CN1300826A - Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide - Google Patents

Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide Download PDF

Info

Publication number
CN1300826A
CN1300826A CN 99125665 CN99125665A CN1300826A CN 1300826 A CN1300826 A CN 1300826A CN 99125665 CN99125665 CN 99125665 CN 99125665 A CN99125665 A CN 99125665A CN 1300826 A CN1300826 A CN 1300826A
Authority
CN
China
Prior art keywords
polypeptide
polynucleotide
dna polymerase
sequence
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 99125665
Other languages
Chinese (zh)
Inventor
毛裕民
谢毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Shanghai Bodao Gene Technology Co Ltd
Original Assignee
Fudan University
Shanghai Bodao Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bodao Gene Technology Co Ltd filed Critical Fudan University
Priority to CN 99125665 priority Critical patent/CN1300826A/en
Priority to AU19823/01A priority patent/AU1982301A/en
Priority to PCT/CN2000/000549 priority patent/WO2001046244A1/en
Publication of CN1300826A publication Critical patent/CN1300826A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1276—RNA-directed DNA polymerase (2.7.7.49), i.e. reverse transcriptase or telomerase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A new polypeptide-DNA polymerase 17, the polynucleotide for coding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide in treating diseases (cancer, HIV infection, etc), the antagonist of said polypeptide and its medical function, and the application of said polynucleotide are disclosed.

