CN1328150A - Polypeptide-human beta-glucosiduronatase 11.88 and polynucleotide for coding it - Google Patents

Abstract

A novel polypeptide-human beta-glocosiduronidtase 11.88, the polynucleotide for coding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide in treating diseases such as pia tumor, HIV infection, etc., the antagonist said polypeptide and its medical action, and the application of said polynucleotide are disclosed.

Description

New polypeptide-human β -glucoronidase 11.88 and polynucleotide for encoding such polypeptide

The present invention belongs to the field of biotechnology, and is especially one new kind of polypeptide, human β -glucuronidase 11.88, and its encoding polynucleotides, preparation process and application.

Reaction of hydrolysis of glucoside to ethanol and glucuronic acid:

glucuronidase is a structural protein of the endoplasmic reticulum, and occurs in lysosomes when changes occur in the endoplasmic reticulum. [ Nature, 213, 457, 1967]

The enzyme is found in mammals and other vertebrates, mollusks such as snails, locusts, bacteria and plants, and is therefore a functionally well-conserved and important enzyme.

β -abnormal expression levels of glucuronidase lead to a number of diseases, for example, 75% of patients with leptomeningeal tumours (leptomeningeal adenocarinomas) show increased levels of this enzyme, and 25% of patients with myelogenous leukaemia (myelogenous leukamia) [ Mayo ClinProc 1985; 60: 293-8]also in acute and subacute bacteria, fungal meningitis and HIV-1 infections [ Lancet 1991; 337: 734-5]

On the other hand, the symptoms include mucopolysaccharidosis, hepatosplenomegaly and skeletal changes [ J.Pediat.82: 249-

Through gene chip analysis, it is found that in bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal Fibroblast 1024NC, Fibroplast, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar formation fc stimulation, 1013HC, bladder cancer established cell EJ, bladder cancer parabladder, bladder cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer, the expression profile of the polypeptide of the invention is very similar to that of human β -glucuronidase, therefore, the two functions can be similar, the invention is named as β -glucuronidase 11.88.

Since the human β -glucuronidase 11.88 protein plays an important role in regulating important functions of the body such as cell division and embryonic development as described above, and it is believed that a large number of proteins are involved in these regulation processes, there is a continuing need in the art to identify more of the human β -glucuronidase 11.88 protein involved in these processes, and in particular, to identify the amino acid sequence of this protein.

An object of the present invention is to provide an isolated novel polypeptide, human β -glucuronidase 11.88, and fragments, analogs and derivatives thereof.

Another objective of the invention is to provide a polynucleotide encoding the polypeptide.

Another objective of the invention is to provide a recombinant vector containing a polynucleotide encoding human β -glucuronidase 11.88.

It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human β -glucuronidase 11.88.

Another objective of the invention is to provide a method for producing human β -glucuronidase 11.88.

Another objective of the invention is to provide an antibody against the polypeptide of the invention, human β -glucuronidase 11.88.

Another objective of the invention is to provide mimetics, antagonists, agonists, and inhibitors for the polypeptide of the human β -glucuronidase 11.88.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human β -glucuronidase 11.88.

The present invention relates to an isolated polypeptide, which is of human origin, comprising: a polypeptide having the amino acid sequence of SEQ ID No.2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the sequence of SEQ ID NO: 2 amino acid sequence.

The present invention also relates to an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a);

(c) a polynucleotide sharing at least 70% identity with the polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) has the sequence shown in SEQ ID NO: the 570-896 position in 1; and (b) has the sequence of SEQ ID NO: 1-2365 in 1.

The present invention furthermore relates to a vector, in particular an expression vector, comprising a polynucleotide according to the invention; a host cell genetically engineered with the vector, including transformed, transduced or transfected host cells; a method for producing the polypeptide of the present invention comprising culturing the host cell and recovering the expression product.

The invention also relates to an antibody capable of specifically binding to the polypeptide of the invention.

The invention also relates to a method for screening compounds which mimic, activate, antagonize, or inhibit the activity of human β -glucuronidase 11.88 protein, comprising using the polypeptide of the invention.

The invention also relates to an in vitro method for detecting diseases or disease susceptibility related to abnormal expression of human β -glucuronidase 11.88 protein, which comprises detecting mutation in the polypeptide or its encoding polynucleotide sequence in a biological sample, or detecting the amount or biological activity of the polypeptide of the invention in the biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic, activator, antagonist or inhibitor thereof and a pharmaceutically acceptable carrier.

The invention also relates to the use of the polypeptide and/or polynucleotide of the invention in the preparation of a medicament for treating cancer, developmental diseases, immune diseases, or other diseases caused by abnormal expression of human β -glucuronidase 11.88.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure of the technology herein.

The following terms used in the specification and claims have the following meanings, unless otherwise specified:

"nucleic acid sequence" refers to an oligonucleotide, nucleotide or polynucleotide and fragments or portions thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing either the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof. When "amino acid sequence" in the present invention refers to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The alteration may comprise a deletion, insertion or substitution of an amino acid or a nucleotide in the amino acid sequence or the nucleotide sequence. Variants may have "conservative" changes, where the substituted amino acid has similar structural or chemical properties as the original amino acid, such as the substitution of isoleucine with leucine. Variants may also have non-conservative changes, such as replacement of glycine with tryptophan.

"deletion" refers to thedeletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

"insertion" or "addition" refers to a change in an amino acid sequence or nucleotide sequence resulting in an increase of one or more amino acids or nucleotides compared to the naturally occurring molecule. "substitution" refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides.

"biological activity" refers to a protein having the structural, regulatory, or biochemical functions of a native molecule. Similarly, the term "immunological activity" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

An "agonist" refers to a molecule that, when bound to human β -glucuronidase 11.88, causes the protein to change, thereby modulating the activity of the protein.

"antagonist" or "inhibitor" refers to a molecule that blocks or modulates the biological or immunological activity of human β -glucuronidase 11.88 when bound to human β -glucuronidase 11.88.

By "modulating" is meant an alteration of the function of human β -glucuronidase 11.88, including an increase or decrease in protein activity, an alteration in binding characteristics, and an alteration in any other biological, functional or immunological property of human β -glucuronidase 11.88.

One skilled in the art can purify human β -glucuronidase 11.88 using standard protein purification techniques, substantially pure human β -glucuronidase 11.88 can produce a single main band on a non-reducing polyacrylamide gel, the purity of the human β -glucuronidase 11.88 polypeptide can be analyzed using amino acid sequence.

"complementary" or "complementation" refers to the natural binding of polynucleotides by base pairing under the conditions of salt concentration and temperature allowed. For example, the sequence "C-T-G-A" may bind to the complementary sequence "G-A-C-T". The complementarity between the two single stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"homology" refers to the degree of complementarity, which may be partial or complete. "partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by hybridization (Southern blot or Northern blot) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes compete for and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, as the conditions of reduced stringency require specific or selective interaction of the two sequences with each other.

"percent identity" refers to the percentage of sequence identity or similarity in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as by the MEGALIGN program (Lasergenistein paper, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, D.G. and P.M. Sharp (1988) Gene 73: 237-. Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, suchas sequence A and sequence B, is calculated by the following formula:

number of residues matching between sequence A and sequence B100

Number of residues in sequence A-number of spacer residues in sequence B

The percent identity between nucleic acid sequences can also be determined by Cluster method or by Methods well known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-.

