CN1333367A - Novel polypeptide--human beta-glucoronidase 26.29 and polynucleotide for encoding said polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide-human beta-glucoronidase 26.29, polynucleotide for coding said polypeptide and method for producing this polypeptide by DNA recombination technology. Said invention also discloses the method for curing several diseases, such as tumor of cerebral pia mater, tumor of lymph hematopoietic tissue, bacterial and fungal meningitis, HIV infection and fetus edema by said polypeptide. Said invention also discloses an antagonist for resisting said polypeptide and its therapeutic action, and also discloses the application of polynucleotide coding this novel human beta-glucoronidase 26.29.

Description

New polypeptide-human beta-glucuronidase 26.29 and polynucleotide for encoding such polypeptide

The present invention belongs to the field of biotechnology, and is especially one new kind of polypeptide, human beta-glucuronidase 26.29 and its encoding polynucleotide sequence. The present invention also relates to the preparation process and application of the polynucleotides and polypeptides.

Reaction of hydrolysis of glucoside to ethanol and glucuronic acid:

glucuronidase is a structural protein of the endoplasmic reticulum, and occurs in lysosomes when changes occur in the endoplasmic reticulum. [ Nature, 213, 457, 1967]

The enzyme is found in mammals and other vertebrates, mollusks such as snails, locusts, bacteria and plants, and is therefore a functionally well-conserved and important enzyme.

β -abnormal expression levels of glucuronidase lead to a number of diseases, for example, 75% of patients with leptomeningeal tumours (leptomeningeal adenocarinomas) show increased levels of this enzyme, and 25% of patients with myelogenous leukaemia (myelogenous leukamia) [ Mayo ClinProc 1985; 60: 293-8]also in acute and subacute bacteria, fungal meningitis and HIV-1 infections [ Lancet 1991; 337: 734-5]

On the other hand, the symptoms include mucopolysaccharidosis, hepatosplenomegaly and skeletal changes [ J.Pediat.82: 249-

Analysis of a gene chip shows that in bladder mucosa, an Ecv304 cell line of PMA +, a thymus of a Ecv cell line of LPS +, 1024NC and 1024NC normal fibroblasts, fibroplast, growth factor stimulation, 1024NT and scar formation fc growth factor stimulation, 1013HT and scar formation fc stimulation are not carried out by growth factors, 1013HC and the bladder cancer established cell EJ, parabladder cancer, bladder cancer, liver cancer cell lines, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma and cardia cancer, the expression spectrum of the polypeptide of the invention is very similar to that of human beta-glucuronidase, so that the functions of the two can be similar. The invention is named as human beta-glucuronidase 26.29.

Since the human beta-glucuronidase 26.29 protein plays an important role in regulating important functions of the body such as cell division and embryonic development as described above, and it is believed that a large number of proteins are involved in these regulation processes, there is a continuing need in the art to identify more of the human beta-glucuronidase 26.29 protein involved in these processes, and in particular, to identify the amino acid sequence of this protein. The isolation of a novel human beta-glucuronidase 26.29 protein encoding gene also provides a basis for research and determination of the function of the protein in health and disease states. This protein may form the basis for the development of a diagnostic and/or therapeutic agent for disease 1, and therefore, it is very important to isolate the DNA encoding it.

An object of the present invention is to provide an isolated novel polypeptide, human beta-glucuronidase 26.29, and fragments, analogs and derivatives thereof.

Another objective of the invention is to provide a polynucleotide encoding the polypeptide.

Another objective of the invention is to provide a recombinant vector containing a polynucleotide encoding human beta-glucuronidase 26.29.

It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human beta-glucuronidase 26.29.

Another objective of the invention is to provide a method for producing human beta-glucuronidase 26.29.

Another objective of the invention is to provide an antibody against the polypeptide of the invention, human beta-glucuronidase 26.29.

Another objective of the invention is to provide mimetics, antagonists, agonists, and inhibitors for the polypeptide of the human beta-glucuronidase 26.29.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with the abnormality of human beta-glucuronidase 26.29.

The present invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No.2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence.

The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) a polynucleotide sharing at least 70% identity with the polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) has the sequence shown in SEQ ID NO: 1 at position 1646-2365; and (b) has the sequence of SEQ ID NO: 1-2775 in 1.

The present invention furthermore relates to a vector, in particular an expression vector, comprising a polynucleotide according to the invention; a host cell genetically engineered with the vector, including transformed, transduced or transfected host cells; a method for producing the polypeptide of the present invention comprising culturing the host cell and recovering the expression product.

The invention also relates to an antibody capable of specifically binding to the polypeptide of the invention.

The invention also relates to a method for screening compounds which mimic, activate, antagonize, or inhibit the activity of human beta-glucuronidase 26.29 protein, comprising using the polypeptide of the invention. The invention also relates to the compounds obtained by this process.

The invention also relates to an in vitro method for detecting diseases or disease susceptibility related to abnormal expression of human beta-glucuronidase 26.29 protein, which comprises detecting mutation in the polypeptide or the polynucleotide sequence for encoding the polypeptide in a biological sample, or detecting the amount or biological activity of the polypeptide in the invention in the biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic, activator, antagonist or inhibitor thereof and a pharmaceutically acceptable carrier.

The invention also relates to the use of the polypeptide and/or polynucleotide of the invention in the preparation of medicaments for treating cancer, developmental diseases, immune diseases or other diseases caused by abnormal expression of human beta-glucuronidase 26.29.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure of the technology herein.

The following terms used in the specification and claims have the following meanings, unless otherwise specified:

"nucleic acid sequence" refers to an oligonucleotide, nucleotide or polynucleotide and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing either the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof. When "amino acid sequence" in the present invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The alteration may comprise a deletion, insertion or substitution of an amino acid or a nucleotide in the amino acid sequence or the nucleotide sequence. Variants may have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as the substitution of isoleucine with leucine. Variants may also have non-conservative changes, such as replacement of glycine with tryptophan.

"deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"insertion" or "addition" refers to a change in an amino acid sequence or nucleotide sequence resulting in an increase of one or more amino acids or nucleotides compared to the naturally occurring molecule. "substitution" refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides.

"biological activity" refers to a protein having the structural, regulatory, or biochemical functions of a native molecule. Similarly, the term "immunological activity" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

An "agonist" is a molecule that, when bound to human beta-glucuronidase 26.29, causes an alteration in the protein, thereby modulating the activity of the protein. Agonists may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human beta-glucuronidase 26.29.

An "antagonist" or "inhibitor" refers to a molecule that blocks or modulates the biological or immunological activity of human beta-glucuronidase 26.29 when bound to human beta-glucuronidase 26.29. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecules that bind to human beta-glucuronidase 26.29.

"modulation" refers to a change in the function of human beta-glucuronidase 26.29, including an increase or decrease in protein activity, a change in binding characteristics, and a change in any other biological, functional, or immunological property of human beta-glucuronidase 26.29.

"substantially pure" means substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify human beta-glucuronidase 26.29 using standard protein purification techniques. Substantially pure human beta-glucuronidase 26.29 produces a single major band on a non-reducing polyacrylamide gel. The purity of the human beta-glucuronidase 26.29 polypeptide can be analyzed by amino acid sequence analysis.