Description

polypeptide-DNA polymerase 17 and polynucleotide for coding it
The present invention belongs to the field of biotechnology, and is especially one new kind of polypeptide, DNA polymerase 17 and polynucleotides encoding this polypeptide. The present invention also relates to the preparation process and application of the polynucleotides and polypeptides.
Precise semi-retentive replication of DNA plays a key role in the late generations of the species upon reproduction. There are a number of enzymes involved in this process,such as DNA polymerases, helicases, topoisomerases, and the like. Among them, DNA polymerase is essential. The DNA polymerase can synthesize the four precursor nucleotides into a DNA strand according to the base pairing rule. They all require a single strand of DNA as a template and RNA or protein as primers. The DNA polymerase can only take four nucleotides, 5' -triphosphate as a precursor, and the general reaction formula is: this activity, in addition to being able to extend the DNA strand, also has the effect of repairing the DNA and replacing the RNA primer.
DNA polymerase also has 3 '-5' exonuclease activity. This enzymatic activity is based on the recognition of a single strand by an unpaired base. This enzymatic activity is therefore indispensable for ensuring the correctness of its polymerization, a function called proofreading. This is crucial for the stability and extreme fidelity necessary for DNA as genetic material.
In addition, DNA polymerases have 5 '-3' exonuclease activity. This activity translates the nicks on the DNA double strand.
A wide variety of DNA polymerases have now been discovered. The functions of the various DNA polymerases are different. By comparing the protein sequences of different DNA polymerases, the homology of 6 regions is found to be high. The first of these regions is most conserved and includes the structure of a tetrapeptide in which there are two aspartic acid residues. The function of this region may be related to the binding of magnesium ions. Thisconserved sequence is: [ YA]- [ GLIVMSTAC]-D-T-D- [ SG]- [ LIVMFTC]-x- [ LIVMSTAC]
Since the DNA polymerase 17 protein plays an important role in the important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there is a continuing need in the art to identify more of the DNA polymerase 17 proteins involved in these processes, and in particular to identify the amino acid sequence of such proteins. The isolation of the gene encoding the novel DNA polymerase 17 protein also provides the basis for studies to determine the role of the protein in both healthy and disease states. This protein may form the basis for the development of a disease diagnostic and/or therapeutic agent, and therefore, it is very important to isolate its encoding DNA.
It is an object of the present invention to provide an isolated novel polypeptide, DNA polymerase 17, and fragments, analogs and derivatives thereof.
Another objective of the invention is to provide a polynucleotide encoding the polypeptide.
Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding DNA polymerase 17.
It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding DNA polymerase 17.
Another object of the present invention is to provide a method for producing the DNA polymerase 17.
Another objective of the invention is to provide an antibody against DNA polymerase 17, which is a polypeptide of the invention.
Another objective of the invention is to provide mimetics, antagonists, agonists, and inhibitors for the polypeptide of DNA polymerase 17.
It is another object of the present invention to provide a method for diagnosing and treating a disease associated with an abnormality of DNA polymerase 17.
The present invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No.2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO. 2.
The invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
(b) a polynucleotide complementary to polynucleotide (a);
(c) a polynucleotide sharing at least 70% identity with the polynucleotide sequence of (a) or (b).
More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) has a sequence of 9-467 bits of SEQ ID NO. 1; and (b) a sequence having positions 1 to 1891 in SEQ ID NO: 1.
The present invention furthermore relates to a vector, in particular an expression vector, comprising a polynucleotide according to the invention; a host cell genetically engineered with the vector, including transformed, transduced or transfected host cells; a method for producing the polypeptide of the present invention comprising culturing the host cell and recovering the expression product.
The invention also relates to an antibody capable of specifically binding to the polypeptide of the invention.
The present invention also relates to a method for screening compounds that mimic, activate, antagonize, or inhibit the activity of DNA polymerase 17 protein, which comprises using the polypeptide of the present invention. The invention also relates to the compounds obtained by this process.
The present invention also relates to an in vitro method for detecting a disease or a susceptibility to a disease associated with aberrant expression of DNA polymerase 17 protein, comprising detecting a mutation in the polypeptide or in a polynucleotide sequence encoding the polypeptide in a biological sample, or detecting the amount or biological activity of a polypeptide of the present invention in a biological sample.
The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic, activator, antagonist or inhibitor thereof and a pharmaceutically acceptable carrier.
The invention also relates to the use of the polypeptide and/or polynucleotide of the invention in the preparation of a medicament for the treatment of cancer, developmental or immune diseases, or other diseases caused by abnormal expression of DNA polymerase 17.
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure of the technology herein.
The following terms used in the specification and claims have the following meanings, unless otherwise specified: "nucleic acid sequence" refers to an oligonucleotide, nucleotide or polynucleotide and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing either the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof. When "amino acid sequence" in the present invention refers to the amino acidsequence of a naturally occurring protein molecule, such "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.
A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The alteration may comprise a deletion, insertion or substitution of an amino acid or a nucleotide in the amino acid sequence or the nucleotide sequence. Variants may have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as the substitution of isoleucine with leucine. Variants may also have non-conservative changes, such as replacement of glycine with tryptophan.
"deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
"insertion" or "addition" refers to a change in an amino acid sequence or nucleotide sequence resulting in an increase of one or more amino acids or nucleotides compared to the naturally occurring molecule. "substitution" refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides.
"biological activity" refers to a protein having the structural, regulatory, or biochemical functions of a native molecule. Similarly, the term "immunological activity" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
An "agonist" is a molecule that, when bound to DNA polymerase 17, causes the protein to change, thereby modulating the activity of the protein. Agonists may include proteins, nucleic acids, carbohydrates or any other molecules that can bind to DNA polymerase 17.
An "antagonist" or "inhibitor" refers to a molecule that blocks or modulates the biological or immunological activity of DNA polymerase 17 when bound to DNA polymerase 17. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecules that can bind to DNA polymerase 17.
"modulation" refers to a change in the function of DNA polymerase 17, including an increase or decrease in protein activity, a change in binding characteristics, and a change in any other biological, functional, or immunological property of DNA polymerase 17.
"substantially pure" means substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify DNA polymerase 17 using standard protein purification techniques. The substantially pure DNA polymerase 17 is capable of generating a single main band on a non-reducing polyacrylamide gel. The purity of the DNA polymerase 17 polypeptide can be analyzed by amino acid sequence analysis.
"complementary" or "complementation" refers to the natural binding of polynucleotides by base pairing under the conditions of salt concentration and temperature allowed. For example, the sequence "C-T-G-A" may bind to the complementary sequence "G-A-C-T". The complementarity between the two single stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
"homology" refers to the degree of complementarity, which may be partial or complete. "partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridizationcan be detected by hybridization (Southern blot or Northern blot) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes compete for and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, as the conditions of reduced stringency require specific or selective interaction of the two sequences with each other.
"percent identity" refers to the percentage of sequence identity or similarity in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software assembler, DNASTAR, Inc., Madison Wis.). MEGALIGN can compare two or more sequences according to different methods, such as the Cluster method (Higgins, D.G. and P.M.Sharp (1988) Gene 73: 237-. Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula:
number of residues matching between sequence A and sequence B
100 (number of residues in sequence A-number of spacer residues in sequence B)
The percent identity between nucleic acid sequences can also be determined by Cluster method or by Methods well known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-.
"similarity" refers to the degree of identical or conservative substitution of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; amino acids with uncharged head groups having similar hydrophilicity can include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
"antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".
"derivative" refers to HFP or a chemical modification of the nucleic acid encoding it. Such chemical modification may be replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. The nucleic acid derivative may encode a polypeptide that retains the main biological properties of the native molecule.
"antibody" refers to intact antibody molecules and fragments thereof, e.g., Fa, F (ab')2And Fv, which specifically binds to an antigenic determinant of DNA polymerase 17.
"humanized antibody" refers to an antibody in which the amino acid sequence of the non-antigen binding region has been replaced to more closely resemble that of a human antibody, but which retains the original binding activity.
The term "isolated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated from some or all of the materials with which it coexists in its natural system. Such polynucleotides may be part of a vector, or such polynucleotides or polypeptides may be part of a composition. Since the carrier or composition is not a component of its natural environment, it remains isolated.
As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.
As used herein, "isolated DNA polymerase 17" means that DNA polymerase 17 is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify DNA polymerase 17 using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of the DNA polymerase 17 polypeptide can be analyzed by amino acid sequence analysis.
The present invention provides a novel polypeptide, DNA polymerase 17, which consists essentially of the amino acid sequence shown in SEQ ID NO. 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.
The invention also includes fragments, derivatives and analogs of DNA polymerase 17. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity of the DNA polymerase 17 of the invention. The fragment, derivative or analogue of the polypeptide of the invention may be: (ii) one in which one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), and the substituted amino acid may or may not be encoded by the genetic code; or (II) one in which one or more of the amino acid residues are substituted with other groups, including a substituent; or (iii) one in which the mature polypeptide is fused to another compound (such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol); or (IV) a polypeptide sequence in which additional amino acid sequences are fused to the mature polypeptide (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence) by way of illustration herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