"similarity" refers to the degree of identical or conservative substitution of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; amino acids with uncharged head groups having similar hydrophilicity can include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

"derivative" refers to HFP or a chemical modification of the nucleic acid encoding it. Such chemical modification may be replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. The nucleic acid derivative may encode a polypeptide that retains the main biological properties of the native molecule.

"antibody" refers to intact antibody molecules and fragments thereof, e.g., Fa, F (ab')₂And Fv, which specifically binds to an antigenic determinant of human β -glucuronidase 11.88.

"humanized antibody" refers to an antibody in which the amino acid sequence of the non-antigen binding region has been replaced to more closely resemble that of a human antibody, but which retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (e.g., its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide is isolated from some or all of the materials with which it coexists in its natural system. Such polynucleotides may be part of a vector, or such polynucleotides or polypeptides may be part of a composition. Since the carrier or composition is not a component of its natural environment, it remains isolated.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated human β -glucuronidase 11.88" means that human β -glucuronidase 11.88 is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.

The present invention provides a novel polypeptide, human β -glucuronidase 11.88, consisting essentially of the amino acid sequence shown in SEQ ID NO.2, which can be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide, which can be a naturally purified product, or a chemically synthesized product, or produced using recombinant techniques from prokaryotic oreukaryotic hosts (e.g., bacterial, yeast, higher plant, insect, and mammalian cells).

The present invention also includes fragments, derivatives and analogs of human β -glucuronidase 11.88 as used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that retain substantially the same biological function or activity as human β -glucuronidase 11.88 of the present invention, fragments, derivatives or analogs of a polypeptide of the present invention can be (I) one in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues) and the substituted amino acid may or may not be encoded by a genetic codon, (II) one in which a group on one or more amino acid residues is substituted with another group comprising a substituent, (III) one in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, e.g., polyethylene glycol), or (IV) one in which additional amino acid sequences are fused to the mature polypeptide (such as a leader sequence or secretory sequence or a sequence used to purify the original polypeptide or a protein sequence) as set forth herein, derivatives and analogs of the art are considered to be within the scope of the present invention.

The present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2, the polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO: 1 the polynucleotide of the present invention is found in a cDNA library of human fetal brain tissue comprising a polynucleotide sequence of 2365 bases in full length and open reading frame 570-896 encoding 108 amino acids the human β -glucuronidase 11.88 is deduced to have a similar function as the human β -glucuronidase as found by gene chipexpression profile comparison.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to SEQ ID NO: 1, or a degenerate variant thereof. As used herein, "degenerate variant" means in the present invention a variant that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2, but is identical to the protein or polypeptide of SEQ ID NO: 1, or a variant thereof.

Encoding the amino acid sequence of SEQ ID NO: 2 comprises: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides encoding the polypeptide and polynucleotides including additional coding and/or non-coding sequences.

The present invention also relates to variants of the above-described polynucleotides which encode a polypeptide having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The invention also relates to polynucleotides (having at least 50%, preferably 70% identity between two sequences) which hybridize to the sequences described above. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 95% or more, preferably 97% or more. And, the polypeptide encoded by the hybridizable polynucleotide is complementary to the polypeptide of SEQ ID NO: 2 have the same biological functions and activities.

As used herein, a "nucleic acid fragment" is at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides in length, and can also be used in nucleic acid amplification techniques (e.g., PCR) to identify and/or isolate a polynucleotide encoding human β -glucuronidase 11.88.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The specific polynucleotide sequences of the present invention encoding human β -glucuronidase 11.88 can be obtained in a variety of ways, for example, polynucleotides can be isolated using hybridization techniques well known in the art, including, but not limited to, 1) hybridization of a probe to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleotide fragments with common structural features.

The DNA fragment sequences of the present invention can also be obtained by the following methods: 1) isolating double-stranded DNA sequences from genomic DNA; 2) chemically synthesizing a DNA sequence to obtain a double-stranded DNA of the polypeptide.

Among the above-mentioned methods, isolation of genomic DNA is least frequently used. Direct chemical synthesis of DNA sequences is a frequently used method. A more frequently used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that highly express the gene and reverse transcribe the mRNA to form a plasmid or phage cDNA library. There are a number of well-established techniques for extracting mRNA and kits are commercially available (Qiagene). The construction of cDNA libraries is also a common procedure (Sambrook, et al, molecular cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction techniques are used in combination, even very few expression products can be cloned.

The gene of the present invention can be screened from such cDNA libraries by conventional methods including, but not limited to, (1) DNA-DNA or DNA-RNA hybridization, (2) the presence or absence of marker gene function, (3) the determination of the level of human β -glucuronidase 11.88 transcript, (4) the detection of the protein product of gene expression by immunological techniques or by determination of biological activity.

In method (1), the probe used for hybridization is homologous to any portion of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. In addition,the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized on the basis of the sequence information of the gene of the present invention. The gene of the present invention itself or a fragment thereof can of course be used as a probe. The DNA probe may be labeled with a radioisotope, fluorescein or an enzyme (e.g., alkaline phosphatase), etc.

In method (4), the detection of the protein product expressed by the gene of human β -glucuronidase 11.88 can be carried out by immunological techniques such as Western blotting, radioimmunoassay, and enzyme-linked immunosorbent assay (ELISA).

A method of amplifying DNA/RNA using PCR technology (Saiki, et al, Science 1985; 230: 1350-. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the polynucleotide of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The polynucleotide sequences of the gene of the present invention obtained as described above, or various DNA fragments and the like can be determined by a conventional method such as the dideoxy chain termination method (Sanger et al, PNAS, 1977, 74: 5463-5467). Such polynucleotide sequencing may also be performed using commercial sequencing kits and the like. Sequencing was repeated to obtain a full-length cDNA sequence. Sometimes, it is necessary to sequence the cDNA of several clones to obtain the full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide ofthe present invention, a genetically engineered host cell transformed with the vector of the present invention or directly with the human β -glucuronidase 11.88 coding sequence, and a method for producing the polypeptide of the present invention by recombinant techniques.

The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.vectors suitable for use in the present invention include, but are not limited to, expression vectors based on the T7 promoter for expression in bacteria (Rosenberg, et al, Gene, 1987, 56: 125), pMSXND expression vectors for expression in mammalian cells (Lee and Nathans, J Bio chem. 263: 3521, 1988), and baculovirus-derived vectors for expression in insect cells.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequence encoding human β -glucuronidase 11.88 and appropriate transcription/translation regulatory elements, including in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like (Sambrook, et al, Molecular Cloning, aLaboratory Manual, cold Spring Harb)or laboratory, New York, 1989). The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; p of lambda phage_LA promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling the expression of genes in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. The insertion of enhancer sequences into vectors will enhance transcription in higher eukaryotic cells. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli, and the like.

It will be clear to one of ordinary skill in the art how to select the appropriate vector/transcriptional regulatory element (e.g., promoter, enhancer, etc.) and selectable marker gene.

In the present invention, the polynucleotide encoding human β -glucuronidase 11.88 or the recombinant vector containing the polynucleotide may be transformed or transduced into a host cell to construct a genetically engineered host cell containing the polynucleotide or the recombinant vector, the term "host cell" refers to a prokaryotic cell, such as a bacterial cell, or a lower eukaryotic cell, such as a yeast cell, or a higher eukaryotic cell, such as a mammalian cell, representative examples are Escherichia coli, Streptomyces, a bacterial cell, such as Salmonella typhimurium, a fungal cell, such as yeast, a plant cell, an insect cell, such as Drosophila S2 or Swef 9, an animal cell, such as a CHO, COS, or Bos melanoma cell, and the like.

