggcttccttctcagat-3 ' (SEQ ID NO: 39) H-FABP ( 5' upstream region): HH/23/Red Hh/23, 24/black red hh/24/.f. H-FABP (intron 2) HFABPintr F2: 5'-attgccttcg gtgtgtttgag-3' (SEQ ID NO : 40) HFABPintr R Bu 5 '-tcaggaatgggagttattgg· 3, (SEQ ID NO: 41) 2 H-FABPintr(T89C) -fl 5' -gactggggagggaaaggaga accgc-3' (SEQ ID NO: 42) H-FABP (included Sub 2): AA/30/black Aa/30, 35/black red aa/35/red H-FABPintr(G411C)-n 5 ' -aaacgccaacagttctatggga tg-3, (SEQID*NO:43) H-FABP (inside Containing 2): DD/26/black Dd/26,26/black-blue dd/26/blue ηκ Han Ying chess type y.y4C: 7mm—(94Clmm, 60Clmin, 72tl.5min) x35 Cycle—72. 〇7111丨11->25. (:〇〇? L94.07.——(94°C«lmin, 56°C lmin, 72°C 15min) x35 Cycle-72°C7min-25°C c〇Initiator extension reaction conditions. (96 C, 10 Sec, 50 C, 5 sec, 60 ° C, 30 sec) x 25 cycles - * 25 t, fistula electrophoresis conditions: 45 min / time ' SnaPshot product (0.5 UL), Hi-Di formamide (9.25 uL), LIZ-120 standard (0.25 uL) 〇3 factor: phase 126—letters (eg, AAj represents a homotypic alternation gene, and different letters (eg, AB) represent a heterozygous alternation gene. Figure 10 shows the use of the first primer set of the invention to The ninth primer group performs multiple primer extension reactions to detect molecules such as ESR-A65G, RBP4-G29C, CRC-C33T, PRLR-A77G, CAST-G47A, CAST-G143A, FUT1-G66A, MC4R-G156A, and RN-G216A. Results of labeled genotypes. Figure 13 shows the use of the tenth primer set to the twelfth primer set of the present invention for multiple primer extension reactions to detect molecular markers such as H_FABp_T2〇4C, H-FABP-T89C and H-FABP-G411C. Results of the genotypes. As shown in Figures 10 and 13, the genotypic detection of various pig molecular markers according to the present invention does not cross each other. Disturbing each genotype representing a specific molecular marker can be clearly interpreted as 'no overlap. The present invention breaks through the common interference of the 引 heavy primer extension reaction. ^Successfully 纟 纟 检测 检测 检测 检测 检测 检测 检测 检测 检测 检测The purpose of this is to make a significant contribution to the selection of pigs with important economic traits. [Simplified Schematic] Figure 1 shows the design position and name of the pig ESR-A65G gene sequence, pcR primer and extension counter 25 201137355. The position and name of the pig RBP4_G29C gene sequence, pCR primer and extension reaction primer are shown. 〃 Figure 3 shows the design location and name of the CRC-C33T gene sequence, pCR primer and extension reaction primer in pigs. Figure 4 shows the PRLR-A77G gene in pigs. Sequence, pCR primer and extension reaction primer design position and name. Figure 5 shows the pig CAST-G47A gene sequence, pCR primer and extension reaction primer design position and name. Figure 6 shows the pig CAST-C143A gene sequence, pCR primer and Extension reaction primer design position and name. ', % Figure 7 shows pig FUT1-G66A gene sequence, pCR primer and extension reaction primer design position Name and Figure 8 shows pigs MC4R-G156A gene sequence, primer PCR reaction primer designed location and name of the extension. Figure 9 shows the design location and name of the RN-G216A gene sequence, pCR primer and extension reaction primer. ^ Figure 10 shows capillary electrophoresis analysis; ESR-A65G, RBP4-G29C, CRC-C33T, PRLR-A77G, CAST-G47A, CAST-G143A, FUT1-G66A, MC4R-G156A, and RN-G216A As a result