The present invention provides isolated nucleic acids (polynucleotides) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO. 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO. 1. The polynucleotides of the invention are found in cDNA libraries of human fetal brain tissue. It comprises a full-length polynucleotide sequence of 1891 bases, whose open reading frames 9-467 encode 152 amino acids. The polypeptide has a characteristic sequence of a DNA polymerase family protein, and it can be concluded that the DNA polymerase 17 has the structure and function represented by the DNA polymerase family protein.
The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 1 or may be a degenerate variant. As used herein, "degenerate variant" refers herein to a nucleic acid sequence that encodes a protein or polypeptide having SEQ ID NO.2, but differs from the sequence of the coding region shown in SEQ ID NO. 1.
The polynucleotide encoding the mature polypeptide of SEQ ID NO.2 comprises: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.
The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides encoding the polypeptide and polynucleotides including additional coding and/or non-coding sequences.
The present invention also relates to variants of the above-described polynucleotides which encode a polypeptide having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.
The invention also relates to polynucleotides (having at least 50%, preferably 70% identity between two sequences) which hybridize to the sequences described above. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 95% or more, preferably 97% or more. And, the polypeptide encoded by the hybridizable polynucleotide is complementary to the polypeptide of SEQ ID NO:2 have the same biological functions and activities.
The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides in length. The nucleic acid fragments may also be used in amplification techniques of nucleic acids, such as PCR, to determine and/or isolate a polynucleotide encoding DNA polymerase 17.
The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.
The specific polynucleotide sequence encoding DNA polymerase 17 of the present invention can be obtained in a variety of ways. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural features.
The DNA fragment sequences of the present invention can also be obtained by the following methods: 1) isolating double-stranded DNA sequences from genomic DNA; 2) chemically synthesizing a DNA sequence to obtain a double-stranded DNA of the polypeptide.
Among the above-mentioned methods, isolation of genomic DNA is least frequently used. Direct chemical synthesis of DNA sequences is a frequently used method. A more frequently used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that highly express the gene and reverse transcribe the mRNA to form a plasmid or phage cDNA library. There are a number of well-established techniques for extracting mRNA and kits are commercially available (Qiagene). The construction of cDNA libraries is also a common procedure (Sambrook, et al, molecular cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction techniques are used in combination, even very few expression products can be cloned.
The gene of the present invention can be screened from these cDNA libraries by a conventional method. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of function of a marker gene; (3) determining the level of a transcript of DNA polymerase 17; (4) the protein product of gene expression is detected by immunological techniques or by assaying for biological activity. The above methods can be used singly or in combination of multiple methods.
In method (1), the probe used for hybridization is homologous to any portion of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized on the basis of the sequence information of the gene of the present invention. The gene of the present invention itself or a fragment thereof can of course be used as a probe. The DNA probe may be labeled with a radioisotope, fluorescein or an enzyme (e.g., alkaline phosphatase), etc.
In method (4), the detection of the protein product expressed by DNA polymerase 17 gene can be carried out by immunological techniques such as Western blotting, radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), etc.
A method of amplifying DNA/RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the polynucleotide of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.
The polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments and the like can be determined by a conventional method such as the dideoxy chain termination method (Sanger et al. PNAS,1977,74: 5463-5467). Such polynucleotide sequencing may also be performed using commercial sequencing kits and the like. Sequencing was repeated to obtain a full-length cDNA sequence. Sometimes, it is necessary to sequence the cDNA of several clones to obtain the full-length cDNA sequence.
The present invention also relates to vectors comprising the polynucleotides of the present invention, as well as genetically engineered host cells produced with the vectors of the present invention or directly with the DNA polymerase 17 coding sequence, and methods for producing the polypeptides of the present invention by recombinant techniques.
In the present invention, the polynucleotide sequence encoding DNA polymerase 17 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vector well known in the art. Vectors suitable for use in the present invention include, but are not limited to: expression vectors based on the T7 promoter for expression in bacteria (Rosenberg, et al. Gene,1987,56: 125); pMSXND expression vector expressed in mammalian cells (Lee and Nathans, J Bio chem.263:3521,1988) and baculovirus-derived vectors expressed in insect cells. In general, any plasmid or vector can be used to construct a recombinant expression vector so long as it can replicate and is stable in the host. An important feature of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding DNA polymerase 17 and appropriate transcription/translation regulatory elements. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, etc. (Sambrook, et al molecular Cloning, a laboratory Manual, cold Spring Harbor laboratory. New York, 1989). The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; the PL promoter of lambda phage; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling the expression of genes in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. The insertion of enhancer sequences into vectors will enhance transcription in higher eukaryotic cells. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.
In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli, and the like.
It will be clear to one of ordinary skill in the art how to select the appropriate vector/transcriptional regulatory element (e.g., promoter, enhancer, etc.) and selectable marker gene.
In the present invention, a polynucleotide encoding DNA polymerase 17 or a recombinant vector containing the polynucleotide may be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or recombinant vector. The term "host cell" refers to prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells such as salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells such as Drosophila S2 or Sf 9; animal cells such as CHO, COS or Bowes melanoma cells.
Transformation of a host cell with a DNA sequence according to the invention or a recombinant vector containing said DNA sequence may be carried out by conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl2Methods, the steps used are well known in the art. Alternatively, MgCl is used2. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, or conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, and the like.
The recombinant DNA polymerase 17 can be expressed or produced by conventional recombinant DNA techniques using the polynucleotide sequence of the present invention (Science, 1984; 224: 1431). Generally, the following steps are performed:
(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding human DNA polymerase 17, or with a recombinant expression vector comprising the polynucleotide;
(2) culturing the host cell in a suitable medium;
(3) isolating and purifying the protein from the culture medium or the cells.
In step (2), the medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.
In step (3), the recombinant polypeptide may be encapsulated in the cell, or expressed on the cell membrane, or secreted out of the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting-out method), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations thereof.
The polypeptide of the present invention and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating diseases, such as malignant tumors, adrenal gland deficiency, skin diseases, various inflammations, HIV infection, immunological diseases, etc.
DNA polymerases play a key role in the precise semi-conservative replication of DNA. The DNA polymerase can synthesize the four precursor nucleotides into a DNA strand according to the base pairing rule.
DNA polymerase also has 3 '-5' exonuclease activity. This enzymatic activity is based on the recognition of a single strand by an unpaired base. This enzymatic activity is therefore indispensable for ensuring the correctness of its polymerization, a function called proofreading. This is crucial for the stability and extreme fidelity necessary for DNA as genetic material. In addition, DNA polymerases have 5 '-3' exonuclease activity. This activity translates the nicks on the DNA double strand. Therefore, abnormal expression of a polypeptide comprising a DNA polymerase-specific sequence will cause errors in DNA replication, resulting in deletion, translocation, duplication, inversion, etc. of DNA, which in turn will cause related diseases such as chromosomal disorders, monogenetic disorders, various tumors, embryonic developmental disorders, etc.
It can be seen that abnormal expression of DNA polymerase 17 of the present invention will result in a variety of diseases, particularly chromosomal disorders, monogenetic disorders, various tumors, and embryonic developmental disorders, including but not limited to:
chromosomal disorders: klinefelter syndrome, XYY syndrome, XX male syndrome, XXX female syndrome, Turner syndrome, trisomy 21 syndrome, crinis felis syndrome, trisomy 13 syndrome, trisomy 18 syndrome, fragile X syndrome, syndrome of chromosome breakage, other symptoms of abnormal chromosome structure and number
Monogenic genetic diseases: autosomal dominant genetic diseases such as Marfan syndrome, Ehlers-Danlos syndrome, congenital achondroplasia, polycystic kidney, tuberous sclerosis, Huntington's chorea, familial hypercholesterolemia, neurofibromatosis, intestinal polyposis, retinoblastoma; autosomal recessive genetic disorders: lysosomal storage disorders such as glycogen storage disorder, lipid storage disorder, mucopolysaccharide storage disorder, synthase deficiency such as blood gamma globulin deficiency, albinism, phenylketonuria, hepatolenticular degeneration, galactosemia; sex linked genetic diseases: hemophilia A, pseudohypertrophic muscular dystrophy, anerythrochloropsia
Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroid, neuroblastoma, astrocytoma, ependymoma, glioma, colon cancer, malignant histiocytosis, melanoma, teratoma, sarcoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gall bladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma, and melanoma
Embryonic development disorders: congenital abortion, cleft palate, facial hemiparalysis, limb defect, limb differentiation disorder, digestive tract atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney, ectopic kidney, double ureter, saphenous, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, amphichromy, atrial septal defect, ventricular septal defect, pulmonary artery stenosis, patent ductus arteriosus, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness, auricular malformation
Abnormal expression of the DNA polymerase 17 of the present invention may also cause certain blood disorders and immune system disorders.
The polypeptide of the present invention and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating diseases, for example, various diseases, especially chromosome diseases, monogenetic diseases, various tumors, embryonic development disturbance diseases, certain blood diseases, immune system diseases, etc.
The invention also provides methods of screening compounds to identify agents that increase (agonists) or repress (antagonists) DNA polymerase 17. Agonists enhance biological functions of DNA polymerase 17 such as stimulating cell proliferation, while antagonists prevent and treat disorders associated with excessive cell proliferation such as various cancers. For example, mammalian cells or membrane preparations expressing DNA polymerase 17 can be cultured with labeled DNA polymerase 17 in the presence of a drug. The ability of the agent to enhance or repress this interaction is then determined.
The antagonists of DNA polymerase 17 include antibodies, compounds, receptor deletants and the like selected. Antagonists of DNA polymerase 17 may bind to DNA polymerase 17 and abrogate its function, or inhibit production of the polypeptide, or bind to the active site of the polypeptide such that the polypeptide is rendered biologically nonfunctional.