Transformation of a host cell with a DNA sequence according to the invention or a recombinant vector containing said DNA sequence may be carried out by conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Alternatively, MgCl is used₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, or conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, and the like.

The recombinant human β -glucuronidase 11.88(Science, 1984; 224: 1431) can be expressed or produced by conventional recombinant DNA techniques using the polynucleotide sequences of the invention, generally by the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding human β -glucuronidase 11.88, or with a recombinant expression vector comprising the polynucleotide;

(2) culturing the host cell in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In step (2), the medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

In step (3), the recombinant polypeptide may be encapsulated in the cell, or expressed on the cell membrane, or secreted out of the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting-out method), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations thereof.

The polypeptide of the present invention and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating diseases, such as malignant tumors, adrenal gland deficiency, skin diseases, various inflammations, HIV infection, immunological diseases, etc.

A glucuronidase, a structural protein of the endoplasmic reticulum, catalyzes the hydrolysis of β -D-glucuronide to ethanol and glucuronic acid. β -glucuronidase expression level abnormalities can lead to a number of diseases.for example, 75% of patients with leptomeningeal tumors (leptomeningeal adnociceps) show increased levels of the enzyme, and 25% of patients with myelogenous leukemia (myelogenous leukemia) [ Mayo Clin Proc 1985; 60: 293-8]can also show increased levels of the enzyme in acute and subacute bacteria, fungal meningitis, and HIV-1 infections.on the other hand, a glucuronidase deficiency when it is absent can lead to a deficiency of the enzyme, symptoms of which include mucopolysaccharidosis, hepatosplenomegaly, and skeletal changes. β -glucuronidase deficiency can also cause edema.A spectrum of expression of a polypeptide of the present invention is consistent with that of a human β -glucuronidase, and similar functions of the expressed polypeptide of the present invention, including but not limited to the presence of abnormal activity of a polypeptide:

various leptomeningeal tumors, various lymphohematopoietic tumors (malignant lymphomas [ cervical, mediastinal, mesenteric and retroperitoneal lymph nodes], various leukemias [ lymphohematopoietic tissues], multiple myelomas [ vertebral/thoracic/costal/cranial and long bone], etc.), various bacterial, fungal meningitis (epidemic encephalitis, cryptococcal meningitis, etc.), HIV infection, fetal edema, etc.;

the polypeptide and the antagonist, the agonist and the inhibitor of the polypeptide can be directly used for treating various diseases, such as leptomeningeal membrane tumor, lymphohematopoietic tissue tumor, bacterial and fungal meningitis, HIV infection, fetal edema and the like.

The present invention also provides methods of screening compounds to identify agents that increase (agonists) or suppress (antagonists) human β -glucuronidase 11.88 agonists increase biological functions of human β -glucuronidase 11.88 in stimulating cell proliferation, while antagonists prevent and treat disorders associated with excessive cell proliferation such as various cancers, for example, mammalian cells or membrane agents expressing human β -glucuronidase 11.88 can be cultured with labeled human β -glucuronidase 11.88 in the presence of a drug, and the ability of the drug to increase or suppress this interaction is then determined.

The antagonist of human β -glucuronidase 11.88 includes screened antibody, compound, receptor deletion substance and analogue, etc. the antagonist of human β -glucuronidase 11.88 can combine with human β -glucuronidase 11.88 and eliminate the function of the human, or inhibit the production of the polypeptide, or combine with the active site of the polypeptide to make the polypeptide unable to exert biological function.

In screening for compounds that are antagonists, human β -glucuronidase 11.88 can be added to a bioanalytical assay to determine whether a compound is an antagonist by determining the effectof the compound on the interaction between human β -glucuronidase 11.88 and its receptor.

The present invention provides methods for producing antibodies using polypeptides, and fragments, derivatives, analogs, or cells thereof, as antigens, which antibodies may be polyclonal or monoclonal antibodies, antibodies directed against the epitope of human β -glucuronidase 11.88, including, but not limited to, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by a Fab expression library.

The production of polyclonal antibodies can be achieved by direct injection of human β -glucuronidase 11.88 into immunized animals (e.g., rabbits, mice, rats, etc.), and various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc. techniques for preparing monoclonal antibodies to human β -glucuronidase 11.88 include but are not limited to hybridoma technique (Kohler and Milstein. Nature, 1975, 256: 495-497), trioma technique, human B-cell hybridoma technique, EBV-hybridoma technique, etc. chimeric antibodies that bind human constant regions to non-human variable regions can be produced using established techniques (Morrison et al, PNAS, 1985, 81: 6851) while existing techniques for producing single-chain antibodies (U.S. Pat No.4946778) can also be used to produce single-chain antibodies to human β -glucuronidase 11.88.

The antibody against human β -glucuronidase 11.88 can be used in immunohistochemical technique to detect human β -glucuronidase 11.88 in biopsy specimens.

The monoclonal antibody combined with human β -glucuronidase 11.88 can also be labeled by radioactive isotope, and injected into body to trace its position and distribution.

A typical approach is to use a sulfhydryl cross-linking agent such as SPDP to attack theamino groups of the antibody and to bind the toxin to the antibody by exchange of disulfide bonds, and this hybrid antibody can be used to kill cells that are positive for human β -glucuronidase 11.88.

The antibody of the invention can be used for treating or preventing diseases related to human β -glucuronidase 11.88. the generation or activity of human β -glucuronidase 11.88 can be stimulated or blocked by the administration of proper dose of the antibody.

The present invention also relates to diagnostic assays for quantitative and positional determination of human β -glucuronidase 11.88 levels, these assays are well known in the art and include FISH assays and radioimmunoassays the levels of human β -glucuronidase 11.88 detected in the assay can be used to explain the importance of human β -glucuronidase 11.88 in various diseases and to diagnose diseases in which human β -glucuronidase 11.88 plays a role.

The polypeptides of the invention may also be used for peptide profiling, for example, where the polypeptides may be specifically cleaved by physical, chemical or enzymatic means and subjected to one or two or three dimensional gel electrophoresis analysis, preferably mass spectrometry.

A recombinant gene therapy vector (e.g., a viral vector) can be designed to express variant human β -glucuronidase 11.88 to inhibit endogenous human β -glucuronidase 11.88 activity.for example, a variant human β -glucuronidase 11.88 can be shortened, lacking a signaling domain, can bind to a downstream substrate, but lacks signaling activity.thus, the recombinant gene therapy vector can be used to treat a disease caused by expression or abnormal activity of human β -glucuronidase 11.88.A viral-derived expression vector such as a retrovirus, adenovirus-related virus, herpes simplex virus, parvovirus β -3588 can be used to transfer a polynucleotide encoding ahuman sambazase 11.88 into a recombinant vector (e.g., a recombinant polynucleotide encoding human glucuronidase 11.88) that can be used to transfer a polynucleotide encoding human β -glucuronidase 11.88 into a cell-carrying a recombinant polynucleotide encoding human glucuronidase 11.88 (e.e.88) for example, a recombinant polynucleotide encoding human glucuronidase 11.88, such as a retrovirus, adenovirus-related virus, herpes simplex virus, parvovirus β -3588, and the like can be used to construct a recombinant polynucleotide encoding human glucuronidase 11.88.

The method for introducing the polynucleotide into the tissue or the cell comprises: injecting the polynucleotide directly into the in vivo tissue; or introducing the polynucleotide into cells in vitro via a vector (e.g., a virus, phage, or plasmid), and then transplanting the cells into the body.