"complementary" or "complementation" refers to the natural binding of polynucleotides by base pairing under the conditions of salt concentration and temperature allowed. For example, the sequence "C-T-G-A" may bind to the complementary sequence "G-A-C-T". The complementarity between the two single stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"homology" refers to the degree of complementarity, which may be partial or complete. "partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by hybridization (Southern blot or Northern blot) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes compete for and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, as the conditions of reduced stringency require specific or selective interaction of the two sequences with each other.

"percent identity" refers to the percentage of sequence identity or similarity in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as by the MEGALIGN program (Lasergenistein paper, DNASTAR, Inc., Madison Wis.). MEGALIGN can compare two or more sequences according to different methods, such as the Cluster method (Higgins, D.G. and P.M.Sharp (1988) Gene 73: 237-. Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula:

number of residues matching between sequence A and sequence B

100

Number of residues in sequence A-number of spacer residues in sequence B

The percent identity between nucleic acid sequences can also be determined by Cluster method or by Methods well known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-.

"similarity" refers to the degree of identical or conservative substitution of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; amino acids with uncharged head groups having similar hydrophilicity can include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

"derivative" refers to HFP or a chemical modification of the nucleic acid encoding it. Such chemical modification may be replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. The nucleic acid derivative may encode a polypeptide that retains the main biological properties of the native molecule.

"antibody" refers to intact antibody molecules and fragments thereof, e.g., Fa, F (ab')₂And Fv, which specifically binds to an epitope of human beta-glucuronidase 26.29.

"humanized antibody" refers to an antibody in which the amino acid sequence of the non-antigen binding region has been replaced to more closely resemble that of a human antibody, but which retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated from some or all of the materials with which it coexists in its natural system. Such polynucleotides may be part of a vector, or such polynucleotides or polypeptides may be part of a composition. Since the carrier or composition is not a component of its natural environment, it remains isolated.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated human beta-glucuronidase 26.29" means that human beta-glucuronidase 26.29 is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify human beta-glucuronidase 26.29 using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of human beta-glucuronidase 26.29 polypeptide can be analyzed by amino acid sequence analysis.

The present invention provides a novel polypeptide, human beta-glucuronidase 26.29, consisting essentially of SEQ ID NO: 2, and 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogs of human beta-glucuronidase 26.29. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity of human beta-glucuronidase 26.29 of the invention. The fragment, derivative or analogue of the polypeptide of the invention may be: (I) such a form in which one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), and the substituted amino acid may or may not be encoded by the genetic code; or (II) one in which one or more of the amino acid residues are substituted with other groups, including substituents; or (III) one in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol; or (IV) a polypeptide sequence in which additional amino acid sequences are fused to the mature polypeptide (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence) by way of illustration herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence. The polynucleotide sequence of the invention comprises SEQ ID NO: 1. The polynucleotides of the invention are found in cDNA libraries of human fetal brain tissue. It comprises a polynucleotide sequence with 2775 bases in full length and an open reading frame of 1646-2365 encodes 239 amino acids. According to the comparison of gene chip expression profiles, the polypeptide has a similar expression profile with human beta-glucuronidase, and the human beta-glucuronidase 26.29 can be deduced to have a similar function with the human beta-glucuronidase.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes eDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to SEQ ID NO: 1, or a degenerate variant thereof. As used herein, "degenerate variant" means in the present invention a variant that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, but is identical to the protein or polypeptide of SEQ ID NO: 1, or a variant thereof.

Encoding the amino acid sequence of SEQ ID NO: 2 comprises: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides encoding the polypeptide and polynucleotides including additional coding and/or non-coding sequences.

The present invention also relates to variants of the above-described polynucleotides which encode a polypeptide having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The invention also relates to polynucleotides (having at least 50%, preferably 70% identity between two sequences) which hybridize to the sequences described above. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 95% or more, preferably 97% or more. And, the polypeptide encoded by the hybridizable polynucleotide is complementary to the polypeptide of SEQ ID NO: 2 have the same biological functions and activities.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides in length. The nucleic acid fragments may also be used in amplification techniques of nucleic acids, such as PCR, to determine and/or isolate a polynucleotide encoding human beta-glucuronidase 26.29.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The specific polynucleotide sequence of the present invention encoding human beta-glucuronidase 26.29 can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural features.

The DNA fragment sequences of the present invention canalso be obtained by the following methods: 1) isolating double-stranded DNA sequences from genomic DNA; 2) chemically synthesizing a DNA sequence to obtain a double-stranded DNA of the polypeptide.

Among the above-mentioned methods, isolation of genomic DNA is least frequently used. Direct chemical synthesis of DNA sequences is a frequently used method. A more frequently used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that highly express the gene and reverse transcribe the mRNA to form a plasmid or phage cDNA library. There are a number of well-established techniques for extracting mRNA and kits are commercially available (Qiagene). The construction of cDNA libraries is also a common procedure (Sambrook, et al, molecular cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction techniques are used in combination, even very few expression products can be cloned.

The gene of the present invention can be screened from these cDNA libraries by a conventional method. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of function of a marker gene; (3) determining the level of human beta-glucuronidase 26.29 transcript; (4) the protein product of gene expression is detected by immunological techniques or by assaying for biological activity. The above methods can be used singly or in combination of multiple methods.

In method (1), the probe used for hybridization is homologous to any portion of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized on the basis of the sequence information of the gene of the present invention. The gene of the present invention itself or a fragment thereof can of course be used as a probe. The DNA probe may be labeled with a radioisotope, fluorescein or an enzyme (e.g., alkaline phosphatase), etc.

In method (4), the detection of protein product expressed by human beta-glucuronidase 26.29 gene can be carried out by immunology methods such as Western blotting, radioimmunoassay, and enzyme-linked immunosorbent assay (ELISA).

A method of amplifying DNA/RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the polynucleotide of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments and the like can be determined by a conventional method such as the dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequencing may also be performed using commercial sequencing kits and the like. Sequencing was repeated to obtain a full-length cDNA sequence. Sometimes, it is necessary to sequence the cDNA of several clones to obtain the full-length cDNA sequence.

The present invention also relates to vectors comprising the polynucleotides of the present invention, as well as genetically engineered host cells engineered with the vectors of the present invention or directly with the human beta-glucuronidase 26.29 coding sequence, and methods for producing the polypeptides of the present invention by recombinant techniques.

In the present invention, a polynucleotide sequence encoding human beta-glucuronidase 26.29 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vector well known in the art. Vectors suitable for use in the present invention include, but are not limited to: expression vectors based on the T7 promoter for expression in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio chem.263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In general, any plasmid or vector can be used to construct a recombinant expression vector so long as it can replicate and is stable in the host. An important feature of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human beta-glucuronidase 26.29 and appropriate transcription/translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthetic technique, in vivo recombination technique, etc. (Sambrook, et al, molecular cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; p of lambda phage_LA promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling the expression of genes in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. The insertion of enhancer sequences into vectors will enhance transcription in higher eukaryotic cells. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli, and the like.

It will be clear to one of ordinary skill in the art how to select the appropriate vector/transcriptional regulatory element (e.g., promoter, enhancer, etc.) and selectable marker gene.

In the present invention, the polynucleotide encoding human beta-glucuronidase 26.29 or the recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterialcells such as salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells such as Drosophila S2 or Sf 9; animal cells such as CHO, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the invention or a recombinant vector containing said DNA sequence may be carried out by conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Alternatively, MgCl is used₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, or conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, and the like.

The recombinant human beta-glucuronidase 26.29 can be expressed or produced by conventional recombinant DNA techniques using the polynucleotide sequence of the present invention (Science, 1984; 224: 1431). Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding human beta-glucuronidase 26.29, or with a recombinant expression vector comprising the polynucleotide;

(2) culturing the host cell in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In step (2), the medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

In step (3), the recombinant polypeptide may be encapsulated in the cell, or expressed on the cell membrane, or secreted out of the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting-out method), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations thereof.

The polypeptide of the present invention and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating diseases, such as malignant tumors, adrenal gland deficiency, skin diseases, various inflammations, HIV infection, immunological diseases, etc.

A glucuronidase, a structural protein of the endoplasmic reticulum, catalyzes the hydrolysis of β -D-glucuronide to ethanol and glucuronic acid. β -glucuronidase expression level abnormalities can lead to a number of diseases.for example, 75% of patients with leptomeningeal tumors (leptomeningeal adnociceps) show increased levels of the enzyme, and 25% of patients with myelogenous leukemia (myelogenous leukemia) [ Mayo Clin Proc 1985; 60: 293-8]can also show increased levels of the enzyme in acute and subacute bacteria, fungal meningitis, and HIV-1 infections.on the other hand, a glucuronidase deficiency when it is absent can lead to a deficiency of the enzyme, symptoms of which include mucopolysaccharidosis,hepatosplenomegaly, and skeletal changes. β -glucuronidase deficiency can also cause edema.A spectrum of expression of a polypeptide of the present invention is consistent with that of a human β -glucuronidase, and similar functions of the expressed polypeptide of the present invention, including but not limited to the presence of abnormal activity of a polypeptide:

various leptomeningeal tumors, various lymphohematopoietic tumors (malignant lymphomas [ cervical, mediastinal, mesenteric and retroperitoneal lymph nodes], various leukemias [ lymphohematopoietic tissues], multiple myelomas [ vertebral/thoracic/costal/cranial and long bone], etc.), various bacterial, fungal meningitis (epidemic encephalitis, cryptococcal meningitis, etc.), HIV infection, fetal edema, etc.;

the polypeptide and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating various diseases, such as leptomeningeal membrane tumor, lymphohematopoietic tissue tumor, bacterial and fungal meningitis, HIV infection, fetal edema and the like.

The invention also provides methods of screening compounds to identify agents that increase (agonists) or suppress (antagonists) human beta-glucuronidase 26.29. Agonists enhance biological functions such as the stimulation of cell proliferation by human beta-glucuronidase 26.29, while antagonists prevent and treat disorders associated with excessive cell proliferation such as various cancers. For example, mammalian cells or membrane preparations expressing human beta-glucuronidase 26.29 can be cultured with labeled human beta-glucuronidase 26.29 in the presence of a drug. The ability of the agent to enhance or repress this interaction is then determined.

The antagonists of human beta-glucuronidase 26.29 comprise screened antibodies, compounds, receptor deletants and analogs. An antagonist of human beta-glucuronidase 26.29 can bind to human beta-glucuronidase 26.29 and abrogate its function, or inhibit production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide is rendered biologically nonfunctional.

In screening for compounds that act as antagonists, human beta-glucuronidase 26.29 can be added to a bioassay to determine whether a compound is an antagonist by determining the effect of the compound on the interaction between human beta-glucuronidase 26.29 and its receptor. Receptor deletants and analogs that act as antagonists can be screened using the same methods described above for compounds. Polypeptide molecules capable of binding to human beta-glucuronidase 26.29 can be obtained by screening a random polypeptide library consisting of various possible combinations of amino acids bound to a solid phase. In screening, human beta-glucuronidase 26.29 molecule is generally marked.

The present invention provides methods for producing antibodies using polypeptides, and fragments, derivatives, analogs, or cells thereof, as antigens. These antibodies may be polyclonal or monoclonal. The invention also provides antibodies directed against the human beta-glucuronidase 26.29 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by a Fab expression library.

Polyclonal antibody production can be achieved by directly injecting human beta-glucuronidase 26.29 into immunized animals (such as rabbit, mouse, rat, etc.), and various adjuvants can be used to enhance immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to human beta-glucuronidase 26.29 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), trioma technology, human B-cell hybridoma technology, EBV-hybridoma technology, and the like. Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using established techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single-chain antibody (U.S. Pat. No.4946778) can also be used for producing single-chain antibody against human beta-glucuronidase 26.29.

The antibody against human beta-glucuronidase 26.29 can be used in immunohistochemical technique to detect human beta-glucuronidase 26.29 in biopsy specimens.

Monoclonal antibodies that bind to human beta-glucuronidase 26.29 can also be labeled with a radioisotope, and injected into the body to track their location and distribution. The radiolabeled antibody can be used as a non-invasive diagnostic method for locating tumor cells and judging whether metastasis exists.

Antibodies can also be used to design immunotoxins directed to a particular site in the body. For example, a monoclonal antibody with high affinity to human beta-glucuronidase 26.29 can be covalently bound to a bacterial or plant toxin (e.g., diphtheria toxin, ricin, ormosine, etc.). One common approach is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody by exchange of disulfide bonds, and this hybrid antibody can be used to kill human beta-glucuronidase 26.29 positive cells.

The antibody of the invention can be used for treating or preventing diseases related to human beta-glucuronidase 26.29. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human beta-glucuronidase 26.29.

The invention also relates to diagnostic assays for quantitative and positional detection of human beta-glucuronidase 26.29 levels. These assays are well known in the art and include FISH assays and radioimmunoassays. The level of human beta-glucuronidase 26.29 detected in the assay can be used to explain the importance of human beta-glucuronidase 26.29 in various diseases and to diagnose diseases in which human beta-glucuronidase 26.29 plays a role.

The polypeptides of the invention may also be used for peptide profiling, for example, where the polypeptides may be specifically cleaved by physical, chemical or enzymatic means and subjected to one or two or three dimensional gel electrophoresis analysis, preferably mass spectrometry.

Polynucleotides encoding human beta-glucuronidase 26.29 may also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat cell proliferation, development or metabolic abnormalities due to the non-expression or abnormal/inactive expression of human beta-glucuronidase 26.29. Recombinant gene therapy vectors (e.g., viral vectors) can be designed to express variant human beta-glucuronidase 26.29, to inhibit endogenous human beta-glucuronidase 26.29 activity. For example, a variant human beta-glucuronidase 26.29 can be a shortened human beta-glucuronidase 26.29 lacking a signaling domain, which binds to a downstream substrate, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of the human beta-glucuronidase 26.29. Expression vectors derived from viruses such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human beta-glucuronidase 26.29 into a cell. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human beta-glucuronidase 26.29 can be found in the literature (Sambrook, et al.). In addition, the recombinant polynucleotide for encoding the human beta-glucuronidase 26.29 can be packaged into a liposome and transferred into cells.

The method for introducing the polynucleotide into the tissue or the cell comprises: injecting the polynucleotide directly into the in vivo tissue; or introducing the polynucleotide into cells in vitro via a vector (e.g., a virus, phage, or plasmid), and then transplanting the cells into the body.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human beta-glucuronidase 26.29 mRNA are also within the scope of the invention. Ribozymes are enzyme-like RNA molecules that specifically cleave specific RNAs and act by specifically hybridizing the ribozyme molecules with complementary target RNAs followed by endonucleolytic action. Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DNA synthesis techniques, such as solid phase phosphoramidite chemical synthesis method for oligonucleotide synthesis. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the DNA sequence encoding the RNA. This DNA sequence has been integrated into the vector downstream of the RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in various ways, such as increasing the length of the flanking sequences, using phosphothioester or peptide bonds instead of phosphodiester linkages for the linkages between ribonucleosides.

The polynucleotide for encoding human beta-glucuronidase 26.29 can be used for diagnosing diseases related to human beta-glucuronidase 26.29. The polynucleotide encoding human beta-glucuronidase 26.29 can be used for detecting whether the human beta-glucuronidase 26.29 is expressed or not or abnormal expression of the human beta-glucuronidase 26.29 under a disease state. For example, a DNA sequence encoding human beta-glucuronidase 26.29 can be used for hybridization of biopsy specimens to determine the expression status of human beta-glucuronidase 26.29. The hybridization techniques include Southern blotting, Northern blotting, in situ blotting, etc. The technical methods are all published mature technologies, and related kits are all available from commercial sources. A part or all of the polynucleotide of the present invention can be immobilized as a probe on a Microarray (Microarray) or a DNA chip (also referred to as "gene chip") for analysis of differential expression of genes in tissues and gene diagnosis. The transcription product of human beta-glucuronidase 26.29 can also be detected by RNA-polymerase chain reaction (RT-PCR) in vitro amplification with primers specific to human beta-glucuronidase 26.29.

The detection of the mutation of the human beta-glucuronidase 26.29 gene can also be used for diagnosing diseases related to the human beta-glucuronidase 26.29. Forms of human beta-glucuronidase 26.29 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities, among others, as compared to the normal wild-type human beta-glucuronidase 26.29 DNA sequence. The mutation can be detected by known techniques such as Southern blotting, DNA sequencing, PCR and in situ hybridization. In addition, since mutation may affect the expression of protein, the presence or absence of mutation in a gene can be indirectly determined by Northern blotting or Western blotting.

The sequences of the invention are also valuable for chromosome identification. The sequence will be specific for a particular location on a human chromosome and will hybridize to it. Currently, there is a need to identify specific sites on each gene on the chromosome. Currently, only few chromosomal markers based on actual sequence data (repeat polymorphisms) are available for marking chromosomal locations. According to the present invention, the first step important in correlating these sequences with disease-associated genes is the mapping of these DNA sequences to chromosomes.

Briefly, PCR primers (preferably 15-35bp) are prepared from the cDNA and the sequence can be mapped to the chromosome. These primers were then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

The PCR mapping method of somatic cell heterozygous cell is a rapid method for mapping DNA to specific chromosome. Using the oligonucleotide primers of the present invention, sublocalization can be achieved using a panel of fragments from a particular chromosome or a large number of genomic clones by similar methods. Other similar strategies that can be used for chromosome mapping include in situ hybridization, prescreening with labeled flow sorted chromosomes, and preselection by hybridization to construct chromosome-specific cDNA libraries.

Fluorescence In Situ Hybridization (FISH) of cDNA clones to metaphase chromosomes allows accurate chromosomal location in one step. For a review of this technology, see Verma et al, Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence is located at an exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. These data can be found, for example, in V.Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). The relationship between the gene and the disease that has been mapped to the chromosomal region can then be determined by linkage analysis.

Next, it is necessary to determine the differences in cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals, but not in any normal individuals, then the mutation maybe the cause of the disease. Comparing diseased and non-diseased individuals generally involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible from the chromosomal level or detectable using PCR based cDNA sequences. Based on the resolution of current physical mapping and gene mapping techniques, cDNAs that are precisely mapped to chromosomal regions associated with disease can be one of 50 to 500 potential disease-causing genes (assuming 1 megabase mapping resolution and one gene per 20 kb).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the invention may be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and a carrier and an excipient which do not affect the effect of the medicine. These compositions can be used as medicaments for the treatment of diseases.

The invention also provides a kit or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Along with these containers, there may be an instructional cue given by a governmental regulatory agency that regulates the manufacture, use or sale of pharmaceuticals or biological products, which cue reflects approval by the governmental agency of manufacture, use or sale for human administration. In addition, the polypeptides of the invention may be used in combination with other therapeutic compounds.

The pharmaceutical compositions may be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes of administration. Human beta-glucuronidase 26.29 is administered in an amount effective to treat and/or prevent a particular indication. The amount of human beta-glucuronidase 26.29 administered to a patient and the dosage range will depend on a number of factors, such as the mode of administration, the health condition of the subject to be treated, and the judgment of the diagnostician.

The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison of the gene chip expression profiles of the present inventors beta-glucuronidase 26.29 and human beta-glucuronidase. The upper graph is the expression profile folding chart of the human beta-glucuronidase 26.29, and the lower sequence is the expression profile folding chart of the human beta-glucuronidase. Wherein 1-bladder mucosa, 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal Fibroblast 1024NC, 5-fibroplast, growth factor stimulation, 1024NT, 6-scar formation fc growth factor stimulation, 1013HT, 7-scar formation fc without growth factor stimulation, 1013HC, 8-bladder cancer establishment cell EJ, 9-bladder cancer paradox, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.

FIG. 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human beta-glucuronidase 26.29. 26.29kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Example 1: cloning of human beta-glucuronidase 26.29

Extraction of human fetal brain Total RNA by the one-step method of guanidinium isothiocyanate/phenol/chloroform extraction of human fetal brain Total RNA, reverse transcription of poly (A) mRNA to form cDNA using the Quik mRNA Isolation Kit (Qiagene, Inc.;) the cDNA fragments were directionally inserted into the multiple cloning site of pBSK (+) vector (Clontech) using Smart cDNA cloning Kit (Clontech), transformation of DH5 α, formation of cDNA library by bacteria comparison of the 5 'and 3' end sequences of all clones using the Dyetermate cycle sequencing Kit (Perkin-Elmer Corp.) and ABI 377 automatic sequencer (Perkin-Elmer Corp.), comparison of the determined cDNA sequence with the existing public DNA sequence database (Genebank) revealed that the cDNA sequence of one of clones designated as 0661a05 was the novel DNA, the inserted cDNA fragment of this clone was synthesized by a series of primers, the determination of the full-length cDNA fragment of this clone 0661a05 was found to be the full length protein of the human glucoside-encoding the protein found by the method of the open reading of the cDNA encoding the cDNA of this clone No. 0661 a-WO 26, the full length protein found by the method of the open reading of the cDNA encoding the cDNA of this clone designated pBSK 19-cDNA 26, the cDNA sequence of this clone designated No. 7-DNA found by PCR, the method of the invention was found that the cDNA sequence of the clone designated pBSK encoding the cDNA sequence of the cDNA is found that the full length of the clone designated No. 26, the cDNA is found that the clone designated No. 0661-DNA

cDNA was synthesized by reverse transcription using total fetal brain cell RNA as a template and oligo-dT as a primer, purified using Qiagene's kit, and then amplified by PCR using the following primers:

Primer1：5’-TGTTTGGCAGAGGTAAGTGACTGA-3’(SEQ ID NO：3)

Primer2：5’-TTTGGTGGTGATTTTATAATCAAT-3’(SEQ ID NO：4)

primer1 is a Primer located in SEQ ID NO: 1, the forward sequence starting at lbp 5' of the sequence;

primer2 is SEQ ID NO: 1, and a 3' terminal reverse sequence.