In screening for compounds that act as antagonists, DNA polymerase 17 can be added to a bioassay assay to determine whether a compound is an antagonist by determining the effect of the compound on the interaction between DNA polymerase 17 and its receptor. Receptor deletants and analogs that act as antagonists can be screened using the same methods described above for compounds. Polypeptide molecules capable of binding to DNA polymerase 17 can be obtained by screening a random polypeptide library consisting of various possible combinations of amino acids bound to a solid phase. In screening, the DNA polymerase 17 molecule is generally labeled.
The present invention provides methods for producing antibodies using polypeptides, and fragments, derivatives, analogs, or cells thereof, as antigens. These antibodies may be polyclonal or monoclonal. The invention also provides antibodies directed against the 17 epitope of DNA polymerase. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by a Fab expression library.
Polyclonal antibody production can be achieved by direct injection of DNA polymerase 17 into an animal (e.g., rabbit, mouse, rat, etc.), and various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to DNA polymerase 17 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature,1975,256:495-497), trioma technology, human B-cell hybridoma technology, EBV-hybridoma technology, and the like. Chimeric antibodies that bind human constant regions to non-endogenous variable regions can be produced using established techniques (Morrison et al, PNAS,1985,81: 6851). The existing techniques for producing single-chain antibodies (U.S. Pat. No.4946778) can also be used to produce single-chain antibodies against DNA polymerase 17.
Antibodies against DNA polymerase 17 may be used in immunohistochemical techniques to detect DNA polymerase 17 in biopsy specimens.
Monoclonal antibodies that bind to DNA polymerase 17 may also be labeled with a radioisotope that can be injected into the body to track its location and distribution. The radiolabeled antibody can be used as a non-invasive diagnostic method for locating tumor cells and judging whether metastasis exists.
Antibodies can also be used to design immunotoxins directed to a particular site in the body. For example, a monoclonal antibody with high affinity to DNA polymerase 17 can be covalently bound to a bacterial or plant toxin (e.g., diphtheria toxin, ricin, ormosine, etc.). One common method is to attack the amino group of the antibody with a thiol crosslinking agent such as SPDP and bind the toxin to the antibody by exchange of disulfide bonds, and this hybrid antibody can be used to kill DNA polymerase 17 positive cells.
The antibodies of the present invention are useful for treating or preventing diseases associated with DNA polymerase 17. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of DNA polymerase 17.
The invention also relates to diagnostic assays for quantitative and positional detection of DNA polymerase 17 levels. These assays are well known in the art and include FISH assays and radioimmunoassays. The level of DNA polymerase 17 detected in the assay can be used to explain the importance of DNA polymerase 17 in various diseases and to diagnose diseases in which DNA polymerase 17 plays a role.
The polypeptides of the invention may also be used for peptide profiling, for example, where the polypeptides may be specifically cleaved by physical, chemical or enzymatic means and subjected to one or two or three dimensional gel electrophoresis analysis, preferably mass spectrometry.
Polynucleotides encoding DNA polymerase 17 may also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat cell proliferation, development or metabolic abnormalities due to the non-expression or abnormal/inactive expression of DNA polymerase 17. Recombinant gene therapy vectors (e.g., viral vectors) can be designed to express the variant DNA polymerase 17 to inhibit endogenous DNA polymerase 17 activity. For example, a variant DNA polymerase 17 may be a shortened, signaling domain-deleted DNA polymerase 17 that, while binding to a downstream substrate, lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of the DNA polymerase 17. Expression vectors derived from viruses such as retroviruses, adenoviruses, adeno-associated viruses, herpes simplex viruses, parvoviruses, and the like can be used to transfer a polynucleotide encoding DNA polymerase 17 into a cell. Methods for constructing recombinant viral vectors carrying polynucleotides encoding DNA polymerase 17 can be found in the literature (Sambrook, et al.). Alternatively, the recombinant DNA polymerase 17 encoding polynucleotide may be packaged in liposomes for transfer into cells.
The method for introducing the polynucleotide into the tissue or the cell comprises: injecting the polynucleotide directlyinto the in vivo tissue; or introducing the polynucleotide into cells in vitro via a vector (e.g., a virus, phage, or plasmid), and then transplanting the cells into the body.
Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit DNA polymerase 17mRNA are also within the scope of the invention. Ribozymes are enzyme-like RNA molecules that specifically cleave specific RNAs and act by specifically hybridizing the ribozyme molecules with complementary target RNAs followed by endonucleolytic action. Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or DNA synthesis techniques, such as solid phase phosphoramidite chemical synthesis method for oligonucleotide synthesis. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the DNA sequence encoding the RNA. This DNA sequence has been integrated into the vector downstream of the RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in various ways, such as increasing the length of the flanking sequences, using phosphothioester or peptide bonds instead of phosphodiester linkages for the linkages between ribonucleosides.
The polynucleotide encoding DNA polymerase 17 can be used for diagnosis of diseases associated with DNA polymerase 17. The polynucleotide encoding DNA polymerase 17 may be used to detect the presence or absence of expression of DNA polymerase 17 or abnormal expression of DNA polymerase 17 in disease states. For example, a DNA sequence encoding DNA polymerase 17 may be used to hybridize the biopsy sample to determine the expression of DNA polymerase 17. The hybridization techniques include Southern blotting, Northern blotting, in situ blotting, etc. The technical methods are all published mature technologies, and related kits are all available from commercial sources. A part or all of the polynucleotide of the present invention can be immobilized as a probe on a Microarray (Microarray) or a DNA chip (also referred to as "gene chip") for analysis of differential expression of genes in tissues and gene diagnosis. In vitro amplification by RNA-polymerase chain reaction (RT-PCR) using primers specific for DNA polymerase 17 can also detect the transcription product of DNA polymerase 17.
Detection of mutations in the DNA polymerase 17 gene may also be used to diagnose DNA polymerase 17 related diseases. The forms of DNA polymerase 17 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities, etc., as compared to the normal wild-type DNA polymerase 17 DNA sequence. The mutation can be detected by known techniques such as Southern blotting, DNA sequencing, PCR and in situ hybridization. In addition, since mutation may affect the expression of protein, the presence or absence of mutation in a gene can be indirectly determined by Northern blotting or Western blotting.
The sequences of the invention are also valuable for chromosome identification. The sequence will be specific for a particular location on a human chromosome and will hybridize to it. Currently, there is a need to identify specific sites on each gene on the chromosome. Currently, only few chromosomal markers based on actual sequence data (repeat polymorphisms) are available for marking chromosomal locations. According to the present invention, the first step important in correlating these sequences with disease-associated genes is the mapping of these DNA sequences to chromosomes.
Briefly, PCR primers (preferably 15-35bp) are prepared from the cDNA and the sequence can be mapped to the chromosome. These primers were then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
The PCR mapping method of somatic cell heterozygous cell is a rapid method for mapping DNA to specific chromosome. Using the oligonucleotide primers of the present invention, sublocalization can be achieved using a panel of fragments from a particular chromosome or a large number of genomic clones by similar methods. Other similar strategies that can be used for chromosome mapping include in situ hybridization, prescreening with labeled flow sorted chromosomes, and preselection by hybridization to construct chromosome-specific cDNA libraries.
Fluorescence In Situ Hybridization (FISH) of cDNA clones to metaphase chromosomes allows accurate chromosomal location in one step. For a review of this technology, see Verma et al, Human Chromosomees: a Manual of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence is located at an exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. These data can be found, for example, in V.Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). The relationship between the gene and the disease that has been mapped to the chromosomal region can then be determined by linkage analysis.
Next, it is necessary to determine the differences in cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals, but not in any normal individuals, then the mutation may be the cause of the disease. Comparing diseased and non-diseased individuals generally involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible from the chromosomal level or detectable using PCR based cDNA sequences. Based on the resolution of current physical mapping and gene mapping techniques, cDNAs that are precisely mapped to chromosomal regions associated with disease can be one of 50 to 500 potential disease-causing genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the invention may be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and a carrier and an excipient which do not affect the effect of the medicine. These compositions can be used as medicaments for the treatment of diseases.
The invention also provides a kit or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Along with these containers, there may be an instructional cue given by a governmental regulatory agency that regulates the manufacture, use or sale of pharmaceuticals or biological products, which cue reflects approval by the governmental agency of manufacture, use or sale for human administration. In addition, the polypeptides of the invention may be used in combination with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes of administration. DNA polymerase 17 is administered in an amount effective to treat and/or prevent the particular indication. The amount of DNA polymerase 17 administered to a patient and the dosage range will depend on a number of factors, such as the mode of administration, the health of the subject to be treated, and the judgment of the diagnostician.
The following drawings are included to illustrate specific embodiments of the invention and are notintended to limit the scope of the invention as defined by the claims.
FIG. 1 is a comparison of amino acid sequence homologies between 50 amino acids in total at 40-89 for the DNA polymerase 17 of the present invention and the proteins of the DNA polymerase family. The top sequence is DNA polymerase 17 and the bottom sequence is the domain DNA polymerase family protein. Identical amino acids are represented by one-character amino acids between the two sequences, and similar amino acids are represented by "+".
FIG. 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) of the separated DNA polymerase 17. 17kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold spring harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Example 1: cloning of DNA polymerase 17
Extraction of human fetal brain Total RNA by the one-step method of guanidinium isothiocyanate/phenol/chloroform extraction of Poly (A) mRNA.2ug Poly (A) mRNA was reverse-transcribed to form cDNA from Total RNA using Quik mRNA Isolation Kit (Qiagene, manufactured by Clontech.) cDNA fragments were directionally inserted into the multiple cloning site of pBSK (+) vector (Clontech.) using Smart cDNA cloning Kit (purchased from Clontech.) and then transformed into DH5 α, the bacterium formed cDNA library comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank) and finding that the cDNA sequence of one of the clones named as cDNA 38b04 was novel DNA, the inserted cDNA fragment of the clone was synthesized by a series of primers and then determined by comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank) and finding that the full-length cDNA sequence of the clone was found to be equivalent to that the full-length cDNA of the protein encoded by the cDNA fragment of this clone was found to be equivalent to the full-length protein encoded by the open reading cDNA of the cDNA of this clone No. 1-11 bp-11. the cDNA sequence of this clone was found to be equivalent to the full length protein encoded by the open reading cDNA of the open cDNA of the sequence of the cDNA sequence found to be found by the open cDNA found to be found to