An oligonucleotide (including antisense RNA and DNA) for inhibiting human β -glucuronidase 11.88 mRNA and a ribozyme are also within the scope of the present invention, the ribozyme is an enzyme-like RNA molecule capable of specifically cleaving a specific RNA by means of an endonuclease action upon specific hybridization of the ribozyme molecule with a complementary target RNA, the antisense RNA and DNA and ribozyme are obtained by any known RNA or DNA synthesis technique, such as the solid phase phosphoramidite chemical synthesis method for oligonucleotide synthesis, and the antisense RNA molecule is obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.

A polynucleotide encoding human β -glucuronidase 11.88 can be used for diagnosing diseases related to human β -glucuronidase 11.88, a polynucleotide encoding human β -glucuronidase 11.88 can be used for detecting whether the human β -glucuronidase 11.88 is expressed or not or abnormal expression of the human β -glucuronidase 11.88 under the disease state, for example, a DNA sequence encoding human β -glucuronidase 11.88 can be used for hybridizing a biopsy specimen to judge the expression condition of the human β -glucuronidase 11.88, hybridization technologies comprise a Southern blotting method, a Northern blotting method, an in situ hybridization and the like, the technical methods are all open mature technologies, related kits are all available from the commercial sources, a part or all of the polynucleotide of the invention can be used as a probe to be fixed on a Microarray (Microarray) or a DNA chip (also called a "gene chip") and used for analyzing the differential expression of genes in tissues and gene diagnosis, and a primer β -glucuronidase 11.88 can be used for carrying out in vitro amplification of a human glucoside-specific RNA polymerase chain reaction product (RT-3688).

The detection of mutation in the human β -glucuronidase 11.88 gene can also be used to diagnose diseases associated with human β -glucuronidase 11.88 mutation forms of human β -glucuronidase 11.88 mutation include point mutation, translocation, deletion, recombination and any other abnormalities compared with the normal wild-type human β -glucuronidase 11.88 DNA sequence.

The sequences of the invention are also valuable for chromosome identification. The sequence will be specific for a particular location on a human chromosome and will hybridize to it. Currently, there is a need to identify specific sites on each gene on the chromosome. Currently, only few chromosomal markers based on actual sequence data (repeat polymorphisms) are available for marking chromosomal locations. According to the present invention, the first step important in correlating these sequences with disease-associated genes is the mapping of these DNA sequences to chromosomes.

Briefly, PCR primers (preferably 15-35bp) are prepared from the cDNA and the sequence can be mapped to the chromosome. These primers were then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

The PCR mapping method of somatic cell heterozygous cell is a rapid method for mapping DNA to specific chromosome. Using the oligonucleotide primers of the present invention, sublocalization can be achieved using a panel of fragments from a particular chromosome or a large number of genomic clones by similar methods. Other similar strategies that can be used for chromosome mapping include in situ hybridization, prescreening with labeled flow sorted chromosomes, and preselection by hybridization to construct chromosome-specific cDNA libraries.

Fluorescence In Situ Hybridization (FISH) of cDNA clones to metaphase chromosomes allows accurate chromosomal location in one step. For a review of this technology, see Verma et al, Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence is located at an exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. These data can be found, for example, in V.Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). The relationship between the gene and the disease that has been mapped to the chromosomal region can then be determined by linkage analysis.

Next, it is necessary to determine the differences in cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals, but not in any normal individuals, then the mutation may be the cause of the disease. Comparing diseased and non-diseased individuals generally involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible from the chromosomal level or detectable using PCR based cDNA sequences. Based on the resolution of current physical mapping and gene mapping techniques, cDNAs that are precisely mapped to chromosomal regions associated with disease can be one of 50 to 500 potential disease-causing genes (assuming 1 megabase mapping resolution and one gene per 20 kb).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the invention may be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and a carrier and an excipient which do not affect the effect of the medicine. These compositions can be used as medicaments for the treatment of diseases.

The invention also provides a kit or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Along with these containers, there may be an instructional cue given by a governmental regulatory agency that regulates the manufacture, use or sale of pharmaceuticals or biological products, which cue reflects approval by the governmental agency of manufacture, use or sale for human administration. In addition, the polypeptides of the invention may be used in combination with other therapeutic compounds.

The human β -glucuronidase 11.88 is administered in an amount effective to treat and/or prevent a particular indication, the amount and range of amounts of human β -glucuronidase 11.88 administered to a patient will depend on a number of factors, such as the mode of administration, the health condition of the subject to be treated, and the judgment of the diagnostician.

The following drawings are included to illustrate specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison graph of gene chip expression profiles of β -glucuronidase 11.88 and β -glucuronidase of the present inventors, wherein the upper graph is a broken square graph of an expression profile of β -glucuronidase 11.88 of human being, and the lower sequence is a broken square graph of an expression profile of β -glucuronidase of human being, wherein 1-bladder mucosa, Ecv304 cell line of 2-PMA +, Ecv304 cell line thymus of 3-LPS +, 4-normal Fibroblast 1024NC, 5-Fibroplast, growth factor stimulation, 1024NT, 6-scar formation fc growth factor stimulation, 1013HT, 7-scar formation fc are not stimulated by growth factors, 1013, 8-bladder cancer established cell line EJ, 9-parabladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetal cortex, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17-phylum cancer.

FIG. 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human β -glucuronidase 11.88, 12kDa is the molecular weight of the protein, and the arrow indicates the isolated protein band.

The invention is further illustrated by the following examples, which are intended to be purely exemplary and are not intended to limit the scope of the invention the experimental procedures, for which specific conditions are not indicated in the following examples, are generally performed according to conventional conditions, such as those described in Sambrook et al, molecular cloning, A Laboratory Manual (New York: Cold spring Harbor Laboratory Press, 1989), or according to conditions recommended by the manufacturer, example 1, cloning of human β -glucuronidase 11.88

Extraction of human fetal brain Total RNA by the one-step method with guanidinium isothiocyanate/phenol/chloroform-Isolation of poly (A) mRNA.2ug poly (A) from Total RNA by reverse transcription with Quik mRNA Isolation Kit (Qiagene products) to form cDNA. cDNA fragments are directionally inserted into the multiple cloning site of pBSK (+) vector (Clontech) using Smart cDNA cloning Kit (purchased from Clontech), transformation of DH5 α, formation of cDNA library by bacteria comparison of 5 'and 3' end sequences of all clones using Dyetermate cycle sequencing Kit (Perkin-Elmer products) and ABI 377 automatic sequencer (Perkin-Elmer products). The comparison of the determined cDNA sequences with the existing public DNA sequence database (Genebank) revealed that the cDNA sequence of one of clones 0789B07 is the novel DNA.the inserted cDNA fragment is synthesized by a series of primers, the determination of the full-length cDNA fragment of this clone 0789B is found to be the full-length cDNA sequence of the clone No. 7-DNA of the gene coding for the protein found by the open reading of the cDNA sequence of the clone No. 7-DNA found in the open-cDNA clone No. 7-DNA sequence of the open-cDNA clone No. 7-bp-7-cDNA clone (cDNA) and the open-coding sequence of the open-coding sequence of the human glucoside protein (cDNA coding sequence of the gene coding sequence of the clone No. 7-cDNA coding sequence of the gene is found in the same) as shown in the same as shown in the sequence of the sequence

cDNA was synthesized by reverse transcription using total fetal brain cell RNA as a template and oligo-dT as a primer, purified using Qiagene's kit, and then amplified by PCR using the following primers:

Primerl：5’-CAAGGTTAGAAGCAAGGAAGCAAG-3’(SEQ ID NO：3)

Primer2：5’-CTTACTAAAGTTTATTAAGTACAA-3’(SEQ ID NO：4)

primerl is a peptide located in SEQ ID NO: 1, 1bp starting forward sequence at the 5' end of the sequence;

primer2 is SEQ ID NO: 1, and a 3' terminal reverse sequence.