of the type, (1) to (4) are the results of tests from different pig individuals. Figure 11 shows the pig H-FABP (5' upstream region) gene sequence, the location and name of the PCR primer and extension reaction primer design. Figure 12 shows the design sequence and name of the H-FABP (intron 2) gene sequence, PCR primer and extension reaction primer. Figure 13 shows the results of capillary electrophoresis analysis of molecular markers such as H_FABp_T2〇4c, H-FABP-T89C and H-FABP-G411C, among which (a), (B) and (C) are from different pig individuals. As a result, the genotypes were ddaaHH, DdAaHh, and DDAAhh, respectively. 26 201137355 Sequence Listing <110> National Chung Hsing University <120> Method and kit for detecting genotypes of pig molecular markers <130> CHU0002TW <160> 45 <170> Patentln 3.5 version <210><211> 27 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 1 cctgttttta cagtgacttt tacagag 27

<210> 2 <211> 24 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 2 cacttcgagg gtcagtccaa ttag 24 <210> 3 <211> 44 <;212>DNA<213> Artificial Sequence<220><223>Intro<400> 3 tacagagtat atctaaagat gcagaatcaa gttttatgag acca 44

<210> 4 <211> 19 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 4 tctgactggg gagggaaag 19 <210> 5 <211> 19 <212> DNA <213> artificial sequence <220><223> primer <400> 5 tgtctgtaaa ggtgcccac 19 1 201137355 <210> 6 <21.l> 25 <2X2> DNA <21:i>; artificial sequence <220><223> bow &子<40ϋ> 6 gactggggag ggaaaggaga accgc 25 <210> 7 <211> 20 <212> DNA <21 3> Artificial sequence <220>;223> Introduction <400> 7 gttccctgtg tgtgtgcaat 20 <210> 8 <211> 21 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 8 agcaagttct cagtaatgag at 22 <210> 9 <211> 31 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 9 gactatgact atgtgcaatc gtgtggccgt g 31 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220><223> Introduction <400> 10 cgtggc Tccg tttgaagaac c 21 <210> 11 <211> 21 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 11 ctgaaaggag tgcataaagc c 21 2 201137355 <210><211> 20 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 12 gagctgcgaa agacctggcc <210> 13 <211> 23 <212> DNA <213>; artificial sequence <220><223> primer <400> 13

Aaatctactg gagaggtttt gaa <210> 14 <211> 21 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 14 gacttctccc gaatcagttc c <210> 15 <211> 17 <212> DNA <213> artificial sequence <220><223> primer <400> 15 gtggagcagc agcgctt <210> 16 <211> 23 <212> DNA <213>artificial sequence<213>;220><223> primer <400> 16 aaacctattt tcagggatat ggg <210> 17 <211> 23 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 17 201137355 aaacctattt tcagggatat ggg 23 <210> 18 <211> 26 <212> DNA <213> Artificial sequence <220><223> Introduction <400 18 gactigactct caggggattt tgacag 26 <210> 19 &lt ;211> 20 <212> DNA <213> Artificial Sequence <220><223> Bow Tie <400> 19 ggactattta cccggatggc - 20 <210 20 <211> 18 <212> DNA <;21:B> Manual Sequence <220><223>Intro<400> 20 atggcaggct ggatgaag 18 <210> 21 <211> 37 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 21 gactgactga ctgacttatg ccacgctgct ggccctg 37 <210> 22 <211> 18 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 22 ccctgaccat cttgattg 18 <210> 23 <211> 18 <;212> DNA <213> artificial sequence <220><223> primer <400> 23 4 201137355 gctagacaaa tcacagagg 19 <210> 24 <211> 35 <212> DNA <213><220><223> Intro <400> 24 gactagctga cttgatcatg tgtaattcca tcatc 35