The sequence of the DNA polymerase 17 of the present invention and the protein sequence encoded by it were determined by using the profile scan program (basic Alignment search tool) in GCG [ Altschul, SF et al.J.mol.biol.1990; 215:403-10], domain analysis was performed in the database of prosite et al. The DNA polymerase 17 of the invention has homology with structural domain DNA polymerase family protein in 40-89, the homology result is shown in figure 1, the homology rate is 0.14, and the score is 7.11; the threshold was 7.06. Example 3: cloning of DNA polymerase 17 encoding Gene by RT-PCR
cDNA was synthesized by reverse transcription using total fetal brain cell RNA as a template and oligo-dT as a primer, purified using Qiagene's kit, and then amplified by PCR using the following primers:
Primerl:5’-ATTAAGATATGCTAGTTTTGTTTG-3’(SEQ ID NO:3)
Primer2:5’-GAGAGTCTCACTCTGTCACCTAGG-3’(SEQ ID NO:4)
primer1 is the forward sequence starting at the 1bp located 5' to SEQ ID NO 1;
primer2 is the 3' reverse sequence of SEQ ID NO: 1.
Conditions of the amplification reaction: 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5),1.5mmol/L MgCl in a reaction volume of 50. mu.l2200. mu. mol/L dNTP,10pmol primer, 1U of Taq DNA polymerase (product of Clontech corporation) was reacted on a DNA thermal cycler model PE9600 (Perkin-Elmer corporation) for 25 cycles under the conditions of 94 ℃ for 30sec, 55 ℃ for 30sec, 72 ℃ for 2min, β -action was set as a positive control and a template blank as a negative control at the time of RT-PCR the amplified product was purified with a QIAGEN kit, ligated to a pCR vector (product of Invitrogen) with a TA cloning kit, and the DNA sequence analysis result showed that the DNA sequence of the PCR product was identical to 1 to 1891bp shown in SEQ ID NO: 1. example 4. Northern blotting analysis of the expression of DNA polymerase 17 gene:
total RNA was extracted by one-step method [ anal. biochem 1987,162, 156-159-]The method comprises acidic guanidinium thiocyanate phenol-chloroform extraction of tissue homogenized with 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2M sodium acetate (pH4.0), addition of 1 volume phenol and 1/5 volumes chloroform-isoamyl alcohol (49: 1), mixing, centrifugation, aspiration of the aqueous layer, addition of isopropanol (0.8 volume) and centrifugation of the mixture to obtain an RNA precipitate, washing of the RNA precipitate with 70% ethanol, drying and dissolving in water, electrophoresis with 20. mu.g of RNA on a 1.2% agarose gel containing 20mM 3- (N-morpholino) propanesulfonic acid (pH7.0) -5mM sodium acetate-1 mM EDTA-2.2M formaldehyde, transfer to nitrocellulose membrane α -32P dATP prepared by random primer method32P-labeled DNA probes. The DNA probe used was thesequence of the coding region of DNA polymerase 17 (9bp to 467bp) amplified by PCR as shown in FIG. 1. Will 32P-markNote probe (about 2X 10)6cpm/ml) was hybridized with RNA-transferred nitrocellulose membrane overnight at 42 ℃ in a solution containing 50% formamide-25 mM KH2PO4(pH7.4) -5 XSSC-5 XDenhardt's solution and 200. mu.g/ml salmon sperm DNA. After hybridization, the filters were washed in 1 XSSC-0.1% SDS at 55 ℃ for 30 min. Then, analysis and quantification were performed using a Phosphor Imager. Example 5: in vitro expression, isolation and purification of recombinant DNA polymerase 17
Based on the sequence of the coding region shown in SEQ ID NO. 1 and FIG. 1, a pair of specific amplification primers is designed, and the sequence is as follows:
Primer3:5’-CCCCATATGATGCTAGTTTTGTTTGTTTGTTTGC-3’(Seq ID No:5)
Primer4:5’-CCCGAATTCTCACCAAGTTGGCCAGGCTGGTATC-3’(Seq ID No:6)
the two primers contained NdeI and EcoRI cleavage sites at the 5 ' end, respectively, followed by the coding sequence at the 5 ' end and 3 ' end of the gene of interest, respectively, and NdeI and EcoRI cleavage sites corresponding to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen Co., Cat. No.69865.3) PCR was performed using pBS-0538b04 plasmid containing the full length of the gene of interest as a template under conditions of 10pmol pBS-0538b04 plasmid 10, Primer-3 and Primer-4, respectively, 10pmol of Advantage polymerase Mix (Clontech Co., product) 1. mu.l cycle parameters, 94 ℃ 20s, 60 ℃ 30s, 68 ℃ 2min, 25 cycles, double sequencing of the amplified product and plasmid T-28, respectively, recovering large fragments, ligating the large fragments with NdeI and DNA fragments, and obtaining a DNA fragment containing the DNA obtained by PCR, after the final concentration of the DNA fragmentwas analyzed by the PCR using a DNA ligase, the DNA fragment containing the DNA obtained by the PCR method was subjected to the final concentration of the DNA fragment obtained by the PCR method of the PCR amplification product obtained by adding the DNA polymerase chain of the DNA of the cDNA ends of the plasmid pET-DNA pET-28b of interest (cDNA ends, the plasmid of the
The following DNA polymerase 17-specific polypeptides were synthesized using a polypeptide synthesizer (product of PE Co.):
NH2-Met-Leu-Val-Leu-Phe-Val-Cys-Leu-Gln-Gln-Gly-Leu-Ala-Leu-Thr-COOH(SEQ ID NO: 7). The polypeptide is respectively coupled with hemocyanin and bovine serum albumin to form a complex, and the method is as follows: avarameas, et al, immunochemistry, 1969; 6:43. 4mg of the hemocyanin polypeptide compound and complete Freund's adjuvant are used for immunizing rabbits, and the hemocyanin polypeptide compound and the complete Freund's adjuvant are used for boosting immunization once after 15 days. The titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with 15. mu.g/ml bovine serum albumin polypeptide complex. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The polypeptides were bound to a cyanogen bromide activated Sepharose4B column and anti-polypeptide antibodies were separated from total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically bound to DNA polymerase 17. Example 7: use of the Polynucleotide fragments of the invention as hybridization probes
The selection of suitable oligonucleotide fragments from the polynucleotide of the present invention can be used as hybridization probes for identifying whether they contain the polynucleotide sequence of the present invention and detecting homologous polynucleotide sequences, and for detecting whether the expression ofthe polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathological tissue cells is abnormal.
The object of this example is to select suitable oligonucleotide fragments from the polynucleotide of the invention SEQ ID NO. 1 for use as hybridization probes and to identify tissues containing the polynucleotide sequence of the invention or its homologous polynucleotide sequences by filter hybridization. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and replica methods, all of which are methods in which a polynucleotide sample to be tested is immobilized on a filter and then hybridized by substantially the same procedure. These same steps are: the filter on which the sample is immobilized is first prehybridized with a hybridization buffer that does not contain a probe so that the nonspecific binding sites of the sample on the filter are saturated with the support and synthetic polymer. The prehybridization buffer is then replaced with a hybridization buffer containing labeled probes and incubated to allow hybridization of the probes to the target nucleic acids. Following the hybridization step, unhybridized probes are removed by a series of membrane washing steps. This example utilizes higher intensity membrane wash conditions (e.g., lower salt concentration and higher temperature) to reduce hybridization background and retain only a highly specific signal. The probes selected for this embodiment include two types: the first type of probe is an oligonucleotide fragment that is identical or complementary to the polynucleotide of the invention, SEQ ID NO 1; the second type of probe is an oligonucleotide fragment, the part of which is identical or complementary to the polynucleotide of the invention, SEQ ID NO 1. In this embodiment, the dot blot method is used to fix the sample on the filter membrane, and the hybridization specificity of the first type probe and the sample is the strongest and is retained under the condition of higher-strength membrane washing. First, selection of probe
The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide of the invention, SEQ ID NO 1, follows the following principles and several aspects to be considered: 1, the size of the probe is preferably 18-50 nucleotides; 2, the GC content is 30-70%, and when the GC content exceeds the GC content, non-specific hybridization is increased; 3, no complementary region should be arranged in the probe; 4, the probe meeting the above conditions can be used as a primary selection probe, and then further computer sequence analysis is carried out, wherein the primary selection probe is respectively compared with the sequence region (namely SEQ ID NO:1) of the primary selection probe and other known genome sequences and complementary regions thereof for homology, and if the homology of the primary selection probe with the non-target molecule region is more than 85 percent or more than 15 continuous bases are completely identical, the primary selection probe is not generally used; whether the initially selected probe is finally selected as a probe having practical application value should be further determined by experiments.
After the above analysis, the following two probes were selected and synthesized:
probe 1(probe1), belonging to the first category of probes, is completely homologous or complementary to the gene fragment of SEQ ID NO:1 (41Nt)
5’-CCTGCCTCAGCCTCCTGAGTACAGGTGCGTGCCACCACGCC-3’ (SEQ ID NO:8)
Probe 2(probe2), belonging to the second category of probes, corresponds to the substitution mutation sequence (41Nt) of the gene fragment of SEQ ID NO:1 or its complementary fragment:
5’-CCTGCCTCAGCCTCCTGAGTATAGGTGCGTGCCACCACGCC-3’ (SEQ ID NO:9)
for other common reagents and their formulation methods not listed in connection with the following specific experimental procedures, reference is made to the literature: DNA PROBES g.h.keller; man ak, m.m.manak; stockton Press,1989(USA) and more generally books of molecular cloning, A laboratory Manual, scientific Press, molecular cloning, A guide to molecular cloning (second edition 1998) [ U.S.]SammBruk et al.
Sample preparation: 1, extraction of DNA from fresh or frozen tissue
The method comprises the following steps: 1) fresh or freshly thawed normal liver tissue is placed in a dish soaked on ice and containing Phosphate Buffered Saline (PBS). The tissue is cut into small pieces with scissors or a scalpel. Tissue should be kept moist during the procedure. 2) The minced tissue was centrifuged at 1000g for 10 minutes. 3) The slurry was homogenized with cold homogenization buffer (0.25mol/L sucrose; 25mmol/LTris-HCl, pH 7.5; 25 mmol/LnaCl; 25mmol/L MgCl2) The pellet was suspended (approximately 10 ml/g). 4) The tissue suspension was homogenized at full speed with an electric homogenizer at 4 ℃ until the tissue was completely disrupted. 5) Centrifuge at 1000g for 10 min. 6) Resuspend the cell pellet (1-5 ml per 0.1g of initial tissue sample) and centrifuge at 1000g for 10 min. 7) The pellet was resuspended in lysis buffer (1 ml per 0.1g of initial tissue sample) and then subjected to the following phenol extraction procedure. 2, phenol extraction of DNA
The method comprises the following steps: 1) cells were washed with 1-10ml cold PBS and centrifuged at 1000g for 10 min. 2) Resuspending the pelleted cells with Cold cell lysate (1X 10)8Cells/ml) a minimum of 100ul lysis buffer was used. 3) SDS was added to a final concentration of 1%, and if SDS was added directly to the cell pellet before resuspending the cells, the cells may form large coloniesThe clumps are difficult to break and the overall yield is reduced. This is at extraction>107Cells are particularly severe. 4) Proteinase K was added to a final concentration of 200 ug/ml. 5) The reaction is incubated at 50 ℃ for 1 hour or at 37 DEG CGently shake at deg.C overnight. 6) Extracted with equal volumes of phenol, chloroform, isoamyl alcohol (25: 24: 1) and centrifuged in a small centrifuge tube for 10 minutes. The two phases are clearly separated, otherwise centrifugation is carried out again. 7) The aqueous phase was transferred to a new tube. 8) Extracted with chloroform isoamyl alcohol (24: 1) of equal volume and centrifuged for 10 minutes. 9) The aqueous phase containing the DNA was transferred to a new tube. Then, DNA purification and ethanol precipitation were performed. 3, DNA purification and ethanol precipitation