Conditions of the amplification reaction: 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl in a reaction volume of 50. mu.l₂200. mu. mol/L dNTP, 10pmol primer, and 1U of Taq DNA polymerase (product of Clontech). The reaction was carried out on a DNA thermal cycler of the type PE9600 (Perkin-Elmer Co.) for 25 cycles under the following conditions: 94 ℃ for 30 sec; 5530sec at 72 ℃ for 2min, β -actin was set as a positive control and a blank template was set as a negative control in RT-PCR the amplified product was purified using QIAGEN's kit and ligated to pCR vector (Invitrogen) using TA cloning kit, DNA sequence analysis showed that the DNA sequence of the PCR product was identical to 1-2365bp shown in SEQ ID NO: 1. example 3 Northern blotting analysis of expression of human β -glucuronidase 11.88 gene:

total RNA extraction by one-step method [ anal. Biochem 1987, 162, 156-]The method comprises acidic guanidinium thiocyanate phenol-chloroform extraction of tissue homogenized with 4M guanidinium isothiocyanate-25 mM sodium citrate, 0.2M sodium acetate (pH4.0), addition of 1 volume phenol and 1/5 volumes chloroform-isoamyl alcohol (49: 1), mixing, centrifugation, aspiration of the aqueous layer, addition of isopropanol (0.8 volume) and centrifugation of the mixture to obtain an RNA precipitate, washing of the RNA precipitate with 70% ethanol, drying and dissolving in water, electrophoresis with 20. mu.g of RNA on a 1.2% agarose gel containing 20mM 3- (N-morpholino) propanesulfonic acid (pH7.0) -5mM sodium acetate-1 mM EDTA-2.2M formaldehyde, transfer to nitrocellulose membrane α -³²preparation of p dATP by random primer method³²The DNA probe used was thePCR-amplified human β -glucuronidase 11.88 coding region sequence (570bp to 896bp) shown in FIG. 1, 32P-labeled probe (about 2X 10 bp)⁶cpm/ml) was hybridized with RNA-transferred nitrocellulose membrane overnight at 42 ℃ in a solution containing 50% formamide-25 mM KH₂PO₄(pH7.4) -5 XSSC-5 XDenhardt's solution and 200. mu.g/ml salmon sperm DNA after hybridization, the filters were washed in 1 XSSC-0.1% SDS at 55 ℃ for 30min, then analyzed and quantified using a Phosphor Imager example 4 in vitro expression, isolation and purification of recombinant human β -glucuronidase 11.88

According to SEQ ID NO: 1 and the sequence of a coding region shown in figure 1, a pair of specific amplification primers is designed, and the sequence is as follows:

Primer3：5’-CATGCTAGCATGCATTTAACTCATATATGTAGA-3’(Seq ID No：5)

Primer4：5’-CATGGATCCTTACACTTCTAATTGAAAATTTGA-3’(Seq ID No：6)

the 5 ' ends of these two primers contain NheI and BamHI cleavage sites, respectively, followed by coding sequences at the 5 ' end and 3 ' end of the gene of interest, respectively, and the NheI and BamHI cleavage sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28B (+) (Novagen, Cat. No. 69865.3.) PCR reactions were carried out using pBS-0789B07 plasmid containing the full length gene of interest as a template under conditions of 10pmol of pBS-0789B07 plasmid, Primer-3 and Primer-4, respectively, 10pmol of Advantage polymerase Mix (Clontech) in a total volume of 50. mu.l, 1. mu.l of cycle parameters: 94. 20s, 60. C30 s, 68. C2 min, 25 cycles, double digestion of NheI and BamHI amplified product and plasmid pET-28(+) in a total volume of 50. mu.l, respectively, and large fragments were recovered and ligated with a sequencing enzyme, the DNA of 30s, the DNA fragment of DNA obtained by sequencing, the DNAligation, the DNA fragment of the DNA of interest was transferred to a DNA of the DNA of interest was obtained by the DNA of interest, the DNA of the DNA

The following human β -glucuronidase 11.88-specific polypeptides were synthesized using a polypeptide synthesizer (product of PE Co.):

NH2-Met-His-Leu-Thr-His-Ile-Cys-Arg-Leu-Phe-Asn-Leu-Ile-Tyr-Ala-COOH (SEQ ID NO: 7) by conjugating the polypeptide to hemocyanin and bovine serum albumin, respectively, using Avrameas, et al, Immunochemistry, 1969, 6: 43, immunizing a rabbit with 4mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, boosting the immunization once with the hemocyanin polypeptide complex plus incomplete Freund's adjuvant after 15 days, using a titer plate coated with 15. mu.g/ml bovine serum albumin polypeptide complex as ELISA to determine the antibody titer in the rabbit serum, separating total IgG from the antibody-positive rabbit serum with protein A-Sepharose, binding the polypeptide to Sepharose4B column activated with cyanogen bromide, separating the anti-polypeptide antibody from the total IgG by affinity chromatography, specifically binding the antibody purified by immunoprecipitation to human β -glucoside 11.88, using the polynucleotide of the present invention as a hybridization probe

The selection of suitable oligonucleotide fragments from the polynucleotide of the present invention can be used as hybridization probes for identifying whether they contain the polynucleotide sequence of the present invention and detecting homologous polynucleotide sequences, and for detecting whether the expression of the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathological tissue cells is abnormal.

The purpose of this example is to determine the expression of the polynucleotide of the invention, SEQ IDNO: 1 as a hybridization probe, and identifying whether some tissues contain the polynucleotide sequence of the present invention or its homologous polynucleotide sequence by filter hybridization. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and replica methods, all of which are methods in which a polynucleotide sample to be tested is immobilized on a filter and then hybridized by substantially the same procedure. These same steps are: the filter on which the sample is immobilized is first prehybridized with a hybridization buffer that does not contain a probe so that the nonspecific binding sites of the sample on the filter are saturated with the support and synthetic polymer. The prehybridization buffer is then replaced with a hybridization buffer containing labeled probes and incubated to allow hybridization of the probes to the target nucleic acids. Following the hybridization step, unhybridized probes are removed by a series of membrane washing steps. This example utilizes higher intensity membrane wash conditions (e.g., lower salt concentration and higher temperature) to reduce hybridization background and retain only a highly specific signal. The probes selected for this embodiment include two types: the first type of probe is a probe that is fully homologous to the polynucleotide of the invention, SEQ ID NO: 1 identical or complementary oligonucleotide fragments; the second type of probe is a probe that partially hybridizes to the polynucleotide of the invention of SEQ ID NO: 1 identical or complementary oligonucleotide fragments. In this embodiment, the dot blot method is used to fix the sample on the filter membrane, and the hybridization specificity of the first type probe and the sample is the strongest and is retained under the condition of higher-strength membrane washing. First, selection of probe

The polynucleotide of the invention is selected from the polynucleotides SEQ ID NO: 1, the following principles and severalaspects to be considered should be followed:

1, the size of the probe is preferably 18-50 nucleotides;

2, the GC content is 30-70%, and when the GC content exceeds the GC content, non-specific hybridization is increased;

3, no complementary region should be arranged in the probe;

4, the probe meeting the above conditions can be used as a primary selection probe, and then further computer sequence analysis is carried out, wherein the primary selection probe is respectively compared with the sequence region (namely SEQ ID NO: 1) of the primary selection probe and other known genome sequences and complementary regions thereof for homology, and if the homology of the primary selection probe with the non-target molecule region is more than 85 percent or more than 15 continuous bases are completely identical, the primary selection probe is not generally used;

whether the initially selected probe is finally selected as a probe having practical application value should be further determined by experiments.