Conditions of the amplification reaction: containing 50mmol/L in a reaction volume of 50. mu.l KCl，10mmol/L Tris-Cl，(pH8.5)，1.5mmol/L MgCl₂200. mu. mol/L dNTP, 10pmol primer, 1U of Taq DNA polymerase (product of Clontech corporation) was reacted on a DNA thermal cycler model PE9600 (Perkin-Elmer corporation) for 25 cycles under the conditions of 94 ℃ for 30sec, 55 ℃ for 30sec, 72 ℃ for 2min, β -action was set as a positive control and a template blank as a negative control at the time of RT-PCR the amplified product was purified with a QIAGEN kit, ligated to a pCR vector (product of Invitrogen) with a TA cloning kit, DNA sequence analysis showed that the DNA sequence of the PCR product was completely identical to 1-2775bp shown in SEQ ID NO: 1. example 3. Northern blotting analysis of expression of human beta-glucuronidase 26.29 gene:

total RNA was extracted by one-step method [ anal. biochem 1987, 162, 156-]The method comprises acidic guanidinium thiocyanate phenol-chloroform extraction of tissue homogenized with 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2M sodium acetate (pH4.0), addition of 1 volume phenol and 1/5 volumes chloroform-isoamyl alcohol (49: 1), mixing, centrifugation, aspiration of the aqueous layer, addition of isopropanol (0.8 volume) and centrifugation of the mixture to obtain an RNA precipitate, washing of the RNA precipitate with 70% ethanol, drying and dissolving in water, electrophoresis with 20. mu.g of RNA on a 1.2% agarose gel containing 20mM 3- (N-morpholino) propanesulfonic acid (pH7.0) -5mM sodium acetate-1 mM EDTA-2.2M formaldehyde, transfer to nitrocellulose membrane α -³²P dATP prepared by random primer method³²P-labeled DNA probes. The DNA probe is the coding region sequence (1646bp to 2365bp) of human beta-glucuronidase 26.29 amplified by PCR shown in figure 1. 32P-labeled Probe (about 2X 10)⁶cpm/ml) was hybridized with RNA-transferred nitrocellulose membrane overnight at 42 ℃ in a solution containing 50% formamide-25 mM KH₂PO₄(pH7.4) -5 XSSC-5 XDenhardt's solution and 200. mu.g/ml salmon sperm DNA. After hybridization, the filters were washed in 1 XSSC-0.1% SDS at 55 ℃ for 30 min. Then, analysis and quantification were performed using a Phosphor Imager. Example 4: in vitro expression, separation and purification of recombinant human beta-glucuronidase 26.29

According to SEQ ID NO: 1 and the sequence of a coding region shown in figure 1, a pair of specific amplification primers is designed, and the sequence is as follows:

Primer3：5’-CATCCATGGATGTATGCGCTGACCAGCCTGGAC-3’(Seq ID No：5)

Primer4：5’-CATGGATCCCCGGAAGAAGCTGTCCCCACTCG-3’(Seq ID No：6)

the 5 ' ends of these two primers contain NcoI and BamHI cleavage sites, respectively, followed by coding sequences at the 5 ' end and 3 ' end of the gene of interest, respectively, and the NcoI and BamHI cleavage sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3.) PCR reactions were carried out using pBS-0661a05 plasmid containing the full-length gene of interest as a template under conditions including pBS-0661a05 plasmid 10, Primer-3 and Primer-4 of 10pmol, Advantage polymerase Mix (Clontech) 1. mu.l of cycle parameters: 94. C20 s, 60C 30s, 68 ℃ 2min in a total of 25 cycles in a total volume of 50. mu.l, the amplified products and plasmid pET-28(+) were double cleaved with NcoI and BamHI, respectively, and the amplified products and the plasmid pET-28(+) were transferred to a colony-10 pmol by sequencing T2 ligase (Clontage polymerase Mix) to a column (Clontech). The. mu.26. C20 s, 60 C.68. C.2 min, 25 cycles, the final concentration of DNA sequence was analyzed by the DNA sequencing method, the DNA sequence of DNA fragment of DNA sequence obtained after the DNA sequence was transferred to a DNA sequence obtained by the DNA sequencing method of DNA sequencing, the DNA sequence obtained by the DNA sequencing method, the DNA sequence obtained by the DNA sequencing method of DNA sequencing method, the DNA sequence obtained by the DNA sequencing method, the DNA sequence obtained by the DNA sequencing method, the method of DNA sequence obtained by the method of DNA sequencing method, the method of DNA sequence obtained by the method of DNA sequencing method, the method of DNA method, the method of DNA method, the method of DNA method, the method

The following human beta-glucuronidase 26.29-specific polypeptides were synthesized using a polypeptide synthesizer (product of PE Co.):

NH2-Met-Tyr-Ala-Leu-Thr-Ser-Leu-Asp-Pro-Ala-Ser-Glu-Pro-Ile-Ser-COOH (SEQ ID NO: 7). The polypeptide is respectively coupled with hemocyanin and bovine serum albumin to form a complex, and the method is as follows: avarameas, et al, immunochemistry, 1969; 6: 43. 4mg of the hemocyanin polypeptide compound and complete Freund's adjuvant are used for immunizing rabbits, and the hemocyanin polypeptide compound and the complete Freund's adjuvant are used for boosting immunization once after 15 days. The titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15. mu.g/ml bovine serum albumin polypeptide complex. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The polypeptides were bound to a cyanogen bromide activated Sepharose4B column and anti-polypeptide antibodies were separated from total IgG by affinity chromatography. Immunoprecipitation demonstrated that purified antibody specifically binds to human beta-glucuronidase 26.29. Example 6: use of the Polynucleotide fragments of the invention as hybridization probes

The selection of suitable oligonucleotide fragments from the polynucleotide of the present invention can be used as hybridization probes for identifying whether they contain the polynucleotide sequence of the present invention and detecting homologous polynucleotide sequences, and for detecting whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathological tissue cells is abnormal.

The purpose of this example is to determine the expression of the polynucleotide of the invention, SEQ ID NO: 1 as a hybridization probe, and identifying whether some tissues contain the polynucleotide sequence of the present invention or its homologous polynucleotide sequence by filter hybridization. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and replica methods, all of which are methods in which a polynucleotide sample to be tested is immobilized on a filter and then hybridized by substantially the same procedure. These same steps are: the filter on which the sample is immobilized is first prehybridized with a hybridization buffer that does not contain a probe so that the nonspecific binding sites of the sample on the filter are saturated with the support and synthetic polymer. The prehybridization buffer is then replaced with a hybridization buffer containing labeled probes and incubated to allow hybridization of the probes to the target nucleic acids. Following the hybridization step, unhybridized probes are removed by a series of membrane washing steps. This example utilizes higher intensity membrane wash conditions (e.g., lower salt concentration and higher temperature) to reduce hybridization background and retain only a highly specific signal. The probes selected for this embodiment include two types: the first type of probe is a probe that is fully homologous to the polynucleotide of the invention, SEQ ID NO: 1 identical or complementary oligonucleotide fragments; the second type of probe is a probe that partially hybridizes to the polynucleotide of the invention of SEQ ID NO: 1 identical or complementary oligonucleotide fragments. In this embodiment, the dot blot method is used to fix the sample on the filter membrane, and the hybridization specificity of the first type probe and the sample is the strongest and is retained under the condition of higher-strength membrane washing. First, selection of probe

The polynucleotide of the invention is selected from the polynucleotides SEQ ID NO: 1, the following principles and several aspects to be considered should be followed:

1, the size of the probe is preferably 18-50 nucleotides;

2, the GC content is 30-70%, and when the GC content exceeds the GC content, non-specific hybridization is increased;

3, no complementary region should be arranged in the probe;

4, the probe meeting the above conditions can be used as a primary selection probe, and then further computer sequence analysis is carried out, wherein the primary selection probe is respectively compared with the sequence region (namely SEQ ID NO: 1) of the primary selection probe and other known genome sequences and complementary regions thereof for homology, and if the homology of the primary selection probe with the non-target molecule region is more than 85 percent or more than 15 continuous bases are completely identical, the primary selection probe is not generally used;

whether the initially selected probe is finally selected as a probe having practical application value should be further determined by experiments.