The method comprises the following steps: 1) 1/10 volumes of 2mol/L sodium acetate and 2 volumes of cold 100% ethanol were added to the DNA solution and mixed well. Left at-20 ℃ for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) The pellet was washed with 500ul of 70% cold ethanol and centrifuged for 5 minutes. 5) Carefully aspirate or pour out the ethanol. The pellet was washed with 500ul cold ethanol and centrifuged for 5 minutes. 6) Carefully suck out or pour out the ethanol and invert it on absorbent paper to drain off the residual ethanol. Air-drying for 10-15 minutes to evaporate the surface ethanol. Care was taken not to completely dry the pellet, otherwise it was difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or blow with dropper while gradually increasing TE, mixing until DNA is fully dissolved, each 1-5 × 106Approximately 1ul of cell extract was added.
The following steps 8-13 are only used when the contamination has to be removed, otherwise step 14 can be performed directly. 8) RNase A was added to the DNA solution at a final concentration of 100ug/ml and incubated at 37 ℃ for 30 minutes. 9) SDS and proteinase K were added to final concentrations of 0.5% and 100ug/ml, respectively. Incubate at 37 ℃ for 30 minutes. 10) The reaction mixture was extracted with phenol, chloroform and isoamyl alcohol (25: 24: 1) at equal volumes and centrifuged for 10 minutes. 11) The aqueous phase was carefully removed, re-extracted with an equal volume of chloroform to isoamyl alcohol (24: 1), and centrifuged for 10 minutes. 12) The aqueous phase was carefully removed, 1/10 volumes of 2mol/L sodium acetate and 2.5 volumes of cold ethanol were added, mixed well and placed at-20 ℃ for 1 hour. 13) Washing the pellet with 70% ethanol and 100% ethanol, air drying, and resuspending the nucleic acids in the same manner as in steps 3-6. 14) Measurement A260And A280To check the purity and yield of DNA. 15) Subpackaging and storing at-20 ℃. Preparation of sample films:
1) 4X 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size were taken, and the spotting position and the number were lightly marked with a pencil, two pieces of NC membrane were required for each probe, so that the membranes were washed with high-intensity conditions and intensity conditions, respectively, in the following experimental steps.
2) Pipette 15. mu.l of each sample and control, spot onto the membrane, and dry at room temperature.
3) The resulting mixture was placed on a filter paper impregnated with 0.1mol/L NaOH and 1.5mol/L NaCl for 5 minutes (twice), air-dried, placed on a filter paper impregnated with 0.5mol/L Tris-HCl (pH7.0) and 3mol/L NaCl for 5 minutes (twice), and air-dried.
4) Clamping in clean filter paper, wrapping with aluminum foil, and vacuum drying at 60-80 deg.C for 2 hr.
Labeling of probes
1) Mu.l Probe (0.1 OD/10. mu.l), 2. mu.l Kinase buffer, 8-10 uCi. gamma. -32P-dATP +2UKinase, to a final volume of 20. mu.l.
2) Incubate at 37 ℃ for 2 hours.
3) Add 1/5 volumes of bromophenol blue indicator (BPB).
4) Passing through Sephadex G-50 column.
5) To have32The first peak (which can be monitored by Monitor) begins to collect before the P-Probe is washed out.
6)5 drops/tube, collect 10-15 tubes.
7) Monitoring isotope content with liquid scintillation meter
8) The collected liquid of the first peak is combined to obtain the product32P-Probe (second peak is free gamma-32P-dATP)。
Prehybridization
The membrane was placed in a plastic bag, 3-10mg of prehybridization solution (10 XDenhardt's; 6 XSSC, 0.1mg/ml CT DNA (calf thymus DNA)) was added, the bag was sealed, and shaken in a water bath at 68 ℃ for 2 hours.
Hybridization of
Cutting off a corner of the plastic bag, adding the prepared probe, sealing the bag opening, and then shaking overnight in a water bath at 42 ℃.
Washing the membrane: high-strength membrane washing:
1) and taking out the hybridized sample membrane.
2) Wash in 2 XSSC, 0.1% SDS at 40 ℃ for 15 min (2 times).
3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃.
4)0.1 XSSC, 0.1% SDS, washed at 55 ℃ for 30 minutes (2 times), and air-dried at room temperature. And (3) low-strength membrane washing:
1) and taking out the hybridized sample membrane.
2) Wash in 2 XSSC, 0.1% SDS at 37 ℃ for 15 min (2 times).
3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 37 ℃.
4)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃ and air-dried at room temperature.
X-ray self-development:
x-ray autoradiography (the tabletting time depends on the radioactivity of the hybridization spots) at-70 ℃.
The experimental results are as follows:
the hybridization experiment is carried out under the condition of low-strength membrane washing, and the radioactivity of the hybridization spots of the two probes is not obviously different; in the hybridization experiment performed under the high-intensity membrane washing condition, the radioactive intensity of the hybridization spot of the probe1 is obviously stronger than that of the other probe. Thus, probe1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of the present invention in different tissues. Example 8 DNA Microarray
The gene chip or gene Microarray is a new technology developed and developed by many national laboratories and major pharmaceutical companies, and it means that a large number of target gene fragments are orderly arranged on carriers such as glass, silicon and the like in high density, and then data comparison and analysis are performed by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information rapidly, efficiently and in high flux. The polynucleotide of the present invention can be used as a target DNA for gene chip technology for high-throughput research of new gene functions; searching and screening new tissue-specific genes, particularly new genes related to diseases such as tumor and the like; diagnosis of a disease, such as a genetic disease. The specific process steps have been reported in the literature, for example, in DeRisi, J.L., Lyer, V.&Brown, P.O. (1997) science278,680-686, and Helle, R.A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94:2150-
The total of 4000 different full-length cDNAs were used as target DNAs, including the polynucleotide of the present invention. They were amplified by PCR, the resulting amplification products were purified and then the concentration thereof was adjusted to about 500ng/ul, and spotted on a glass medium with a spotting instrument of Cartesian 7500 (from Cartesian, USA) at a distance of 280 μm from the spot. Hydrating and drying the spotted glass slide, placing the glass slide in an ultraviolet crosslinking instrument for crosslinking, eluting and drying the glass slide to fix the DNA on the glass slide to prepare the chip. The specific method steps are reported in the literature, and the sample application post-treatment steps in the embodiment are as follows:
1. hydrating in a humid environment for 4 hours;
2.0.2% SDS for 1 minute;
3．ddH2o washes twice, each for 1 minute;
4．NaBH4sealing for 5 minutes;
water at 5.95 ℃ for 2 minutes;
6.0.2% SDS for 1 minute;
7．ddH2flushing twice;
8. air-dried and stored in the dark at 25 ℃ for later use. (II) Probe labeling
Total mRNA was extracted from normal liver and liver cancer, respectively, by a one-step method, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen),mRNA of normal liver tissue was labeled with a fluorescent reagent Cy3dUTP (5-Amino-propyl-2 '-deoxyuridine 5' -triphosphate coupled to Cy3 fluorescent dye, respectively, purchased from Amersham pharmacia Biotech, Amersham pharmacia Biotech) by reverse transcription, mRNA of liver tissue was labeled with a fluorescent reagent Cy5dUTP (5-Amino-propyl-2 '-deoxyuridine 5' -triphosphate coupled to Cy5fluorescent dye, purchased from Amersham pharmacia Biotech), and mRNA of liver tissue was prepared after purification. The specific steps refer to and the method is as follows: schena, M., Shalon, D., Heller, R. (1996) Proc.Natl.Acad.Sci.USA.Vol.93:10614-10619.Schena, M., Shalon, Dari., Davis, R.W. (1995) science.270.(20):467-
Separately putting probes from the above two tissues together with the chip in UniHybTMHybridization was carried out in hybridization solution (available from TeleChem) for 16 hours, washed with washing solution (1 XSSC, 0.2% SDS) at room temperature, scanned with ScanArray 3000 scanner (available from General screening, USA), and the scanned images were subjected to data analysis using Imagene software (available from Biodiscovery, USA), and a ratio of Cy3/Cy5 was calculated for each spot, and a spot having a ratio of less than 0.5 and greater than 2 was considered to be a gene whose expression was differentiated. The experimental results show that the expression of the polynucleotide of the present invention in the above two tissues has no significant difference in Cy3 signal =10393.44 (averaged over four experiments), Cy5signal =9329.13 (averaged over four experiments), and Cy3/Cy5= 1.11408.
Sequence listing
(1) General information:
(ii) name of the invention: DNA polymerase 17 and its coding sequence
(iii) number of sequences: 9
(2) 1, SEQ ID NO:
sequence characteristics:
(A) length: 1891bp
(B) Type (2): nucleic acids
(C) Chain property: double chain
(D) Topological structure: linearity
(ii) type of molecule: cDNA
(xi) sequence description: SEQ ID NO 1: 1 ATTAAGATATGCTAGTTTTGTTTGTTTGTTTGCAACAGGGTCTTGCTCTGACATCCAGGC AAGTGCAGTGGCAGAATCATGGTTCACTGCAGCCTAGACCTTCCAGGCTCAAGCAATTCT CCTGCCTCAGCCTCCTGAGTACAGGTGCGTGCCACCACGCCCAGCTAACCCTTGTATTTT181 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG241 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 301 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 361 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 421 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 481 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 541 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 601 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 661 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 721 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 781 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 841 901 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 961 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1021 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1081 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1141 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1201 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1261 13272 1321 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1381 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1441 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1501 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1561 1621 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1681 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1741 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG 1803672 18672 TTGCAGAGACGGGGTCTCAATATGTTGCCCAGGCTGGTCTTGAACTCCTGGGCTCAAGTG
(3) Information of SEQ ID NO:2:
sequence characteristics:
(A) length: 152 amino acids
(B) Type (2): amino acids
(D) Topological structure: linearity
(ii) type of molecule: polypeptides
(xi) sequence description: SEQ ID NO 2: 1 Met Leu Val Leu Phe Val Cys Leu Gln Gln Gly Leu Ala Leu Thr 16 Ser Arg Gln Val Gln Trp Gln Asn His Gly Ser Leu Gln Pro Arg 31 Pro Ser Arg Leu Lys Gln Phe Ser Cys Leu Ser Leu Leu Ser Thr 46 Gly Ala Cys His His Ala Gln Leu Thr Leu Val Phe Phe Ala Glu 61 Thr Gly Ser Gln Tyr Val Ala Gln Ala Gly Leu Glu Leu Leu Gly 76 Ser Ser Asp Ser Pro Thr Ser Ala Ser Gln Gly Ile Gly Thr Thr 91 Gly Ile Ser His Gln Gly Gln Pro Arg Leu Leu Phe Val Tyr Gln106 Gln Leu His Leu Pro Asn Gly Lys Cys Thr Trp Val Ser Phe Gln121 Ala Trp Trp Phe Thr Pro Val Ile Pro Ala Pro Trp Glu Ala Glu136 Ala Gly Arg Ser Pro Glu Val Arg Ser Leu Ile Pro Ala Trp Pro151 Thr Trp
(4) Information of SEQ ID NO 3
Sequence characterization
(A) Length: 24 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: 3: ATTAAGATATGCTAGTTTTGTTTG 24 SEQ ID NO
(5) Information of SEQ ID NO 4
Sequence characterization
(A) Length: 24 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: SEQ ID NO 4: GAGAGTCTCACTCTGTCACCTAGG 24
(6) Information of SEQ ID NO 5
Sequence characterization
(A) Length: 34 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: SEQ ID NO 5: CCCCATATGATGCTAGTTTTGTTTGTTTGTTTGC 34
(7) Information of SEQ ID NO 6
Sequence characterization
(A) Length: 34 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: 6: CCCGAATTCTCACCAAGTTGGCCAGGCTGGTATC 34 SEQ ID NO
(8) Information of SEQ ID NO:7:
sequence characteristics:
(A) length: 15 amino acids
(B) Type (2): amino acids
(D) Topological structure: linearity
(ii) type of molecule: polypeptides
(xi) sequence description: 7 Met-Leu-Val-Leu-Phe-Val-Cys-Leu-Gln-Gln-Gly-Leu-Ala-Leu-Thr 15
(9) Information of SEQ ID NO 8
Sequence characterization
(A) Length: 41 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: 8: CCTGCCTCAGCCTCCTGAGTACAGGTGCGTGCCACCACGCC 41 SEQ ID NO
(10) Information of SEQ ID NO 9
Sequence characterization
(A) Length: 41 bases
(B) Type (2): nucleic acids
(C) Chain property: single strand
(D) Topological structure: linearity
(ii) type of molecule: oligonucleotides
(xi) sequence description: 9: CCTGCCTCAGCCTCCTGAGTATAGGTGCGTGCCACCACGCC 41 SEQ ID NO