<210> 25 <211> 20 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 25 ggaacaaatg tgcagacaag 20 <210> 26 <211> 20 <212> DNA <213>Artificial sequence<220><223>Intro<400> 26 cccacgaagc tctgcttctt 20

<210> 27 <211> 55 <212> DNA <2X3> Artificial sequence <220><223> Introduction <400> 27 gactgactga ctgactgact gactgactga ctgactctgg tggccaacgg cgtcc 55 <210> 28 <211&gt ; 121 <212> DNA <213> Sus scrofa <400> 28 cctgttttta cagtgacttt tacagagtat atctaaagat gcagaatcaa gttttatgag 60 accaactttt cttgtcaagt ccccattcca ccctattcta attggactga ccctcgaagt 120 g 121 <210> 29 <211> 140 <212> DNA <; 213 > Sus scrofa < 400 > 29 tctgactggg gagggaaagg agaaccgcgg gtgggatgga gggaagacac cctttgcttg 60 5 201137355 gcctggctca ggatccacct ggcttttgca gtaactggga cgtgtgcgca gacatggtgg 120 gcacctttac agacaccgag 140 < 210 > 30 < 211 > 243 < 212 > DNA < 213 > Sus scrofa <400> 30 gttccctgtg tgtgtgcaat ggtgtggccg tgcgctccaa ccaagatctc attactgaga 60 acttgctccc tggccgcgag cttctgctgc agacaaacct catcaactat gtcaccaggt 120 ctggcccccc aacctttgac cccagagctt agaaccctcc accaccccgc cccgactcag 18 0 agactccact ccggtgaatg gcccttcctc cgtcccccac ccccggactt aatgccagtc 240 ccc 243 < 210 > 31 < 2U > 166 < 212 > DNA < 213 > Sus scrofa < 400 > 31 cgtggctccg tttgaagaac caaccaagga gaccccgcca tcccggccgc agaatccagc 60 tgcgaaagac ctggccagct tcaccacggc cccgggccac tgcagacacc cgctgggtgg 120 gctggattac ctcgatcccg caggctttat gcactccttt cagtga 166 < 210 > 32 < 211 > 300 < 212 > DNA < 213 > Sus scrofa < 400 > 32 aaatctactg gagaggtttt gaaagctcag tctgttgggg taatcagaag cgctgctgct 60 ccaccccacg agaaaaaaag aagggtggaa gaggtataaa tcattacttc tttgcaacga 120 agcatggtct gcctgacagc agatgctttc ctgaggctta tggagctgat tcgggagaag 180 tccgattgtg catcacactt gatgagtgtc tttgcgctcc tggtcctgtg tggagtagtg 240 aaaccagtca gggttcactc ggtcatctcc aggcaggcct tctctttctg caaatgcttg 300 < 210 > 33 < 211 > 248 < 212 > DNA < 213 > Sus scrofa < 400 > 33 aaacctattt tcagggatat gggaaaatat cccacagagc attctctcct ttgcctcttc 60 Attgatggcc atttcta tta atatctcaga aacctgaagc tgcccaagat cccattgatg 120 ccctctcagg ggattttgac agatgtccat caactacaga aacctcagag aacacaacaa 180 aggtactgtg ctttttcata ctgactttcc ttaagtgtgt gggtacatac atacaatttt 240 agactgta 248 < 210 > 34 < 211 > 231 201137355 < 212 > DNA < 213 > Sus scrofa < 400 > 34 ggactattta cccggatggc cggtttggga accagatggg acagtatgcc acgctgctgg 60 ccctggcgca gctcaacggc cgccaggcct tgccatgcac gccgtcctgg 120 cccccgtgtt ccgcatcacg ctgcctgtcc tggcgcccga ggtagacagg cacgctcctt 180 ggcgggagct ggagcttcac gactggatgt ccgaggatta tgcccactta a 231 & lt tcatccagcc; 210 > 35 < 211 > 410 < 212 > DNA < 213 > Sus scrofa

≪ 400 > 35 ccctgaccat tattctatat tgtatctcat gccaagaact gtgatttgtc gactttctcc tcagttgaga cttgattggg ctcctgcccc cctgatcatg gaggaaaacc tagcagatat ttacacagtc cattctattg gtctttgtgg cagaatccat tgtaattcca ttcaaagaga taaatgggga tggacaatat tataaattta tctgctgggc actgtgtgtg tcatcgatcc tcatctgttg cagaggagac gcttcaacaa agttcgtgat ccccttcttc cttcatgtct cctgatttat ctatcccctg ttataaatgc cagcattttc tctgctcagt ctccacttaa cactttaatt gcactccgga ggtggcctct aagcataaga ttgtaaggca 60 120 180 240 300 360 410 <210> 36 <211> 407 <212> DNA <213> Sus scrofa

≪ 400 > 36 ggaacaaatg agcaggctca ggacctctga gaaggccttc gaagcagagc gggggacctt caggggcctg tgcagacaag tgtagaggca ggcgcaggga tttgccctgg ttcgtgggtg gtggggtgat gcctggagag gatctcgtgg ggcccgggag acgattcacc tggccaacgg aggaggggct tctagggccg ggggggagca agggcatgcc gcgcccggtg ctcaactgtt cgtccgagcg ggggaggcag agctctgaca tttgaccccg aggacgtggg gaagaaccct ctctccggcg gcacctttgt aggtggtggg caccacaggc gtctcct agaggcagac ggctggcagg ctcagatcaa gggacagcaa gaagggaata ttcaaccaag 60 120 180 240 300 360 407 <210> 37 <211> 30 <212> DNA <213> Artificial sequence <220><223> Introduction <400> 37 aagaggacca agatgcctac gccgcggaga 30 <210> 38 <211&gt 20 <212> DNA <213> Artificial sequence 201137355 <220><223> Introduction <noo> 38 ctgcatcttt gaccaagagg 20 <210><211><212><213> 39 20 DMA Artificial sequence <220><223> primer <400> 39 cagcggcttc cttctcagat 20 <210><211><212><213> 40 21 DNA Sequence <220><223> primer <400> 40 attgccttcg gtgtgtttga g 21 <210><211><212><213> 41 20 DNA artificial sequence <220><223><400> 41 tcaggaatgg gagttattgg 20 <210><211><212> 42 27 DNA artificial sequence <220><223> Introduction <400> 42 gactggggag ggaaaggaga accgc 25 <210><211><212><213> 43 24 DNA artificial sequence <220><223> primer <400> 43 aaacgccaac agttctatgg gatg 24 <210><211>·<212><213> 44 660 DNA Sus scrofa 8 201137355 < 400 > 44 aagaggacca agatgcctac gccgcggaga gtcggccaga actttcccag cggggcatca 60 gcccaagagt gagtttcctt tctcctctag tctctcatct ctgttcggac cccaggctcg 120 tggagggacc aggaaaccga agatgtccat gacctgcgcc ccaactcgcg ggctccgtgc 180 ccccagcggc ttccttctca gattccgaag agcgccttga ggccaggaaa ggggactggt 240 cctgccagcc ccggggaggg attcggatcc cgggtacccg tgctgccggg cgcctacggg 300 ctgccccttc ctctttcggc aggctgggg g atgggcgatc aacccggcga ggcagcgcct 360 gcatggggct tcctatttcg ggagcggggg cgtacgccac gcctcgtcac gtgacgctag 420 ggccatttaa agcggtagcg cgggctggga gccgccggtc ctggaatttt tgcgcgcctg 480 ttctgtcgtc tctttctcag cctagcccag cctcaccatg gtggacgcct tcgcgggcac 540 ctggaagcta gtggacagca agaatttcga tgactacatg aagtcaattg gtgaggacga 600 ctcgggatgt tgggctggga agaggttggc cgcgtgcccg gccggagcct tgctccagcc 660

≪ 210 > 45 < 211 > 816 < 212 > DNA < 213 > Sus scrofa < 400 > 45 attgccttcg gtgtgtttga gtgtctttct gccaagcctc agctccccct ccttccaagg 60 aggaggggac atctaccctc tctcaggatc ggctaccctg cagcagcttg cctcaggcct 120 cccagcccct gggccaggca tggaagaggg agaactggga ggtttgctct ctacagggtg 180 tccctatagt agtatctttt caccagaccc gatcattcag ctactcagct gtttcctctt 240 cctcacagct gcctccaata gtttcctcct tgtggaggaa gcgggcagca gagatgggac 300 agtacccaga gatggagagg tgcctgtcct accacatgct tttaacttaa agtagcctac 360 cttcttgagg ggcaagaaat ccaattaaac gccaacagtt ctatgggatg gccaggctag 420 aaataatctg ctctgagtgg acaaaaagct gggggaatgg gaatgaggaa ggtgatcata 480 agggtgtacc cctagcccta aacacacaca gccttttcag attctcctat taagcctgct 540 cagtcacggt cccctagcct ggcttagagc ccccagactt ctagaagaga cacctgggag 600 agctgccaaa tgagaaccag ctgatgtgga ctggcagcag Cacccagaag agtttaagtg 660 gacatttaac cagggctgtg gaacactcca agggtaccca gccccaggac aaggcagttg 720 ctgcccactt gtcagctgaa gggctcacat gatatggacc aagaggagta ggaatacag g 780 gcagagtcct aattttccaa taactcccat tcctga 816

Claims (1)

201137355 VII. Scope of application: 1. A method for simultaneously detecting genotypes of a plurality of pig molecular markers, including: 'A (A) using a nucleic acid sample from a pig as a template, using a plurality of primer sets in the same reaction Performing an extension reaction to generate a reaction product, wherein the plurality of primer sets are selected from any one or a combination of four or more of the group consisting of the first to the ninth introduction groups: (1) the first introduction group And comprising (a) a first PCR primer pair comprising two primers, each having a nucleotide sequence of SEqID NOS: 1 and 2, and (b) a first extension reaction primer having SEQ ID N〇: 3 a nucleotide sequence; wherein the first primer set is for detecting a single nucleotide polymorphism of the emodin receptor, which is located at the 65th position of the SEQ ID NO: 28 (esr_a65G); a second primer set comprising (a) a second PCR primer pair comprising two primers, each having a nucleotide sequence of SE NOS: 4 and 5, and (b) a second extension reaction primer having SEqIDn 〇: a nuclear sequence of 6; wherein, the second primer set A single nucleotide polymorphism for detecting retinol binding protein 4, which is located at the 29th position/position of SEQ ID NO: 29 (RBP4-G29C); ^ (3) The third primer set, which includes (a a second PCR primer pair comprising two primers, each having a sEq NOS: nucleotide sequence of 7 and 8, and eight (b) a second extension reaction primer having a nucleotide sequence of SEQ ID NO: Wherein, the third primer set is used to detect a single nucleotide polymorphism of the calcium ion release channel acceptor, which is located at the 33rd base position of SEQ ID NO: 30 201137355 (CRC-C33T); (4) A fourth primer set comprising (a) a fourth PCR primer pair, which contains two primers, each having a nucleotide sequence of NOS: 10 and 11, and a VUI (b) fourth extension reaction primer having SEQidn〇 : 12 nucleocrine acid sequence, wherein the fourth primer set is used to detect the mononuclear thief of the prolactin receptor (IV) 'is located at SEQ ID NO: 31, 77 (PRLR-A77G); £ (5 a fifth primer set comprising U) a fifth PCR primer pair comprising two primers, a nucleoside sequence of NOS: 13 and 14, and a π mountain (b) fifth An extension primer having a nucleotide sequence of SEQ1DN〇: 15, wherein the fifth primer set is for detecting a calcium-activated protease inhibitory polymorphism, which is located at SEQ ID NO: 32 ^ (CAST-G47A); 47 subunits (6) sixth primer set, which includes a pair of primers, which contain two primers, each having the nucleotide sequence of SEQ ID NOS. 16 and 17, and a 乂 (7) sixth extension reaction primer, a nucleotide sequence having SEQidn〇: 18, the sixth primer set is used to detect the catalyzed chymotrypsin, which is located at SEQ throwing: 33 ^ (CAST-C143A); Position (7) a seventh primer set comprising U) a seventh PCR primer pair comprising two NOS sequences: 19 and 20 (tetra) acid sequences, and a SEQ ID column (7) seventh extension reaction primer having SEQidn 〇: 2i's nuclear bitter acid sequence 201137355 wherein 'the seventh primer set is used to detect the mononucleic acid polymorphism of fucosyltransferase, which is located at the 156th base position of SEQ ID NO: 34 (FUT1) -G66A); (8) Eighth primer set, which includes (a) an eighth PCR primer pair containing two primers, Others have seq id NOS: nucleotide sequences of 22 and 23, and (b) an eighth extension reaction primer having the nucleotide sequence of SEQ ID NO: 24; X wherein the eighth primer set is for detecting melanocortin a single nucleotide polymorphism of the receptor 4, which is located at the 156th position of the SEQ ID NO: 35 (MC4R-G156A); and the soil (9) ninth primer set, which includes (a) the ninth PCR A primer pair comprising two primers, each having a seq id NOS: nucleotide sequence of 25 and 26, and (b) a ninth extension reaction primer having a SEqIDN〇:27 nuclear acid sequence; wherein, the ninth The primer set is used to detect a single nucleotide polymorphism of the acid gene, which is located at the 216th base position of SEQ ID NO: 36 (version _ (3216/^ and (B) analysis of the aforementioned reaction product to obtain A signal representing the genotype of the aforementioned single nucleotide polymorphism, wherein the signals can be distinguished from each other. The method of claim 1, wherein in the step (A), the primer extension reaction is performed using the first primer group to the ninth primer group to detect the genotype of the early nucleotide polymorphism. 3. According to the scope of the patent application! The method of claim, wherein in step (B), the genotype of the single nucleotide polymorphism is detected using capillary electrophoresis. 4. A kit of genotypes capable of simultaneously detecting a plurality of pig molecular markers, and = a primer set as described in the scope of the patent application, which is selected from the first ^, and to the ninth primer Any combination of four or more of the group consisting of groups. 5. The kit according to item 4 of the scope of application for patents, including the first to ninth introduction groups as described in item 1 of the application patent 201137355. 6. A method for simultaneously detecting a genotype of a plurality of molecular markers of a heart-type fatty acid-binding protein (5), (A) using a nucleic acid sample derived from a pig as a template, and using a plurality of primers in the same reaction The group performs a primer extension reaction to generate a reaction product, wherein the plurality of primer set systems comprises: (1) a tenth primer set comprising: (a) a tenth PCR primer pair comprising two primers each having SEq NOS: a nucleotide sequence of 37 and 38, and (b) a tenth extension reaction primer having the nucleotide sequence of SEQ ID NO: 39; wherein the 'tenth primer set is for detecting a single nucleotide of H-FABP An acid polymorphism, which is located at the 204th position of SEQ ID NO: 44 (h-FABP-T204C); (2) an eleventh introduction group comprising: U) an eleventh PCR primer pair, a primer comprising two primers, each having the nucleotide sequences of SEQ ID NOS: 40 and 41, and (b) an eleventh extension reaction primer having the nucleotide sequence of SEQ ID NO: 42; wherein, the eleventh primer The group is used to detect the single nucleotide polymorphism of H-FABP, which is located in SEQ ID NO: The 89th base position of 45 (H-FABP-T89C); (3) The twelfth primer set, which comprises: (a) a twelfth PCR primer pair containing two primers, respectively having SEQ ID NOS: a nucleotide sequence of 40 and 41, and (b) a twelfth extension reaction primer having the nucleotide sequence of SEQ ID NO: 43; wherein the twelfth primer set is for detecting a single core of H-FABP a polymorphism, located at the 411th base position of SEQ ID NO: 45 (H-FABP-G411C); and 201137355 (B) analyzing the aforementioned reaction product to obtain a gene representing the aforementioned single nucleotide poly bear Type of signal 'where the signals can be distinguished from one another. 7. According to the method of claim i, the multi-molecular standard cylinder of the genotype of the fatty acid-binding protein to the twelfth primer cylinder is as described in claim 5 of the patent scope. Ten bow 1