After the above analysis, the following two probes were selected and synthesized:

probe 1(probe1), belonging to the first class of probes, hybridizes to SEQ ID NO: 1 (41 Nt):

5’-TGTATGCGCTGACCAGCCTGGACCCTGCCAGTGAGCCAATC-3’(SEQ ID NO：8)

probe 2(probe2), belonging to the second class of probes, corresponds to SEQ ID NO: 1 or a complementary fragment thereof (41 Nt):

5’-TGTATGCGCTGACCAGCCTGCACCCTGCCAGTGAGCCAATC-3’(SEQ ID NO：9)

for other common reagents and their formulation methods not listed in connection with the following specific experimental procedures, reference is made to the literature: DNA PROBES g.h.keller; man ak, m.m.manak; stockton Press, 1989(USA) and more generally books of molecular cloning, A laboratory Manual, scientific Press, molecular cloning, A guide to molecular cloning (second edition 1998) [ U.S.]SammBruk et al.

Sample preparation: 1, extraction of DNA from fresh or frozen tissue

The method comprises the following steps: 1) fresh or freshly thawed normal liver tissue is placed in a dish soaked on ice and containing Phosphate Buffered Saline (PBS). The tissue is cut into small pieces with scissors or a scalpel. Tissue should be kept moist during the procedure. 2) The minced tissue was centrifuged at 1000g for 10 minutes. 3) The slurry was homogenized with cold homogenization buffer (0.25mol/L sucrose; 25mmol/LTris-HCl, pH 7.5; 25 mmol/LnaCl; 25mmol/L MgCl₂) The pellet was suspended (approximately 10 ml/g). 4) The tissue suspension was homogenized at full speed with an electric homogenizer at 4 ℃ until the tissue was completely disrupted. 5) Centrifuge at 1000g for 10 min. 6) Resuspend the cell pellet (1-5 ml per 0.1g of initial tissue sample) and centrifuge at 1000g for 10 min. 7) The pellet was resuspended in lysis buffer (1 ml per 0.1g of initial tissue sample) and then subjected to the following phenol extraction procedure. 2, phenol extraction of DNA

The method comprises the following steps: 1) cells were washed with 1-10ml cold PBS and centrifuged at 1000g for 10 min. 2) Resuspending the pelleted cells with Cold cell lysate (1X 10)⁸Cells/ml) a minimum of 100ul lysis buffer was used. 3) SDS was added to a final concentration of 1%, and if SDS was added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to breakAnd reduced overall yield. This is at extraction>10⁷Cells are particularly severe. 4) Proteinase K was added to a final concentration of 200 ug/ml. 5) The reaction was incubated at 50 ℃ for 1 hour or shaken gently overnight at 37 ℃. 6) Extracted with equal volumes of phenol, chloroform, isoamyl alcohol (25: 24: 1) and centrifuged in a small centrifuge tube for 10 minutes. The two phases are clearly separated, otherwise centrifugation is carried out again. 7) The aqueous phase was transferred to a new tube. 8) Extracted with chloroform isoamyl alcohol (24: 1) of equal volume and centrifuged for 10 minutes. 9) The aqueous phase containing the DNA was transferred to a new tube. Then, DNA purification and ethanol precipitation were performed. 3, DNA purification and ethanol precipitation

The method comprises the following steps: 1) 1/10 volumes of 2mol/L sodium acetate and 2 volumes of cold 100% ethanol were added to the DNA solution and mixed well. Left at-20 ℃ for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) The pellet was washed with 500ul of 70% cold ethanol and centrifuged for 5 minutes. 5) Carefully aspirate or pour out the ethanol. The pellet was washed with 500ul cold ethanol and centrifuged for 5 minutes. 6) Carefully suck out or pour out the ethanol and invert it on absorbent paper to drain off the residual ethanol. Air-drying for 10-15 minutes to evaporate the surface ethanol. Care was taken not to completely dry the pelletIt is difficult to re-dissolve after drying. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or blow with dropper while gradually increasing TE, mixing until DNA is fully dissolved, each 1-5 × 10⁶Approximately 1ul of cell extract was added.

The following steps 8-13 are only used when the contamination has to be removed, otherwise step 14 can be performed directly. 8) RNase A was added to the DNA solution at a final concentration of 100ug/ml and incubated at 37 ℃ for 30 minutes. 9) SDS and proteinase K were added to final concentrations of 0.5% and 100ug/ml, respectively. Incubate at 37 ℃ for 30 minutes. 10) The reaction mixture was extracted with phenol, chloroform and isoamyl alcohol (25: 24: 1) at equal volumes and centrifuged for 10 minutes. 11) The aqueous phase was carefully removed, re-extracted with an equal volume of chloroform to isoamyl alcohol (24: 1), and centrifuged for 10 minutes. 12) The aqueous phase was carefully removed, 1/10 volumes of 2mol/L sodium acetate and 2.5 volumes of cold ethanol were added, mixed well and placed at-20 ℃ for 1 hour. 13) Washing the pellet with 70% ethanol and 100% ethanol, air drying, and resuspending the nucleic acids in the same manner as in steps 3-6. 14) Measurement A₂₆₀And A₂₈₀To check the purity of DNAAnd yield. 15) Subpackaging and storing at-20 ℃. Preparation of sample films:

1) 4X 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size were taken, and the spotting position and the number were lightly marked with a pencil, two pieces of NC membrane were required for each probe, so that the membranes were washed with high-intensity conditions and intensity conditions, respectively, in the following experimental steps.

2) Pipette 15. mu.l of each sample and control, spot onto the membrane, and dry at room temperature.

3) The resulting mixture was placed on a filter paper impregnated with 0.1mol/L NaOH and 1.5mol/L NaCl for 5 minutes (twice), air-dried, placed on a filter paper impregnated with 0.5mol/L Tris-HCl (pH7.0) and 3mol/L NaCl for 5 minutes (twice), and air-dried.

4) Clamping in clean filter paper, wrapping with aluminum foil, and vacuum drying at 60-80 deg.C for 2 hr.

Labeling of probes

1) Mu.l Probe (0.1 OD/10. mu.l), 2. mu.l Kinase buffer, 8-10 uCi. gamma. -³²P-dATP +2UKinase, to a final volume of 20. mu.l.

2) Incubate at 37 ℃ for 2 hours.

3) Add 1/5 volumes of bromophenol blue indicator (BPB).

4) Passing through Sephadex G-50 column.

5) To have³²The first peak (which can be monitored by Monitor) begins to collect before the P-Probe is washed out.

6)5 drops/tube, collect 10-15 tubes.

7) Monitoring isotope content with liquid scintillation meter

8) The collected liquid of the first peak is combined to obtain the product³²P-Probe (second peak is free gamma-³²P-dATP)。

Prehybridization

The membrane was placed in a plastic bag, 3-10mg of prehybridization solution (10 XDenhardt's; 6 XSSC, 0.1mg/ml CT DNA (calf thymus DNA)) was added, the bag was sealed, and shaken in a water bath at 68 ℃ for 2 hours.

Hybridization of

Cutting off a corner of the plastic bag, adding the prepared probe, sealing the bag opening, and then shaking overnight in a water bath at 42 ℃.

Washing the membrane: high-strength membrane washing:

1) and taking out the hybridized sample membrane.

2) Wash in 2 XSSC, 0.1% SDS at 40 ℃ for 15 min (2 times).

3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃.

4)0.1 XSSC, 0.1% SDS, washed at 55 ℃ for 30 minutes (2 times), and air-dried at room temperature. And (3) low-strength membrane washing:

1) and taking out the hybridized sample membrane.

2) Wash in 2 XSSC, 0.1% SDS at 37 ℃ for 15 min (2 times).

3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 37 ℃.

4)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃ and air-dried at room temperature.

X-ray self-development:

x-ray autoradiography (the tabletting time depends on the radioactivity of the hybridization spots) at-70 ℃.

The experimental results are as follows:

the hybridization experiment is carried out under the condition of low-strength membrane washing, and the radioactivity of the hybridization spots of the two probes is not obviously different; in the hybridization experiment performed under the high-intensity membrane washing condition, the radioactive intensity of the hybridizationspot of the probe1 is obviously stronger than that of the other probe. Thus, probe1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of the present invention in different tissues. Example 7 DNA Microarray

The gene chip or gene Microarray is a new technology developed and developed by many national laboratories and major pharmaceutical companies, and it means that a large number of target gene fragments are orderly arranged on carriers such as glass, silicon and the like in high density, and then data comparison and analysis are performed by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information rapidly, efficiently and in high flux. The polynucleotide of the present invention can be used as a target DNA for gene chip technology for high-throughput research of new gene functions; searching and screening new tissue-specific genes, particularly new genes related to diseases such as tumor and the like; diagnosis of a disease, such as a genetic disease. The specific process steps have been reported in the literature, for example, in the literature de ris, j.l., Lyer, V.&Brown, P.O. (1997) Science278, 680-: 2150&2155

The total of 4000 different full-length cDNAs were used as target DNAs, including the polynucleotide of the present invention. They were amplified by PCR, the resulting amplification products were purified and then the concentration thereof was adjusted to about 500ng/ul, and spotted on a glass medium with a spotting instrument of Cartesian 7500 (from Cartesian, USA) at a distance of 280 μm from the spot. Hydrating and drying the spotted glass slide, placing the glass slide in an ultraviolet crosslinking instrument for crosslinking, eluting and drying the glass slide to fix the DNA on the glass slide to prepare the chip. The concrete steps of the method are reported in the literature, and the sample application post-treatment step of the embodiment is as follows:

1. hydrating in a humid environment for 4 hours;

2.0.2% SDS for 1 minute;

3. ddH₂o washes twice, each for 1 minute;

4. NaBH₄sealing for 5 minutes;

water at 5.95 ℃ for 2 minutes;

6.0.2% SDS for 1 minute;

7. ddH₂flushing twice;

8. air-dried and stored in the dark at 25 ℃ for later use. (II) Probe labeling

Total mRNA was extracted from a human mixed tissue and a specific tissue (or a stimulated cell line) respectively by a one-step method, and mRNA was purified using Oligotex mRNA Midi Kit (available from QiaGen), mRNA of the human mixed tissue was labeled with a fluorescent reagent Cy3dUTP (5-Amino-pro-phenyl-2 '-deoxyuridine 5' -triprotected to Cy3 fluorescent dye, available from Amersham pharmacia Biotech) respectively by reverse transcription, mRNA of the specific tissue (or the stimulated cell line) was labeled with a fluorescent reagent Cy5dUTP (5-Amino-pro-phenyl-2 '-deoxyuridine 5' -triphate coupled Cy5 fluorescent dye, available from Amersham pharmacia Biotech) and the probe was prepared after purification. The specific steps refer to and the method is as follows: schena, m., Shalon, d., Heller, R. (1996) proc.natl.acad.sci.usa.vol.93: 10614-10619 Schena, m., Shalon, dari, Davis, R.W (1995) science.270 (20): 467-480. III. hybridization

Separately putting probes from the above two tissues together with the chip in UniHyb^TMHybridization was carried out in hybridization solution (available from TeleChem) for 16 hours at room temperature using washing solution (1)SSC, 0.2% SDS) was washed, scanned using a ScanArray 3000 scanner (available from General Scanning, usa), and the scanned images were subjected to data analysis using Imagene software (Biodiscovery, usa) to calculate the ratio of Cy3/Cy5 for each spot.

The specific tissues of the organism (or stimulated cell lines) are bladder mucosa, Ecv304 cell line of PMA +, thymus of Ecv304 cell line of LPS +, 1024NC and fibroplast of normal Fibroblast, growth factor stimulation, 1024NT and scar formation fc growth factor stimulation, 1013HT and scar formation fc are not stimulated by growth factors, 1013HC, bladder cancer establishing cell EJ, beside bladder cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma and cardia cancer. A broken chart is drawn according to the 17 Cy3/Cy5 ratios. (FIG. 1). It can be seen that the expression profiles of the human beta-glucuronidase 26.29 and the human beta-glucuronidase are very similar.

Sequence listing (1) general information: (ii) name of the invention: number of human beta-glucuronidase 26.29 and its coding sequence (iii): 9

(2) SEQ ID NO: 1, information: (i) sequence characteristics:

(A) length: 2775bp

(B) Type (2): nucleic acids

(C) Chain property: double chain

(D) Topological structure: linear (ii) molecular type: cdna (xi) sequence description: SEQ ID NO: 1: 1 TGTTTGGCAGAGGTAAGTGACTGAGAGGGATCTGAGAGGGCAAGCAAGAACCCTGGGCAC 61 AGAGCTATGTAACCTGGATGTTTCATCCATTGTCCTTTCAGTAAACAACCCATGAAAGCT121 TGCTGTGGGTTGCATGCCAGAAAGGCTCAGGGCATAGAAAACACATGTGACCAGTAGCAG181 TCCCTACCCTCCAGAGACACACGACCTGCAGGAGACAGCCAGGTGCATGGGCAACTGTAA241 TAGGGCATGGCAAGTTCTCAGAGAGATGGAGATGCAGAGCCTGGGCTGGGGGATCACGTA301 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT361 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 421 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 481 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 541 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 601 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 661 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 721 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 781 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 841 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 901 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 961 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1021 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1081 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1141 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1261 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 13213272 1321 13272 1381 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 14472 1441 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1501 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1561 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1621 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1681 1741 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1801 18672 1861 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 1921 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 19872 1981 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2101 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2161 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2221 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2272 2281 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2341 2402472 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2521 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT 2572 ATCAGGGCAAGTTAGCCTCACTGGGGCAGGATGCCGGGAGGAGAAAACGTTCGGGCTAAT (3) ID NO: 2, information: (i) sequence characteristics:

(A) length: 239 amino acids

(B) Type (2): amino acids

(D) Topological structure: linear (ii) molecular type: polypeptide (xi) sequence description: SEQ ID NO: 2: 1 Met Tyr Ala Leu Thr Ser Leu Asp Pro Ala Ser Glu Pro Ile Ser 16 Tyr Val Asn Phe Thr Ile Ala Glu Arg Ala Gln Arg Val Val Val 31 Trp Leu Gly Gln Asn Phe Leu Leu Pro Glu Asp Thr His Ile Gln 46 Asn Ala Pro Phe Gln Val Cys Phe Thr Ser Leu Arg Asn Gly Gly 61 His Leu His Ile Lys Ile Lys Leu Ser Gly Glu Ile Thr Ile Asn 76 Thr Asp Asp Ile Asp Leu Ala Gly Asp Ile Ile Gln Ser Met Ala 91 Ser Phe Phe Ala Ile Glu Asp Leu Gln Val Glu Ala Asp Phe Pro106 Val Tyr Phe Glu Glu Leu Arg Lys Val Leu Val Lys Val Asp Glu121 Tyr His Ser Val His Gln Lys Leu Ser Ala Asp Met Ala Asp His136 Ser Asn Leu Ile Arg Ser Leu Leu Val Gly Ala Glu Asp Ala Arg151 Leu Met Arg Asp Met Lys Thr Met Lys Ser Arg Tyr Met Glu Leu166 Tyr Asp Leu Asn Arg Asp Leu Leu Asn Gly Tyr Lys Ile Arg Cys181 Asn Asn His Thr Glu Leu Leu Gly Asn Leu Lys Ala Val Asn Gln196 Ala Ile Gln Arg Ala Gly Arg Leu Arg Val Gly Lys Pro Lys Asn211 Gln Val Ile Thr Ala Cys Arg Asp Ala Ile Arg Ser Asn Asn Ile226 Asn Thr Leu Phe Lys Ile Met Arg Mal Gly Thr Ala Ser Ser (4) SEQ ID NO: 3 information (i) sequence characteristics

(A) Length: 24 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotides

(xi) Description of the sequence: SEQ ID NO: 3: TGTTTGGCAGAGGTAAGTGACTGA 24(5) SEQ ID NO: 4 information (i) sequence characteristics

(A) Length: 24 bases

(B) Type (2): nucleic acids

(C) Chainproperty: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotide (xi) sequence description: SEQ ID NO: 4: TTTGGTGGTGATTTTATAATCAAT 24(6) SEQ ID NO: 5 information (i) sequence characteristics

(A) Length: 33 base

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotide (xi) sequence description: SEQ ID NO: 5: CATCCATGGATGTATGCGCTGACCAGCCTGGAC 33(7) SEQ ID NO: 6 information (i) sequence characteristics

(A) Length: 33 base

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotide (xi) sequence description: SEQ ID NO: 6: CATGGATCCCCGGAAGAAGCTGTCCCCACTCG 33(8) SEQ ID NO: 7, information: (i) sequence characteristics:

(A) length: 15 amino acids

(B) Type (2): amino acids

(D) Topological structure: linear (ii) molecular type: polypeptide (xi) sequence description: SEQ ID NO: 7: Met-Tyr-Ala-Leu-Thr-Ser-Leu-Asp-Pro-Ala-Ser-Glu-Pro-Ile-Ser 15(9) SEQ ID NO: 8 information (i) sequence characteristics

(A) Length: 41 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotide (xi) sequence description: SEQ ID NO: 8: TGTATGCGCTGACCAGCCTGGACCCTGCCAGTGAGCCAATC 41(10) SEQ ID NO: 9 information (i) sequence characteristics

(A) Length: 41 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linear (ii) molecular type: oligonucleotide (xi) sequence description: SEQ ID NO: 9: TGTATGCGCTGACCAGCCTGCACCCTGCCAGTGAGCCAATC 41

Claims (18)

1. An isolated polypeptide-human beta-glucuronidase 26.29, comprising: SEQ ID NO: 2, or an active fragment, analog or derivative of the polypeptide thereof.

2. The polypeptide of claim 1, wherein the amino acid sequence of said polypeptide, analog or derivative has an amino acid sequence identical to SEQ ID NO: 2 is at least 95% identical.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the sequence of SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

4. An isolated polynucleotide, characterized in that the polynucleotide comprises one selected from the group consisting of:

(a) encodes a polypeptide having the sequence of SEQ ID NO: 2 or a fragment, analog or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide sharing at least 70% identity to (a) or (b).

5. The polynucleotide of claim 4, wherein said polynucleotide comprises a sequence encoding a polypeptide having the sequence of SEQ ID NO: 2, or a polynucleotide having the amino acid sequence shown in figure 2.

6. The polynucleotide of claim 4, wherein the sequence of said polynucleotide comprises the sequence set forth in SEQ ID NO: 1 at position 1646-2365 or SEQ ID NO: 1-2775 in 1.

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant vector constructed from the polynucleotide of any one of claims 4 to 6 and a plasmid, virus or expression vector.

8. A genetically engineered host cell comprising an exogenous polynucleotide, wherein the genetically engineered host cell is selected from the group consisting of:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) A host cell transformed or transduced with a polynucleotide according to any one of claims 4 to 6.

9. A method for producing a polypeptide having human beta-glucuronidase 26.29 activity, characterized in that the method comprises:

(a) culturing the engineered host cell of claim 8 under conditions that express human beta-glucuronidase 26.29;

(b) isolating the polypeptide having human beta-glucuronidase 26.29 activity from the culture.

10. An antibody capable of binding to a polypeptide, wherein said antibody is an antibody capable of specifically binding to human beta-glucuronidase 26.29.

11. A compound for simulating or regulating the activity or expression of polypeptide, which is characterized in that the compound simulates, promotes, antagonizes or inhibits the activity of human beta-glucuronidase 26.29.

12. The compoundof claim 11, which is SEQ ID NO: 1 or a fragment thereof.

13. Use of a compound according to claim 11 for a method of modulating the in vivo, in vitro activity of human beta-glucuronidase 26.29.

14. A method for detecting a disease or a susceptibility to a disease associated with the polypeptide of any of claims 1-3, comprising detecting the amount of expression of the polypeptide, or detecting the activity of the polypeptide, or detecting a nucleotide variation in the polynucleotide that causes an abnormality in the amount of expression or activity of the polypeptide.

15. Use of a polypeptide according to any of claims 1-3 for screening for mimetics, agonists, antagonists or inhibitors of human beta-glucuronidase 26.29; or for peptide fingerprinting.

16. Use of a nucleic acid molecule according to any of claims 4 to 6 as a primer in a nucleic acid amplification reaction, or as a probe in a hybridization reaction, or for the manufacture of gene chips or microarrays.

17. The polypeptide, polynucleotide or compound of any of claims 1-6 and 11 for use wherein the polypeptide, polynucleotide or its mimetics, agonists, antagonists or inhibitors are used in a safe and effective amount in combination with a pharmaceutically acceptable carrier to form a pharmaceutical composition for the diagnosis or treatment of diseases associated with the abnormality of human beta-glucuronidase 26.29.

18. Use of the polypeptide, polynucleotide or compound of any of claims 1-6 and 11, wherein said polypeptide, polynucleotide or compound is used for thepreparation of a medicament for the treatment of, for example, malignant tumors, hematological disorders, HIV infection and immunological disorders and various types of inflammation.