After the above analysis, the following two probes were selected and synthesized:

probe 1 (probe), belonging to the first category of probes, hybridizes with SEQ ID NO: 1 (41 Nt):

5’-TGCATTTAACTCATATATGTAGACTTTTCAACTTAATCTAT-3’(SEQ ID NO：8)

probe 2(probe2), belonging to the second class of probes, corresponds to SEQ ID NO: 1 or a complementary fragment thereof (41 Nt):

5’-TGCATTTAACTCATATATGTCGACTTTTCAACTTAATCTAT-3’(SEQ ID NO：9)

for other common reagents and their formulation methods not listed in connection with the following specific experimental procedures, reference is made to the literature: DNA PROBESg.h.keller; man ak, m.m.manak; stockton Press, 1989(USA) and more generally books of molecular cloning, A laboratory Manual, scientific Press, molecular cloning, A guide to molecular cloning (second edition 1998) [ U.S.]SammBruk et al.

Sample preparation: 1, extraction of DNA from fresh or frozen tissue

The method comprises the following steps: 1) fresh or freshly thawed normal liver tissue is placed in a dish soaked on ice and containing Phosphate Buffered Saline (PBS). The tissue is cut into small pieces with scissors or a scalpel. Tissue should be kept moist during the procedure. 2) The minced tissue was centrifuged at 1000g for 10 minutes. 3) The slurry was homogenized with cold homogenization buffer (0.25mol/L sucrose; 25mmol/LTris-HCl, pH 7.5; 25 mmol/LnaCl; 25mmol/L MgCl₂) The pellet was suspended (approximately 10 ml/g). 4) The tissue suspension was homogenized at full speed with an electric homogenizer at 4 ℃ until the tissue was completely disrupted. 5) Centrifuge at 1000g for 10 min. 6) Resuspend the cell pellet (1-5 ml per 0.1g of initial tissue sample) and centrifuge at 1000g for 10 min. 7) The pellet was resuspended in lysis buffer (1 ml per 0.1g of initial tissue sample) and then subjected to the following phenol extraction procedure. 2, phenol extraction of DNA

The method comprises the following steps: 1) cells were washed with 1-10ml cold PBS and centrifuged at 1000g for 10 min. 2) Resuspending the pelleted cells with Cold cell lysate (1X 10)⁸Cells/ml) a minimum of 100ul lysis buffer was used. 3) Adding SDS to a final concentration of 1%, if SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and overall yield is reduced. This is at extraction>10⁷Cells are particularly severe. 4) Proteinase K was added to a final concentration of 200 ug/ml. 5) The reaction was incubated at 50 ℃ for 1 hour or shaken gently overnight at 37 ℃. 6) Extracting with equal volume of phenol, chloroform and isoamyl alcohol (25: 24: 1), centrifuging in a small centrifuge tubeFor 10 minutes. The two phases are clearly separated, otherwise centrifugation is carried out again. 7) The aqueous phase was transferred to a new tube. 8) Extracted with chloroform isoamyl alcohol (24: 1) of equal volume and centrifuged for 10 minutes. 9) The aqueous phase containing the DNA was transferred to a new tube. Then, DNA purification and ethanol precipitation were performed. 3, DNA purification and ethanol precipitation

The method comprises the following steps: 1) 1/10 volumes of 2mol/L sodium acetate and 2 volumes of cold 100% ethanol were added to the DNA solution and mixed well. Left at-20 ℃ for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) The pellet was washed with 500ul of 70% cold ethanol and centrifuged for 5 minutes. 5) Carefully aspirate or pour out the ethanol. The pellet was washed with 500ul cold ethanol and centrifuged for 5 minutes. 6) Carefully suck out or pour out the ethanol and invert it on absorbent paper to drain off the residual ethanol. Air-drying for 10-15 minutes to evaporate the surface ethanol. Care was taken not to completely dry the pellet, otherwise it was difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or blow with dropper while gradually increasing TE, mixing until DNA is fully dissolved, each 1-5 × 10⁶Approximately 1ul of cell extract was added.

The following steps 8-13 are only used when the contamination has to be removed, otherwise step 14 can be performed directly. 8) RNase A was added to the DNA solution at a final concentration of 100ug/ml and incubated at 37 ℃ for 30 minutes. 9) SDS and proteinase K were added to final concentrations of 0.5% and 100ug/ml, respectively. Incubate at 37 ℃ for 30 minutes. 10) The reaction mixture was extracted with phenol, chloroform and isoamyl alcohol (25: 24: 1) at equal volumes and centrifuged for 10 minutes. 11) The aqueous phase was carefully removed, re-extracted with an equal volume of chloroform to isoamyl alcohol (24: 1), and centrifuged for 10 minutes. 12) The aqueous phase was carefully removed, 1/10 volumes of 2mol/L sodium acetate and 2.5 volumes of cold ethanol were added, mixed well and placed at-20 ℃ for 1 hour. 13) Washing the pellet with 70% ethanol and 100% ethanol, air drying, and resuspending the nucleic acids in the same manner as in steps 3-6. 14) Measurement A₂₆₀And A₂₈₀To check the purity and yield of DNA. 15) Subpackaging and storing at-20 ℃. Preparation of sample films:

1) 4X 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size were taken, and the spotting position and the number were lightly marked with a pencil, two pieces of NC membrane were required for each probe, so that the membranes were washed with high-intensity conditions and intensity conditions, respectively, in the following experimental steps.

2) Pipette 15. mu.l of each sample and control, spot onto the membrane, and dry at room temperature.

3) The resulting mixture was placed on a filter paper impregnated with 0.1mol/L NaOH and 1.5mol/L NaCl for 5 minutes (twice), air-dried, placed on a filter paper impregnated with 0.5mol/L Tris-HCl (pH7.0) and 3mol/L NaCl for 5 minutes (twice), and air-dried.

4) Clamping in clean filter paper, wrapping with aluminum foil, and vacuum drying at 60-80 deg.C for 2 hr.

Labeling of probes

1) Mu.l Probe (0.1 OD/10. mu.l), 2. mu.l Kinase buffer, 8-10 uCi. gamma. -³²P-dATP +2UKinase, to a final volume of 20. mu.l.

2) Incubate at 37 ℃ for 2 hours.

3) Add 1/5 volumes of bromophenol blue indicator (BPB).

4) Passing through Sephadex G-50 column.

5) To have³²The first peak (which can be monitored by Monitor) begins to collect before the P-Probe is washed out.

6)5 drops/tube, collect 10-15 tubes.

7) Monitoring isotope content with liquid scintillation meter

8) The collected liquid of the first peak is combined to obtain the product³²P-Probe (second peak is free gamma-³²P-dATP)。

Prehybridization

The membrane was placed in a plastic bag, 3-10mg of prehybridization solution (10 XDenhardt's; 6 XSSC, 0.1mg/ml CT DNA (calf thymus DNA)) was added, the bag was sealed, and shaken in a water bath at 68 ℃ for 2 hours.

Hybridization of

Cutting off a corner of the plastic bag, adding the prepared probe, sealing the bag opening, and then shaking overnight in a water bath at 42 ℃.

Washing the membrane: high-strength membrane washing:

1) and taking out the hybridized sample membrane.

2) Wash in 2 XSSC, 0.1% SDS at 40 ℃ for 15 min (2 times).

3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃.

4)0.1 XSSC, 0.1% SDS, washed at 55 ℃ for 30 minutes (2 times), and air-dried at room temperature. And (3) low-strength membrane washing:

1) and taking out the hybridized sample membrane.

2) Wash in 2 XSSC, 0.1% SDS at 37 ℃ for 15 min (2 times).

3)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 37 ℃.

4)0.1 XSSC, 0.1% SDS, for 15 minutes (2 times) at 40 ℃ and air-dried at room temperature.

X-ray self-development:

x-ray autoradiography (the tabletting time depends on the radioactivity of the hybridization spots) at-70 ℃.

The experimental results are as follows:

the hybridization experiment is carried out under the condition of low-strength membrane washing, and the radioactivity of the hybridization spots of the two probes is not obviously different; in the hybridization experiment performed under the high-intensity membrane washing condition, the radioactive intensity of the hybridization spot of the probe 1 is obviously stronger than that of the other probe. Thus, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotides of the present invention in different tissues. Example 7 DNA Microarray

The gene chip or gene Microarray is a new technology developed and developed by many national laboratories and major pharmaceutical companies, and it means that a large number of target gene fragments are orderly arranged on carriers such as glass, silicon and the like in high density, and then data comparison and analysis are performed by fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information rapidly, efficiently and in high flux. The polynucleotide of the present invention can be used as a target DNA for gene chip technology for high-throughput research of new gene functions; searching and screening new tissue-specific genes, particularly new genes related to diseases such as tumor and the like; diagnosis of a disease, such as a genetic disease. The specific process steps have been reported in the literature, for example, in the literature de ris, j.l., Lyer, V.&Brown, P.O. (1997) Science278, 680-: 2150-2155. (one) spotting

The total of 4000 different full-length cDNAs were used as target DNAs, including the polynucleotide of the present invention. They were amplified by PCR, the resulting amplification products were purified and then the concentration thereof was adjusted to about 500ng/ul, and spotted on a glass medium with a spotting instrument of Cartesian 7500 (from Cartesian, USA) at a distance of 280 μm from the spot. Hydrating and drying the spotted glass slide, placing the glass slide in an ultraviolet crosslinking instrument for crosslinking, eluting and drying the glass slide to fix the DNA on the glass slide to prepare the chip. The concrete steps of the method are reported in the literature, and the sample application post-treatment step of the embodiment is as follows:

1. hydrating in a humid environment for 4 hours;

2.0.2% SDS for 1 minute;

3.ddH₂o washes twice, each for 1 minute;

4.NaBH₄sealing for 5 minutes;

water at 5.95 ℃ for 2 minutes;

6.0.2% SDS for 1 minute;

7.ddH₂flushing twice;

8. air-dried and stored in the dark at 25 ℃ for later use. (II) Probe labeling

Total mRNA was extracted from human mixed tissue and specific tissue (or stimulated cell line) by one-step method, and mRNA was purified using Oligotex mRNA Midi Kit (available from QiaGen), mRNA of human mixed tissue was labeled with the fluorescent reagent Cy3dUTP (5-Amino-pro-pyl-2 '-deoxyuridine 5' -triprotected to Cy3 fluorescent dye, available from Amersham pharmacia Biotech) by reverse transcription, mRNA of specific tissue (or stimulated cell line) was labeled with the fluorescent reagent CySdo-pro-pyl-2 '-deoxyuridine 5' -trit-colored Cy to 5 fluorescent dye, available from Amersham pharmacia Biotech), and probe was prepared after purification. The specific steps refer to and the method is as follows: schena, m., Shalon, d., Heller, R. (1996) proc.natl.acad.sci.usa.vol.93: 10614-10619 Schena, m., Shalon, dari, Davis, R.W (1995) science.270 (20): 467-480. III. hybridization

Separately putting probes from the above two tissues together with the chip in UniHyb^TMHybridization was carried out in hybridization solution (available from TeleChem) for 16 hours, washed with washing solution (1 XSSC, 0.2% SDS) at room temperature, scanned with ScanArray 3000 scanner (available from General screening, USA), and the scanned images were subjected to data analysis using Imagene software (available from Biodiscovery, USA) to calculate the Cy3/Cy5 ratio for each spot.

The specific tissues of the organism (or stimulated cell lines) are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal Fibroblast 1024NC, fibroplast, growth factor stimulation, 1024NT and scar formation fc growth factor stimulation, 1013HT and scar formation fc are not stimulated by growth factors, 1013HC, bladder cancer established cell EJ, beside bladder cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma and cardia cancer, and a folding chart is drawn according to the 17 Cy3/Cy5 ratio (figure 1), so that the expression spectrums of the human β -glucuronidase 11.88 and the human β -glucuronidase are very similar.

Sequence listing (1) general information:

(ii) the invention name is human β -glucuronidase 11.88 and coding sequence thereof

(iii) number of sequences: 9(2) SEQ IDNO: 1, information:

sequence characteristics:

(A) length: 2365bp

(B) Type (2): nucleic acids

(C) Chain property: double chain

(D) Topological structure: linearity

(ii) type of molecule: cDNA

(xi) sequence description: SEQ ID NO: 1: 1 CAAGGTTAGAAGCAAGGAAGCAAGTTAGGAGGGGAACGATGATTGTGGTCATCTAGATCA 61 TAGTTGTAGAAGGTGGAGAGAAGTAGAGCTGACTGAAATTCTCAATGGTTTAAACGTGGA121 GTAAAAGAGAGGGAATTTACAAATTACTGAAATAATTTTTGGTTTGATCAAACGGAAGGA181 TAATACGGCCACTCATTAAAGTAGGGAATACTAAGCACAAACAGTTTCAAGGAGAAAATC241 AAAACTTTTGTTTTGGACATGTTAAGTTTAAAATGTGTGTTAACTAATTAAACGGTAATG301 TTGAGGAAGCAAGTAACTGGCTGACAAGTCTGAGGATTAAGGGAGAGGTCTGATTTGTTT361 ATATGTAGTATTTAAATGCATGAGACTAGATACAATCATACAGGAAATAATTGTAAAGAA421 AATGTCCAAGGACTGAATATATTTTGCTTCTCCACAACTTATAATGCAGAAAATCTCTTC481 AAAGGAAGAAAAATAAAAATCCATTTATCCTAATCACATTCTTTTCTAATATAAAGTCTC541 ATTTTTATTTTCAAGTGCACATAAAAATAATGCATTTAACTCATATATGTAGACTTTTCA601 ACTTAATCTATGCAAATGACAAAATAAATACTGTAAGTCAGTCTATATTTACTGAATCTC661 TACTTGCAAGGTTCTGCACTAAGGCAAATTATGATATAAAACTGAGCCAAAAAAGACATG721 GAGGAAAAGAAATATGTTGCATAATAATATCAAAGAACTTAGTAAATACACAAATAACTG781 TAGAGGTTCAGGTTGGAATCGCATACTATGTACAGGAAAGTATAAAGAAGCTCAATGTTA841 TCATTATCAGGATAATACTCTTGGTCAAATGTTCAAATTTTCAATTAGAAGTGTAAATGA901 TAGTAAAATAAACAATTCTACCCACAAAGATATTTTCTATGAAATTACTTTCATGAGATA 961 GTCATCTTTATTACATTGTACCAGCAGATGTCGCTAGAAAACTGTTTTTGGAAGAATTTG1021 TAGTTCATTGGTGTGACTTCTATAGCAAACACTTTACTGTAGGTTTTCCTCTAAAAACAC1081 ATTTATAGGGATGCAAAAATGTTACTAATCTTAATTAAAGTACATTAAGTTCTCTCAAGT1141 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA1201 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1261 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 13213272 1321321 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1381 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 14472 1441 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1501 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1561 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1621 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1681 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1741 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 1861 18672 1921 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 19820472 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 2101 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 2161 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 2221 AAATATCTCGATATTAGACTTTTAATGATGGGTGATGTTCCTATAATCCATTCAATATAA 223672 23472 (3) SEQ ID NO: 2, information:

sequence characteristics:

(A) length: 108 amino acids

(B) Type (2): amino acids

(D) Topological structure: linearity

(ii) type of molecule: polypeptides

(xi) sequence description: SEQ ID NO: 2: 1 Met His Leu Thr His Ile Cys Arg Leu Phe Ash Leu Ile Tyr Ala 16 Asn Asp Lys Ile Ash Thr Val Ser Gln Ser Ile Phe Thr Glu Ser 31 Leu Leu Ala Arg Phe Cys Thr Lys Ala Asn Tyr Asp Ile Lys Leu 46 Ser Gln Lys Arg His Gly Gly Lys Glu Ile Cys Cys I1e I1e Ile 61 Ser Lys Asn Leu Val Ash Thr Gln Ile Thr Val Glu Val Gln Val 76 Gly Ile Ala Tyr Tyr Val Gln Glu Ser I1e Lys Lys Leu Asn Val 91 Ile Ile Ile Arg Ile Ile Leu Leu Val Lys Cys Ser Asn Phe Gln106 Leu Glu Val (4) SEQ ID NO: 3 information

Sequence characterization

(A) Length: 24 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotides

(xi) sequence description: SEQ ID NO: 3: CAAGGTTAGAAGCAAGGAAGCAAG 24(5) SEQ ID NO: 4 information

Sequence characterization

(A) Length: 24 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotides

(xi) sequence description: SEQ ID NO: 4: CTTACTAAAGTTTATTAAGTACAA 24(6) SEQ ID NO: 5 information

Sequence characterization

(A) Length: 33 base

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotide (xi) sequence description: SEQ ID NO: 5: CATGCTAGCATGCATTTAACTCATATATGTAGA 33(7) SEQ ID NO: 6 information

Sequence characterization

(A) Length: 33 base

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotide (xi) sequence description: SEQ ID NO: 6: CATGGATCCTTACACTTCTAATTGAAAATTTGA 33 (8) SEQ ID NO: 7, information:

sequence characteristics:

(A) length: 15 amino acids

(B) Type (2): amino acids

(D) Topological structure: linearity

(ii) type of molecule: polypeptide (xi) sequence description: SEQ ID NO: 7: Met-His-Leu-Thr-His-Ile-Cys-Arg-Leu-Phe-Asn-Leu-Ile-Tyr-Ala 15(9) SEQ ID NO: 8 information

Sequence characterization

(A) Length: 41 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotide (xi) sequence description: SEQ ID NO: 8: TGCATTTAACTCATATATGTAGACTTTTCAACTTAATCTAT 41(10) SEQ ID NO: 9 information

Sequence characterization

(A) Length: 41 bases

(B) Type (2): nucleic acids

(C) Chain property: single strand

(D) Topological structure: linearity

(ii) type of molecule: oligonucleotide (xi) sequence description: SEQ ID NO: 9: TGCATTTAACTCATATATGTCGACTTTTCAACTTAATCTAT 41

Claims (18)

1. An isolated polypeptide-human β -glucuronidase 11.88, characterized in that it comprises a polypeptide of amino acid sequence shown in SEQ ID NO.2, or an active fragment, analog or derivative of the polypeptide.

2. The polypeptide of claim 1, wherein the amino acid sequence of said polypeptide, analog or derivative has an amino acid sequence identical to SEQ ID NO: 2 is at least 95% identical.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the sequence of SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

4. An isolated polynucleotide, characterized in that the polynucleotide comprises one selected from the group consisting of:

(a) encodes a polypeptide having the sequence of SEQ ID NO: 2 or a fragment, analog or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide sharing at least 70% identity to (a) or (b).

5. The polynucleotide of claim 4, wherein said polynucleotide comprises a sequence encoding a polypeptide having the sequence of SEQ ID NO: 2, or a polynucleotide having the amino acid sequence shown in figure 2.

6. The polynucleotide of claim 4, wherein the sequence of said polynucleotide comprises the sequence set forth in SEQ ID NO: 1 at position 570-896 or SEQ ID NO: 1-2365 in 1.

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant vector constructed from the polynucleotide of any one of claims 4 to 6 and a plasmid, virus or expression vector.

8. A genetically engineered host cell comprising an exogenous polynucleotide, wherein the genetically engineered host cell is selected from the group consisting of:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) A host cell transformed or transduced with a polynucleotide according to any one of claims 4 to 6.

9. A method of producing a polypeptide having the activity of human β -glucuronidase 11.88, characterized in that the method comprises:

(a) culturing the engineered host cell of claim 8 under conditions that express human β -glucuronidase 11.88;

(b) isolating the polypeptide having human β -glucuronidase 11.88 activity from the culture.

10. An antibody capable of binding to a polypeptide, wherein said antibody is an antibody capable of specifically binding to human β -glucuronidase 11.88.

11. A compound for simulating or regulating the activity or expression of polypeptide, which is characterized in that the compound simulates, promotes, antagonizes or inhibits the activity of human β -glucuronidase 11.88.

12. The compound of claim 11, which is SEQ ID NO: 1 or a fragment thereof.

13. Use of a compound according to claim 11 for the modulation of the in vivo, in vitro activity of human β -glucuronidase 11.88.

14. A method for detecting a disease or a susceptibility to a disease associated with the polypeptide of any of claims 1-3, comprising detecting the amount of expression of the polypeptide, or detecting the activity of the polypeptide, or detecting a nucleotide variation in the polynucleotide that causes an abnormality in the amount of expression or activity of the polypeptide.

15. Use of a polypeptide according to any of claims 1 to 3 for screening for mimetics, agonists, antagonists or inhibitors of human β -glucuronidase 11.88, or for peptide fingerprinting.

16. Use of a nucleic acid molecule according to any of claims 4 to 6 as a primerin a nucleic acid amplification reaction, or as a probe in a hybridization reaction, or for the manufacture of gene chips or microarrays.

17. The polypeptide, polynucleotide or compound of any of claims 1-6 and 11 for use wherein the polypeptide, polynucleotide or its mimetics, agonists, antagonists or inhibitors are used in a safe and effective amount in combination with a pharmaceutically acceptable carrier to form a pharmaceutical composition for the diagnosis or treatment of diseases associated with the abnormality of human β -glucuronidase 11.88.

18. Use of the polypeptide, polynucleotide or compound of any of claims 1-6 and 11, wherein said polypeptide, polynucleotide or compound is used for the preparation of a medicament for the treatment of, for example, malignant tumors, hematological disorders, HIV infection and immunological disorders and various types of inflammation.

Images