Claims (18)

1. An isolated polypeptide-DNA polymerase 17 comprising: 2, or an active fragment, analogue or derivative of the polypeptide thereof.
2. The polypeptide of claim 1, wherein the amino acid sequence of said polypeptide, analog or derivative has at least 95% identity to the amino acid sequence set forth in SEQ ID No. 2.
3. The polypeptide according to claim 2, characterized in that it comprisesa polypeptide having the amino acid sequence shown in SEQ ID NO. 2.
4. An isolated polynucleotide, characterized in that the polynucleotide comprises one selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO.2 or a fragment, an analogue or a derivative thereof;
(b) a polynucleotide complementary to polynucleotide (a); or
(c) A polynucleotide sharing at least 70% identity to (a) or (b).
5. The polynucleotide of claim 4, wherein the polynucleotide comprises a polynucleotide encoding the amino acid sequence of SEQ ID No. 2.
6. The polynucleotide of claim 4, wherein the sequence of said polynucleotide comprises the sequence of positions 9-467 of SEQ ID NO. 1 or the sequence of positions 1-1891 of SEQ ID NO. 1.
7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant vector constructed from the polynucleotide of any one of claims 4 to 6 and a plasmid, virus or expression vector.
8. A genetically engineered host cell comprising an exogenous polynucleotide, wherein the genetically engineered host cell is selected from the group consisting of:
(a) a host cell transformed or transduced with the recombinant vector of claim 7; or
(b) A host cell transformed or transduced with a polynucleotide according to any one of claims 4 to 6.
9. A method for producing apolypeptide having DNA polymerase 17 activity, comprising:
(a) culturing the engineered host cell of claim 8 under conditions to express DNA polymerase 17;
(b) isolating the polypeptide having DNA polymerase 17 activity from the culture.
10. An antibody capable of binding to a polypeptide, wherein said antibody is an antibody capable of specifically binding to DNA polymerase 17.
11. A class of compounds that mimic or modulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize, or inhibit the activity of DNA polymerase 17.
12. The compound of claim 11, which is an antisense sequence to the polynucleotide sequence shown in SEQ ID No. 1 or a fragment thereof.
13. Use of a compound according to claim 11 for a method of modulating the activity of DNA polymerase 17 in vivo or in vitro.
14. A method for detecting a disease or a susceptibility to a disease associated with the polypeptide of any of claims 1-3, comprising detecting the amount of expression of the polypeptide, or detecting the activity of the polypeptide, or detecting a nucleotide variation in the polynucleotide that causes an abnormality in the amount of expression or activity of the polypeptide.
15. Use of a polypeptide according to any of claims 1 to 3 for screening for mimetics, agonists, antagonists or inhibitors of DNA polymerase 17; or for peptide fingerprinting.
16. Use of a nucleic acid molecule according to any of claims 4 to 6 as a primer in a nucleic acid amplification reaction, or as a probe in a hybridization reaction, or for the manufacture of gene chips or microarrays.
17. The use of the polypeptide, polynucleotide or compound of any of claims 1-6 and 11, wherein the polypeptide, polynucleotide or its mimetics, agonists, antagonists or inhibitors are used in a safe and effective amount in combination with a pharmaceutically acceptable carrier to form a pharmaceutical composition for the diagnosis or treatment of a disease associated with DNA polymerase 17 abnormalities.
18. Use of the polypeptide, polynucleotide or compound of any of claims 1-6 and 11, wherein said polypeptide, polynucleotide or compound is used for the preparation of a medicament for the treatment of, for example, malignant tumors, hematological disorders, HIV infection and immunological disorders and various types of inflammation.
CN 99125665 1999-12-21 1999-12-21 Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide Pending CN1300826A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN 99125665 CN1300826A (en) 1999-12-21 1999-12-21 Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide
AU19823/01A AU1982301A (en) 1999-12-21 2000-12-11 A novel polypeptide - dna polymerase 17 and the polynucleotide encoding the same
PCT/CN2000/000549 WO2001046244A1 (en) 1999-12-21 2000-12-11 A novel polypeptide - dna polymerase 17 and the polynucleotide encoding the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 99125665 CN1300826A (en) 1999-12-21 1999-12-21 Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide

Publications (1)

Publication Number Publication Date
CN1300826A true CN1300826A (en) 2001-06-27

Family

ID=5284079

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 99125665 Pending CN1300826A (en) 1999-12-21 1999-12-21 Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide

Country Status (3)

Country Link
CN (1) CN1300826A (en)
AU (1) AU1982301A (en)
WO (1) WO2001046244A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110256566A (en) * 2019-05-10 2019-09-20 江苏苏博生物医学科技南京有限公司 Taq archaeal dna polymerase single-chain immunoglobulins IgG antibody, preparation method and its application in Genotyping detection

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7236296A (en) * 1995-09-08 1997-03-27 Life Technologies, Inc. Cloned dna polymerases from thermotoga and mutants thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110256566A (en) * 2019-05-10 2019-09-20 江苏苏博生物医学科技南京有限公司 Taq archaeal dna polymerase single-chain immunoglobulins IgG antibody, preparation method and its application in Genotyping detection

Also Published As

Publication number Publication date
AU1982301A (en) 2001-07-03
WO2001046244A1 (en) 2001-06-28

Similar Documents

Publication Publication Date Title
CN1300826A (en) Polypeptide-DNA polymerase 17 and polynucleotide for coding this polypeptide
WO2001072786A1 (en) A novel polypeptide - tumor suppressor protein 63 and the polynucleotide encoding said polypeptide
CN1322825A (en) New polypeptide superoxide dismutase 11 and its encoding polynucleotides
CN1328150A (en) Polypeptide-human beta-glucosiduronatase 11.88 and polynucleotide for coding it
CN1307104A (en) Polypeptide-human phosphoenolpyruvate carboxylase 81 and polynucleotide for coding said polypeptide
CN1307130A (en) Polypeptide-xylose isomerase 43 and polynucleotide for coding said polypeptide
CN1301843A (en) New polypeptide-hydrogenase 9 and polynucleotide coding such polypeptide
CN1315528A (en) Polypeptide-human hydrogenase 10 and polynucleotide for coding it
CN1363665A (en) Polypeptide-superoxide dismutase 9.35 and polynucleotide for coding it
CN1333367A (en) Novel polypeptide--human beta-glucoronidase 26.29 and polynucleotide for encoding said polypeptide
CN1344800A (en) New polypeptide human phosphoglycerol diesterase 31.56 and polynucleotides encoding this polypeptide
WO2001049857A1 (en) A novel polypeptide, serine transhydroxymethylase 15 and the polynucleotide encoding the polypeptide
WO2001055404A1 (en) A novel polypeptide, a human alcohol dehydrogenase 39 and the polynucleotide encoding the polypeptide
WO2001073062A1 (en) Novel polypeptide--- a prostate specific membrane antigen 18 and polynucleotide encoding it
CN1364876A (en) New polypeptide-DNA polymerase 9.68 and polynucleotide for encoding such polyupeptide
WO2001046430A1 (en) A novel polypeptide, peroxidase 12 and the polynucleotide encoding the polypeptide
WO2001072980A1 (en) A new polypeptide- human peroxydase 18 and the polynucleotide encoding it
CN1363658A (en) Polypeptide-DNA polymerase 14.78 and polynucleotide for coding it
WO2001092541A1 (en) Novel polypeptide - a human hydrogen peroxidase 12 and polynucleotide encoding it
WO2001094371A1 (en) A novel peptide - human ribosomal protein s4-10 and the polynucleotide coding this novel peptide
WO2001090376A1 (en) Novel polypeptide - a human triose phosphate isomerase 11 and polynucleotide encoding it
CN1313394A (en) Polypeptide-DNA polymerase 10 and polynucleotide for coding it
WO2001053492A1 (en) A novel polypeptide, s-adenosylmethionine synthetase 31 and the polynucleotide encoding the polypeptide
WO2001072805A1 (en) A new polypeptide - human flavoprotein subunit 14.19 and the polynucleotide encoding it
WO2001075002A2 (en) A novel polypeptide, cellular cycle regulation gene 28 and the polynucleotide encoding the polypeptide

Legal Events

Date Code Title Description
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C06 Publication
PB01 Publication
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication