CN1312856A - Enzymatic nucleic acid treamtent of diseases or conditions related to hepatitisc virus infection - Google Patents

Abstract

Enzymatic nucleic acid molecules which modulate the expression and/or replication of hepatitis C are disclosed.

Description

The disease relevant or the enzymatic nucleic acid treamtent of state with infection with hepatitis C virus

Present patent application requires the Blatt of submission on February 24th, 1999 etc., the Blatt that USSN (application number is not arranged as yet), on September 18th, 1998 submit to etc., USSN 60/100, the McSwiggen that on April 27th, 842 and 1998 submitted to etc., USSN 60/083,217 right of priority, all these are title with " disease relevant with infection with hepatitis C virus or the enzymatic nucleic acid treamtent of state " all in first to file.These applications herein comprise that figure is whole and all are introduced into as a reference.

Background of invention

The present invention relates to be used for the treatment of the method and the reagent of disease relevant or state with infection with hepatitis C virus.

Be the discussion of correlation technique below, wherein none is considered to prior art of the present invention.

In 1989, HCV was confirmed as a kind of RNA viruses and is considered to the cause of disease of most of viral hepatitis non-A non-Bs (Choo etc., science 1989; 244:359-362).For example HIV is different with retrovirus, and HCV is without the dna replication dna phase, and does not detect virus genomic integration form (Houghton etc., hepatology (Hepatology) 1991 in host chromosome; 14:381-388).On the contrary, duplicating by forming of coding (just) chain duplicated (bearing) chain and mediated, and the formation of duplicating chain causes producing the normal chain HCV RNA of several copies.Genome is made up of a single great opening reading frame, and it translates into a polyprotein (Kato etc., FEBS Letters 1991:280:325-328).This polyprotein produces several viral proteins (Leinbach etc., virusology (Virology) 1994 through the cutting of translation back subsequently; 204:163-169).

The detection that the genome of 9500 bases of HCV is carried out confirms viral nucleic acid can undergo mutation with high frequency (Smith etc., molecular evolution (Mol.Evol.) 1997; 45:238-246).This mutation rate causes being evolved into the HCV of several different genotype, has about 70% sequence homogeny (Simmonds etc., general virology magazine (J.Gen.Virol.) 1994 between these genotypic HCV; 75:1053-1061).Notice that these sequences are quite remote on evolving, this is very important.For example, the hereditary homogeny between people and primates such as chimpanzee is approximately 98%.In addition, verified, HCV in single patient infects by several different and quasispecies that constantly evolve and is formed, and these quasispecies have 98% homogeny on rna level.Therefore, the HCV genome be alterable height and also constantly changing.Though the HCV genome is an alterable height, there is the zone of 3 high conservatives in the genome.These conservative sequences appear at 5 ' end of 5 ' and 3 ' non-coding region and core protein coding region, and they are considered to the key of HCV rna replicon and the translation of HCV polyprotein.Therefore, the therapeutical agent at these conservative HCV genome areas may have significant effect to a variety of HCV genotype.In addition, be unlikely to specificity at the ribozyme generation drug resistance of HCV genome conservative region.On the contrary, with to enzyme for example virus protease or helicase to suppress be the therapeutic modality of purpose, then easily cause the screening of persister because the RNA of these encoding viral enzymes is positioned at the genomic hypervariable region of HCV.

After being exposed to HCV at first, the patient raises through an of short duration liver enzyme, (Alter etc. take place in its expression inflammatory process, IN:SeeffLB, Lewis JH compiles, modern hepatology (CurrentPerspectives in Hepatology), New York: Plenum Medical Book Co; 1989:83-89).The rising of this liver enzyme will initial expose at least 4 week the back and can last up to 2 months (Farci etc., New England Journal of Medicine (New England Journal of Medicine) 1991 takes place; 325:98-104).Before liver enzyme raises, utilize RT-PCR to analyze and in the patients serum, may detect HCV RNA (Takahashi etc., american journal of gastroenterology (American Joumal ofGastroenterology) 1993; 88:2:240-243).This stage of disease is called as acute phase, and since HCV infect due to acute viral hepatitis patient 75% be asymptomatic and do not detect usually.All the other patients of 25% develop into jaundice or other hepatitis symptom.

Acute HCV infection is a kind of benign disease, yet nearly acute HCV patient's progress of 80% is chronic hepatic diseases, what it showed as the lasting rising of serum alanine aminotransferase (ALT) level and circulation HCV RNA continues to exist (Sherlock, lancet (Lancet) 1992; 339:802).The naturally progress of chronic HCV infection in the period of 10 to 20 causes 20% to 50% patient that liver cirrhosis (Davis etc., infectious and disease (Infectious Agents and Disease) 1993 take place; 2:150-154), and have many data to confirm that HCV infect progress and are hepatocellular carcinoma (Liang etc., hepatology 1993; 18:1326-1333; Tong etc., western medicine magazine (Westem Joumal ofMedicine) 1994; 160 volumes, the 2nd phase: 133-138).Still the inferior crowd of most probable progress for liver cirrhosis and/or hepatocellular carcinoma do not determined in research, so all patients have equal risk.

Need point out that importantly the survival time of patients that is diagnosed as hepatocellular carcinoma only is 0.9 to 12.8 months (Takabashi etc., american journal of gastroenterologies 1993 after initial diagnosis; 88:2:240-243).With chemotherapeutic hepatocellular carcinoma is treated to confirm being effectively, and since in the liver widely tumor invasion only have 10% patient can from surgical operation, benefit (Trinchet etc., PresseMedicine 1994; 23:831-833).Because the invasion and attack characteristic of primary hepatocellular carcinoma, unique feasible therapy is liver transplantation (Pichlmayr etc., a hepatology 1994 except surgical operation; 20:33S-40S).

In the process of liver cirrhosis progress, the patient of chronic HCV infection shows Clinical symptoms, if do not consider cause this be common in the clinical liver cirrhosis (D ' Amico etc., digestion disease and science (Digestive Diseases and Sciences) 1986; 31:5:468-475).These Clinical symptoms may comprise: BEV, ascites, jaundice and encephalopathic (Zakim D, Boyer TD, hepatology: hepatic diseases textbook (Hepatology atextbook ofliver disease) second edition, the first roll.1990 W.B.Saunders Company. Philadelphia).Early stage at liver cirrhosis classifies as the compensatory liver cirrhosis with the patient, though it means the liver organization damage taken place, and patient's liver still can detoxify to the metabolite in the blood flow.In addition, the patient that great majority have the compensatory hepatic diseases is asymptomatic, and Symptomatic slight symptom, for example maldigestion and the weakness of only being reported as of minority.In the late period of liver cirrhosis, the patient is classified as mistake compensatory liver cirrhosis, mean it metabolite toxicide ability in blood flow is reduced, and will show in above-mentioned Clinical symptoms of this stage just.

In 1986, D ' Amico etc. described the clinical manifestation of 1155 liver cirrhosis patients relevant with virus of being addicted to drink and survival rate (D ' Amico, the same).In 1155 patients, though asymptomatic in when beginning research 70%, 435 (37%) have the compensatory disease.Remaining 720 patient (63%) has and loses the compensatory hepatic diseases, wherein 78% shows as and has the ascites history, and 31% has jaundice, and 17% has hemorrhage and 16% encephalopathic arranged.Have among the patient of compensatory disease and have among the patient who loses the compensatory disease at 6 (0.5%) and observe hepatocellular carcinoma at 30 (2.6%).

In 6 years, the patient with compensatory liver cirrhosis is developed the Clinical symptoms that mistake compensatory disease with annual 10% ratio.In most of the cases, ascites is to lose first compensatory performance.Develop into hepatocellular carcinoma when in addition, 59 patients' to 6 that show as the compensatory disease at first year research finishes.

As for survival rate, D ' Amico studies show that 5 years survival rates of all patients only are 40% in the research.For 6 years survival rates of the patient who has the compensatory liver cirrhosis at first is 54%, and only is 21% for having 6 years survival rates of patient of losing the compensatory disease at first.Survival rate does not have marked difference between the patient of the patient of being addicted to drink property liver cirrhosis and the relevant liver cirrhosis of virus.Patient's underlying cause of death comprises that liver failure accounts for 49% in the research of D ' Amico, and hepatocellular carcinoma accounts for 22% and hemorrhagely account for 13% (D ' Amico the same).

Chronic hepatitis C is the diseases associated with inflammation of a kind of slow progress of liver, and by a kind of virus (HCV) mediation, it can cause liver cirrhosis, liver failure and/or hepatocellular carcinoma in the time in 10 to 20 years.In the U.S., the HCV infection is the reason (NIH Consensus Development Conference Statement on Management ofHepatitis C, in March, 1997) of the newly-increased case of routine acute hepatitis in U.S.'s every year 50,000 according to estimates.HCV is 1.8% at the sickness rate of the U.S. according to estimates, and CDC estimates that chronically infected American quantity is about 4,500,000 people.CDC also estimates to cause annual death toll up to 10,000 examples by chronic HCV infection.

The clinical experiment that utilizes Interferon, rabbit (IFN-α) in the treatment of chronic HCV infection of a lot of strict controls confirms, 3 times treatment makes the patients serum ALT value of about 50% (from 40% to 70%) reduce (Davis etc., New England Journal of Medicine 1989 when finish 6 months the course of treatment weekly; 321:1501-1506; Marcellin etc., hepatology 1991; 13:393-397; Tong etc., hepatology 1997; 26:747-754; Tong etc., hepatology 1997; 26 (6) 1640-1645).Yet after interferon therapy stopped, about 50% reaction patient recurrence caused the response rate of " lastingly " estimated by the stdn of Serum ALT concentration to be approximately 20 to 25%.

In recent years, become possibility by utilizing branched DNA or reversed transcriptive enzyme polymerase chain reaction (RT-PCR) analysis that HCV RNA is directly detected.Usually, the RT-PCR method is sensitiveer, and can carry out more accurate evaluation (Tong etc., the same) to clinical course.The change that utilizes HCV RNA value is as clinical endpoint, and the patient up to 35% that studies show that 6 months I type interferon therapy is observed detects less than HCV RNA (Marcellin etc., the same) when treatment finishes.Yet as if being terminal point with ALT, about 50% patient is stopping to treat recurrence in back 6 months, and it only is 12% (Marcellin etc., the same) that persistent virusology is replied.The lasting virusology that studies show that the treatment in 48 weeks is observed is replied up to 25% (NIH consensus statement:1997).Therefore, the treatment standard with I type interferon therapy chronic HCV infection was 48 weeks at present, and utilized main evaluation (Hoofnagle etc., the New England Journal of Medicine 1997 of the change conduct of HCV RNA concentration to curative effect; 336 (5) 347-356).

The side effect that is caused by I type interferon therapy can be divided into 4 big classes, comprises 1. influenza-like symptoms; 2. neural spiritual side effect; 3. laboratory abnormalities; And 4. other (Dusheiko etc., viral hepatitis magazines (Joumal of Viral Hepatitis) 1994; 1:3-5).The example of influenza-like symptom comprises: fatigue, heating, myalgia, discomfort, appetite stimulator, tachycardia, stiff, headache and arthrodynia.Influenza-like symptom is normally of short duration, and is tending towards alleviating (Dushieko etc., the same) after 4 week of administration.Neural spiritual side effect comprises: irritability, indifferent, mood change, insomnia, cognitive change and depression.The most important thing is depression in these neural spiritual side effects, have the patient of history of depression should not give I type Interferon, rabbit.Laboratory abnormalities comprises: myeloid cell reduces, and comprises granulocyte, thrombocyte and a spot of red corpuscle.These changes of hemocyte quantity seldom cause any significant clinical sequela (Dushieko etc., the same).In addition, the increase of triglyceride concentration and the rising of serum L-Ala and l-asparagine transamination enzyme concn have been observed.At last, Tiroidina also is in the news unusually.These Tiroidina can reverse after interferon therapy stops unusually usually, and can control it with suitable medicine in treatment.That other side effects comprise is nauseating, diarrhoea, stomachache and backache, itch, alopecia and rhinorrhea.Usually, most of side effect will alleviate (Dushieko etc., the same) after the treatment in 4 to 8 weeks.

Welch etc., gene therapy (Gene Therapy) 1996; 3 (11): 994-1001 has described in the external and body that carries out with two kinds of carriers of expressing at the hair clip type ribozyme of hepatitis C virus and has studied.

Sakamoto etc., Journal of Clinical Investigation (J.Clinical Investigation) 1996; 98 (12): 2720-2728 has described by some carrier of expressing hammerhead ribozyme to cutting in the cell of HCV RNA with to the inhibition of viral protein translation.

Lieber etc., Journal of Virology (J.Virology) 1996; 70 (12): 8782-8791 has described by the adenovirus mediated expression to some hammerhead ribozyme and has made by this viral RNA removing in the liver cell of infection with hepatitis C virus.

Ohkawa etc., 1997, hepatology magazine (J.Hepatology), 27; 78-84 has described the hammerhead ribozyme that utilizes some in-vitro transcription to the external cutting of HCV RNA and the inhibition of viral protein translation.

Barber etc., PCT international publication number WO 97/32018 have described and have utilized adenovirus carrier to express the hair clip type ribozyme of some anti-hepatitis c virus.

Kay etc., PCT international publication number WO 96/18419 have described and have utilized some recombinant adenoviral vector to express anti-HCV hammerhead ribozyme.

Yamada etc., Japanese patent application JP have described the hammerhead ribozyme at HCV that a specificity poly-(L)-Methionin connects for No. 07231784.

Draper, United States Patent (USP) the 5th, 610 has been described for No. 054 and can have been suppressed the enzyme nucleic acid molecule that HCV duplicates.

Alt etc., hepatology 1995; 22 (3): 707-717 has described the specificity of hepatitis c virus gene being expressed by certain antisense phosphorothioate ester oligodeoxynucleotide and has suppressed.

The invention summary

The present invention relates to ribozyme or enzyme nucleic acid molecule, it is directed cutting hepatitis C virus (HCV) and/or by the RNA sample of HCV coding.Particularly the applicant has described screening and the function of ribozyme that can specificity cutting HCVRNA.This type of ribozyme can be used to treat with HCV and infect relevant disease.

Because the highly variable of HCV genome sequence, the screening that is used for the ribozyme of extensive therepic use may relate to the genomic conserved regions of HCV.Particularly, the invention describes the hammerhead ribozyme that can in the genomic conserved regions of HCV, cut.A series of 30 are derived from HCV genome conserved regions (5 ' end and 3 '-NCR) the hammerhead ribozyme of 5 '-non-coding region (NCR), core protein coding region are shown in the table IV.The applicant finds that the enzyme nucleic acid molecule that common cleavage site is positioned at HCV genome 5 ' end can block translation, and cleavage site is positioned at the ribozyme of genome 3 ' end and can blocks rna replicon.Identified about 50 HCV strain isolateds, and the alignment that these strain isolateds of genotype 1a, lb, 2a, 2b, 2c, 3a, 3b, 4a, 5a and 6 have carried out sequence has been arranged.The applicant utilizes these alignment to arrange definite 30 hammerhead ribozyme sites in the next high conservative zone between each genotype.In conserved regions, identify 23 ribozyme sites in the homologous zone.Therefore, can design a ribozyme and cut all different HCV strain isolateds.According to the applicant, ribozyme at the conserved regions design of various HCV strain isolateds can effectively suppress duplicating of HCV in various patient group, and can guarantee the validity at the ribozyme of HCV quasispecies, described HCV quasispecies is owing to the sudden change in the non-conserved regions of HCV genome is evolved.

" inhibition " means to make the active of HCV or be lower than by the level of the coded RNA of HCV genome is not having viewed level under the situation of nucleic acid, and particularly the inhibition by ribozyme preferably is lower than non-activity RNA molecule (can not cut this RNA in conjunction with mRNA goes up same loci) viewed level when existing.

" enzyme nucleic acid " means a kind of nucleic acid molecule that can catalyzed reaction, and described catalyzed reaction includes, but not limited to the cutting and the trans-splicing of connection, peptide and the amido linkage of locus specificity cutting and/or other nucleic acid molecule.This type of molecule with endonuclease activity may have complementarity to the special genes target in the substrate land, but also has the enzymatic activity of in this target specificity cutting RNA or DNA.That is to say that the nucleic acid molecule with endonuclease activity can be at intramolecularly or intermolecular cutting RNA or DNA, deactivation target RNA or dna molecular thus.This complementarity makes enzyme RNA molecule can fully hybridize with target RNA or DNA, so that cutting can take place.Preferred 100% complementarity, but in the present invention complementarity to be low to moderate 50-75% may also be effective.Can modify nucleic acid at base, sugar and/or phosphoric acid group place.Term enzyme nucleic acid molecule and phrase for example ribozyme, catalytic RNA, enzyme RNA, catalytic DNA, catalytic oligonucleotide, nucleozyme, DNA enzyme, RNA enzyme, endoribonuclease, endonuclease, minizyme, leadzyme, oligozyme or DNA enzyme exchange use.The nucleic acid molecule with enzymic activity all described in all these terms.Specific enzymes nucleic acid molecule described in the application is also nonrestrictive in the present invention, those of ordinary skill in the art will recognize for enzyme nucleic acid molecule of the present invention, importantly it has the specific substrate binding site of same or a plurality of target nucleic acid regional complementarities, with and have in this substrate binding site or nucleotide sequence on every side, described nucleotide sequence is given this molecule with the nucleic acid nicking activity.

" enzyme part " or " catalyst structure domain " mean in the ribozyme and to be cut to pass part and parcel/zone (for example seeing Fig. 1) for nucleic acid primer.

" substrate brachium conjunctivum " or " substrate binding domains " means the part/zone of ribozyme with the part of its substrate complementary (that is, can base pairing).Usually, this type of complementarity is 100%, but if desired can be lower.For example, few 10 bases in 14 can be matched.This type of arm is shown in Fig. 1 and 3 substantially.That is to say that these arms contain the ribozyme internal sequence, its intention connects together ribozyme by complementary base pairing effect with target RNA.Ribozyme of the present invention can have adjacent or non-conterminous brachium conjunctivum, and can be all lengths.The length of brachium conjunctivum preferably more than or equal 4 Nucleotide; 12-100 Nucleotide particularly; More especially 14-24 Nucleotide is long.If select 2 brachium conjunctivums, the length that then is designed to brachium conjunctivum is that symmetric (that is, each brachium conjunctivum length is identical; For example, 5 and 5 Nucleotide, 6 and 6 Nucleotide or 7 and 7 Nucleotide are long) or asymmetrical (that is length difference of brachium conjunctivum; For example, 6 and 3 Nucleotide, 3 and 6 Nucleotide is long, 4 and 5 Nucleotide is long, 4 and 6 Nucleotide is long, 4 and 7 Nucleotide is long, or the like).

In an embodiment preferred of the present invention, described enzyme nucleic acid molecule is formed in tup type or the hair clip type primitive, but also can be formed in the primitive of hepatitis D virus, group-, group-or RNA enzyme P RNA (relevant with the RNA homing sequence) or neurospora VS RNA.Dreyfus, the same, Rossi etc., 1992, AIDS research and human retrovirus (AIDSResearch and Human Retroviruses) 8,183 have described the example of this type of tup type primitive; Hampel etc., EP0360257, Hampel and Tritz, 1989, biological chemistry 28,4929, Feldstein etc. 1989, gene 82,53, Haseloff and Gerlach, 1989, gene 82,43 and Hampel etc., 1990, nucleic acids research 18,299 has been described the hair clip type primitive; Perrotta and Been, 1992, biological chemistry 31,16 has been described the hepatitis D virus primitive; Guerrier-Takada etc., 1983, cell 35,849, Forster and Altman, 1990, science 249,783, Li and Altman, 1996, nucleic acids research 24,835 has been described RNA enzyme P primitive; Collins (Saville and Collins, 1990, cell 61,685-696; Saville and Collins, 1991, newspaper (Proc.Natl.Acad.Sci.USA) 88 of institute of NAS, 8826-8830; Collins and Olive, 1993, biological chemistry 32,2795-2799; Guo and Collins, 1995, EMBO's magazine (EMBO.J.) 14,363) neurospora VS RNA ribozyme primitive has been described; Griffin etc., 1995, chemistry and biology (Chem.Biol.) 2,761; Michels and Pyle, 1995, biological chemistry 34,2965; PCT international publication number WO96/22689 such as Pyle have described group-; Cech etc., United States Patent (USP) 4,987,071 has described group-; Chartrand etc., 1995, nucleic acids research 23,4092; Santoro etc., 1997, institute of NAS newspaper 94,4262 has been described DNA enzyme primitive.These specific primitives are also nonrestrictive in the present invention, person of skill in the art will appreciate that importantly it has the specific substrate binding site of same or a plurality of target gene RNA regional complementarities to enzyme nucleic acid molecule of the present invention, with and have in substrate binding site or on every side nucleotide sequence, described nucleotide sequence makes this molecule have the nucleic acid nicking activity.

" equivalence " RNA of HCV means in various animals and infects those relevant naturally occurring RNA molecules with HCV, and described animal comprises people, rodents, primates, rabbit and pig.Except the coding region, RNA sequence of equal value also comprises the zone as 5 '-non-translational region, 3 '-non-translational region, intron, intron-exon junction etc.

" complementarity " means a kind of nucleic acid, and it can form hydrogen bond by base pairing effect and another RNA sequence of traditional Watson-Crick base pairing or other non-traditional type (for example, Hoogsteen type).

In an embodiment preferred, the invention provides the enzyme cutting agent of high degree of specificity of method preparation shows to(for) the expection target RNA.The preferred target of enzyme nucleic acid molecule is in the highly conserved sequence district of the proteic said target mrna of coding HCV, so that can provide specific treatment to disease or state with one or more enzyme nucleic acid.This fermentoid nucleic acid molecule can be passed to specific cell according to required outer seedbed.Perhaps, ribozyme can be expressed by the DNA/RNA carrier that is passed to specific cells.

This type of ribozyme is effective for preventing above-mentioned disease or state and any other disease or the state relevant with HCV activity level in the cell or tissue.

" be correlated with " mean the inhibition of HCV RNA and thus due to being reduced in of virus activity level will palliate a disease to a certain extent or the symptom of state.

In preferred embodiments, ribozyme has brachium conjunctivum, itself and the target complement sequence of showing in IV-IX.The example of this type of ribozyme also is shown in table IV-IX.The example of this type of ribozyme is made up of determined sequence in these tables basically.May have other sequence, it does not disturb this type of cutting.

" basically by ... form " mean active ribozyme contain one with embodiment in those enzyme center or cores of equal value, and the brachium conjunctivum that cuts can take place in conjunction with mRNA so that at target site.

Therefore, in one aspect, the present invention is a feature with the ribozyme of inhibition of gene expression and/or virus replication.These chemistry or enzymatic synthetic RNA molecule contain the substrate binding domains of the accessible areas that is bonded to its said target mrna.The RNA molecule also contains the structural domain of catalysis RNA cutting.The RNA molecule is preferably the ribozyme with tup type or hair clip type primitive.By combination, ribozyme cutting said target mrna stops translation and proteinic accumulation.Under the situation that target gene is not expressed, HCV genetic expression and/or duplicate is suppressed.

In an embodiment preferred, ribozyme can directly add, and perhaps can form mixture with cation lipid, is wrapped in the liposome, perhaps is passed to target cell.Can bestow related tissue partly with mixing or be not incorporated in nucleic acid in the biopolymer or nucleic acid complexes ex vivo or the body by injection, infusion pump or support.In another embodiment preferred, ribozyme is bestowed HCV action site (for example, liver cell) in suitable liposome vectors.

In another aspect of this invention, will cut target molecule and suppress the active ribozyme of HCV and express by the transcription unit that is inserted in DNA or the RNA carrier.Recombinant vectors is preferably DNA plasmid or virus vector.The virus vector of ribozyme expression can based on, but be not limited to adeno-associated virus (AAV), retrovirus, adenovirus or α virus and make up.Preferred transmit as mentioned above can ribozyme expression recombinant vectors, and remain in the target cell.Perhaps, can utilize the virus vector that the ribozyme transient expression is provided.Examples of such carriers can repeat to bestow as required.Ribozyme is just cut said target mrna in case quilt expresses.The carrier of ribozyme expression can give in system's throwing, for example by intravenously or intramuscular bestow, by bestowing the target cell of taking out from the patient, again introduce the patient subsequently or by making that (summary is seen Couture and Stinchcomb to any alternate manner can introduce the purpose target cell, 1996, TIG., 12,510).In another aspect of this invention, cutting target molecule and the ribozyme that suppresses virus replication are expressed by the transcription unit that is inserted into DNA, RNA or virus vector.Preferred local throwing of recombinant vectors that as mentioned above can ribozyme expression given, and instantaneous remaining in the smooth muscle cell.Yet, other mammalian cell carrier that can utilize guide RNA to express for this purpose.

" patient " means a kind of organism, and it is the donor or the acceptor of transplanted cells, perhaps is cell itself." patient " also refers to bestow a kind of organism of enzyme nucleic acid molecule.Preferred patient is Mammals or mammalian cell.More preferably the patient behaves or people's cell.

" carrier " means any technology based on nucleic acid and/or virus that is used to transmit purpose nucleic acid.

Single or the associating of these ribozymes or connect Supreme Being's other medicines and can be used for the treatment of above-mentioned disease or state.For example, in order to treat disease or the state relevant with the HCV level, can treat the patient, perhaps can treat other suitable cell, this is clearly for those those skilled in the art.

Other features and advantages of the present invention will be come clear and definite from following description and claim to its embodiment preferred.

Preferred embodiment is described

At first will be briefly described accompanying drawing.

Accompanying drawing:

Fig. 1 shows the secondary structure model of 7 different sorts enzyme nucleic acid molecule.Arrow indication cleavage site.Indicate target sequence.Three grades of interactions of line indication by an interval.-expression base pairing effect.Group-: P1-P9.0 represents various loop-stem structures (Cech etc., 1994, natural structure biology (Nature Struc.Bio.) 1,273).RNA enzyme P (M1RNA): EGS represents external guide sequence (Foster etc., 1990, science 249,783; Pace etc., 1990, journal of biological chemistry (J.Biol.Chem.) 265,3587).Group-: 5 ' SS means 5 ' splice site; 3 ' SS means 3 ' splice site; IBS means the intron binding site; EBS means exon binding site (Pyle etc., 1994, biological chemistry (Biochemistry) 33,2716).VS RNA: I-VI is indicated 6 loop-stem structures; Three grades of interactions (Collins, PCT international publication number WO96/19577) are represented in the shadow zone.The HDV ribozyme: I-IV is indicated 4 basic ring structures (Been etc., U.S. Patent number 5,625,047).Hammerhead ribozyme: I-III means indicates 3 loop-stem structures; Stem I-III can and can be symmetry or asymmetric (Usman etc., 1996, Curr.Op.Struct.Biol., 1,527) for any length.The hair clip type ribozyme: spiral 1,4 and 5 can be any length; Spiral 2 length are between 3 to 8 base pairs; Y is a pyrimidine; Provide the spiral 2 (H2) (that is, n is 1,2,3 or 4) of at least 4 base pairs, and the length of spiral 5 optionally is provided as 2 or polybase base (preferred 3-20 base, promptly m is from 1-20 or more) more.Spiral 2 and spiral 5 can link to each other by one or more base covalency (that is, r is 1 base). Spiral 1,4 or 5 also can be expanded 2 or a plurality of base pair (for example, 4-20 base pair) stablizing the structure of ribozyme, and is preferably protein binding site.In each case, each N and N ' are respectively any normal or base of modifying, and each deshed line is represented a potential base pairing effect.Can modify these Nucleotide at sugar, base or phosphoric acid place.In spiral, do not need base to match fully, but preferably pairing fully.Spiral 1 and 4 can be for any size (be o and p separately separately for from 0 to any numeral, for example, 20), as long as keep some base pairings.The base of key is shown base specific in the structure, can have tangible effect by chemically modified (no base, base, sugar and/or phosphoric acid modify) or with other base replacement but those those skilled in the art think one or more.Spiral 4 can by 2 independently molecule coordinate, promptly do not have shack.Can be ribonucleotide when shack exists, its base, sugar or phosphoric acid are with or without modification." q " is 2 bases.Shack also can be replaced by the non-nucleotide link molecule.H refers to base A, U or C.Y refers to pyrimidine bases."-" refers to covalent linkage.(Burke etc., 1996, nucleic acid and molecular biology (Nucleic Acids ﹠amp; Mol.Biol.) 10,129; Chowrira etc., U.S. Patent number 5,631,359).

Fig. 2 is a figure, and it has showed the ability of the ribozyme cutting in target each site in 5 ' conservative HCVUTR district by the transcripton of several genotype generations.

Fig. 3 is the diagram of dual reporter gene system, and it is used to confirm in the cell cultures reduction by the uciferase activity of ribozyme mediation.

Fig. 4 shows that ribozyme reduces the ability of uciferase activity in the OST-7 cell.

Fig. 5 display target is to compare the ability that reduces uciferase activity in the OST-7 cell with the contrast of their non-activities in the ribozyme in HCV.5-313 and HCV.5-318 site.

Fig. 6 A handles the bar figure of the effect that HCV-poliovirus (PV) is duplicated for the explanation ribozyme.In 96 orifice plates, infect the HeLa cell with 0.1 infection multiplicity (MOI) with HCV-PV.With substratum displacement virus inoculation liquid, described substratum contains 5% serum and specified same cation lipid compound ribozyme or contrast (200nm) then.After 24 hours, virus is carried out quantitatively by 3 cracking cells of freeze thawing and by the plaque detection.The contrast that will upset (scrambled control, SAC), mark in conjunction with contrast (BC), 3 P=S ribozymes and 4 P=S ribozymes.With average+standard deviation (S.D.) expression of plaque forming unit (pfu)/ml with three repeat samples.

Fig. 6 B handles the bar figure of the effect that wild-type PV is duplicated for the explanation ribozyme.In 96 orifice plates, infected the HeLa cell 30 minutes with MOI=0.05 with wild-type PV.Ribozymes all in (B) contain 4P=S.With average+standard deviation (S.D.) expression of plaque forming unit (pfu)/ml with three repeat samples.

Fig. 7 is the diagram of target in the various hammerhead ribozyme constructs of HCV RNA.

Fig. 8 illustrates the influence that site 183 ribozymes processing is infected single-wheel HCV-PV.Before ribozyme or control treatment, the HeLa cell was infected 30 minutes with MOI=5 with HCV-PV.Lysing cell after 6,7 or 8 hours, and detect by plaque virus is carried out quantitatively.Ribozyme brachium conjunctivum/stem II form (7/4,7/3,6/4,6/3) and the contrast (SAC, 7/4 form) that upsets are marked.All all contain 4P=S stability.The result of pfu/ml is expressed as the intermediate value ± scope of 2 repeat samples.

Fig. 9 is presented at the secondary structure model of 3 kinds of ribozyme primitives described in this application.

Figure 10 shows the activity with the anti-HCV ribozyme of Interferon, rabbit associating.With the pfu/ml ecbatic is the intermediate value ± scope of 2 repeat samples.BAC is in conjunction with the contrast molecule that weakens; IF, Interferon, rabbit; Rz, target is in the hammerhead ribozyme in HCV site 183; Pfu, plaque forming unit.

Ribozyme

The natural RNA as enzyme of present known 7 basic kind. In addition, several in-vitro screenings (evolution) strategy (Orgel, 1979, Proc.R Soc.London, B 205,435) be used to evolve and can the cracking of catalysis phosphodiester bond be connected new nucleic acid catalyst (Joyce with connection, 1989, gene 82,83-87; Beaudry etc., 1992, science 257,635-641; Joyce, 1992, Scientific Beauty compatriots (Scientific American) 267,90-97; Breaker etc., 1994, TIBTECH 12,268; Bartel etc., 1993, science 261,1411-1418; Szostak, 1993, TIBS 17,89-93; Kumar etc., 1995, FASEB J., 9,1183; Breaker, 1996, Curr.Op.Biotech, 7,442; Santoro etc., 1997, institute of NAS newspaper, 94,4262; Tang etc., 1997, RNA 3,914; Nakamaye and Eckstein, 1994, the same; Long and Uhlenbeck, 1994, the same; Ishizaka etc., 1995, the same; Vaish etc., 1997, biochemistry 36,6495; All these all are introduced into the application as a reference). Every kind can the catalysis series reaction, is included in the trans hydrolysis (and therefore can cut other RNA molecule) of phosphodiester bond under the physiological condition. The table I has been summed up some feature of a part in these ribozymes. Usually, enzyme nucleic acid plays a role by at first being bonded to target RNA. This combination assigns to carry out by the target joint portion of enzyme nucleic acid, and described target bound fraction is close to this molecule enzyme part, and target RNA is cut in acting as of described enzyme part. Therefore in a single day, then the enzyme nucleic acid molecules is at first identified and is matched in conjunction with target RNA by complementary base, and is bonded to correct site, but enzymatic cutting target RNA. The tactic cutting of this type of target RNA will destroy it and instruct the synthetic ability of coded albumen. A kind of enzyme nucleic acid in conjunction with and cut its RNA target after, it discharges to seek another target by that RNA, and repeatedly combination and the new target of cutting.

The enzyme feature of ribozyme is the advantage that is better than other technology, will be lower because influence the concentration of the required ribozyme of a kind of therapeutic treatment.This advantage has reflected the ability of ribozyme performance enzyme effect.Therefore, a lot of the molecules that ribozyme molecule just can cracking target RNA.In addition, ribozyme is a kind of inhibition of high special, has not only to depend in conjunction with the base pairing of target RNA mechanism but also depend on the inhibition specificity of the mechanism of target RNA cutting.Can select the single mispairing of contiguous cleavage site or the catalytic activity that ribozyme is thoroughly eliminated in base substitution.

Nucleic acid molecule with endonuclease enzymic activity can cut other independently RNA molecule repeatedly in the specific mode of a kind of nucleotide base sequence.This fermentoid nucleic acid molecule can target in any rna transcription almost, and effectively cut (Zaug etc., 324, nature 429,1986 in external realization; Uhlenbeck, 1987, nature 328,596; Kim etc., 84, institute of NAS newspaper 8788,1987; Dreyfus, 1988, Einstein Quart. Medical Biology magazine (J.Bio.Med.), 6,92; Haseloff and Gerlach, 334, nature 585,1988; Cech, 260, JAMA3030,1988; And people such as Jefferies, 17, nucleic acids research 1371,1989; Chartrand etc., 1995, nucleic acids research 23,4092; Santoro etc., 1997, institute of NAS newspaper 94,4262).

Because their sequence-specific, trans cutting ribozyme has prospect (Usman and McSwiggen, 1995, Ann.Rep.Med.Chem.30,285-294 as the therapeutical agent of human diseases; Christoffersen and Marr, 1995, journal of medicinal chemistry (J.Med.Chem.) 38,2023-2037).Can make ribozyme in the background of cell RNA, cut specific RNA target by design.This type of cutting makes the RNA loss of function and stops the protein expression of this RNA.Proteinic synthetic can by this way optionally be suppressed relevant with morbid state.

The ribozyme of specific site is represented a kind of novel method of treatment of infection with hepatitis C virus among the cutting HCVRNA.The applicant points out that ribozyme can suppress the activity of HCV, and the retarding effect of ribozyme needs catalytic activity.Those those of ordinary skill in the art will find that other ribozyme that is clear that cutting HCV RNA from described embodiment can design at an easy rate, and it within the scope of the invention.

Target site

Can be according at Draper etc., WO 93/23569; Sullivan etc., WO 93/23057; Thompson etc., WO 94/02595; Draper etc., WO 95/04818; McSwiggen etc., U.S. Patent number 5,525, the target of being announced in 468 of determining effective ribozyme, the application all is incorporated herein by reference these.Do not have to repeat the guidance in those documents, provide herein, but the specific embodiment of these class methods is provided below, but be not limited to this area those.According in design described in those applications at the ribozyme of this type of target, and synthesize outward and the body build-in test with receptor as described.Can also be according to this type of ribozyme be optimized and throwing is given described in those.

Utilize the best ribozyme target site of computer folding algorithm screening HCV RNA sequence.Tup type or hair clip type ribozyme cleavage site have been identified.These sites are shown in (all sequences is 5 ' to 3 ' in table) in table IV-VIII.In table, the nucleotide base site is labeled as by the site of designed ribozyme type cutting.

Because HCV RNA is the height homologous in some zone, so some ribozyme target sites also are homologous (seeing Table IV and VIII).In the case, single ribozyme is with the inhomogeneous HCV RNA of target.A kind of target is clearly in the advantage of the ribozyme of a few class HCV RNA, particularly may cause under the situation of morbid state these RNA one or more.

Having designed can bonded tup type or hair clip type ribozyme and analyze respectively by computer folding (Jaeger etc., 1989, institute of NAS newspaper, 86,7706) and to estimate ribozyme sequence and whether be folded into suitable secondary structure.Those ribozymes that have disadvantageous intramolecular interaction between brachium conjunctivum and catalytic core are got rid of from consider.Can select various brachium conjunctivum length to optimize activity.Usually, at least 5 bases can interact in conjunction with target RNA or with target RNA on each arm.The ribozyme that will have tup type or a hair clip type primitive be designed to mRNA courier in each site annealing.Brachium conjunctivum and above-mentioned target site sequence complementation.

Synthesizing of ribozyme

Utilizing the automated method composition length is difficult greater than the nucleic acid of 100 Nucleotide, and the medical expense of this quasi-molecule has stoped its application.In the present invention, little nucleic acid primitive (for example, tup type or hair clip type ribozyme) being used for the external source throwing gives.The simple structure of these molecules has increased the ability of the target region of nucleic acid intrusion mRNA structure.Yet these nucleic acid molecule can also be by eukaryotic promoter in cell inner expression (for example, Izant and Weintraub, 1985, science 229,345; McGarry and Lindquist, 1986, institute of NAS newspaper 83,399; SullengerScanlon etc., 1991, institute of NAS newspaper 88,10591-5; Kashani-Sabet etc., 1992, antisense progress (Antisense Res.Dev.) 2,3-15; Dropulic etc., 1992, Journal of Virology (J.Virol) 66,1432-41; Weerasinghe etc., 1991 Journal of Virologies 65,5531-4; Ojwang etc., 1992, institute of NAS newspaper 89,10802-6; Chen etc., 1992, nucleic acids research 20,4581-9; Sarver etc., 1990, science 247,1222-1225; Thompson etc., 1995, nucleic acids research 23,2259).Those those skilled in the art will recognize that any nucleic acid can be by suitable DNA/RNA vector expression in eukaryotic cell.The activity of this type of nucleic acid can obtain amplifying by it being discharged from original transcripton by ribozyme (Draper etc., PCTWO93/23569, and Sullivan etc., PCT WO94/02595, both all are incorporated herein by reference by complete at this; Ohkawa etc., 1992, Nucleic Acids Symp.Ser., 27,15-6; Taira etc., 1991, nucleic acids research 19,5125-30; Ventura etc., 1993, nucleic acids research, 21,3249-55; Chowrira etc., 1994, journal of biological chemistry (J.Biol.Chem.) 269,25856).

Ribozyme among the embodiment is chemosynthesis.Used synthetic method according to as at Usman etc., 1987, U.S. chemical institute magazine (J.Am.Chem.Soc.) 109,7845; Scaringe etc., 1990, nucleic acids research 18,5433; With Wincott etc., 1995, nucleic acids research 23, the conventional RNA synthetic method described in the 2677-2684, and utilize general nucleic acid protection and coupling group is for example in the dimethoxytrityl of 5 '-end with at the phosphoramidite of 3 '-end.At 394 AppliedBiosystems; Inc. carry out small-scale synthetic on the synthesizer; used 2.5 μ mol scale schemes for adjusting are wherein implemented 5 minutes coupling step to the Nucleotide of silyl protection, and the methylated Nucleotide of 2 '-O-is implemented 2.5 minutes coupling step.Shown the II summary description quantity and the duration of contact of agents useful for same in synthesis cycle.In each coupling circulation, utilize with respect to the phosphoramidite (0.1M 163 μ L=16.3 μ mol) of 6.5 times of surpluses of polymer bonded 5 '-hydroxyl and the S-ethyl tetrazolium (0.25M 238 μ L=59.5 μ mol) of 24 times of surpluses.Determine at 394 AppliedBiosystems that by the colorimetric assay of trityl component the synthetic average coupling output that only goes up of Inc. is 97.5-99%.Other is used for 394Applied Biosystems, the synthetic oligonucleotide synthetic agent only of Inc.: detritylation solution is 2% TCA (ABI) in methylene dichloride; Be used among the THF 16% N-Methylimidazole (ABI) and in THF 10% diacetyl oxide/10% 2,6-lutidine (ABI) adds cap; Oxidizing solution is 16.9mM I in THF ₂, 49mM pyridine, 9% water (Millipore).B﹠amp; The synthetic level of S acetonitrile is directly taken from reagent bottle.S-ethyl tetrazolium solution (0.25M in acetonitrile) is by (AmericanIntemational Chemical, solid Inc.) is made available from the international chemical company of the U.S..

The following RNA deprotection that carries out.The oligoribonucleotide that the polymer bonded is not had a trityl is transferred to 4mL glass screw cap bottle from synthetic post, and is suspended from methylamine (MA) solution 10 minutes at 65 ℃.After being cooled to-20 ℃, remove supernatant from Support Polymer.EtOH with 1.0mL: MeCN: H ₂O/3: the washing upholder was 3 times in 1: 1, and the vortex vibration is added to supernatant in the primary supernatant then.The supernatant that contains oligoribonucleotide that merges is drained into white powder.

The oligoribonucleotide of base deprotection is resuspended in the anhydrous TEAHF/NMP solution (the solution 250 μ L of 1.5mLN-methyl-2-pyrrolidone, 750 μ L TEA and 1.0mL TEA3HF are to provide 1.4MHF), and is heated to 65 ℃ of 1.5h.With the oligomer of the abundant deprotection that obtained before the anionresin desalination with 50mM TEAB (9mL) cancellation.

For the deprotection oligomer is carried out the anionresin desalination, TEAB solution is splined on Qiagen 500 with 50mM TEAB (10mL) prewashing ^On the anion-exchange column (QiagenInc.).After having gone up the post of sample, with TEAB (10mL) eluted rna of 2M and drain into white powder with 50mM TEAB (10mL) washing.

By displacement conversion G ₅A ₆Order and with A ₁₄Be replaced as U and synthesize the hammerhead ribozyme (by Hertel, K.J. etc., 1992, nucleic acids research 20,3252 is numbered) of non-activity.The ribozyme of non-activity also can pass through G ₅Be replaced as U and A ₁₄Being replaced as U synthesizes.In some cases, the sequence of substrate brachium conjunctivum is at random, but keeps overall based composition.

Average per step coupling productive rate greater than 98% (Wincott etc., 1995, nucleic acids research 23,2677-2684).

The hair clip type ribozyme is divided into two partial synthesis, and the activated ribozyme of reconstruction of annealing then (Chowrira and Burke, 1992, nucleic acids research 20,2835-2840).Utilize the T7 phage rna polymerase also can synthesize ribozyme (Milligan and Uhlenbeck, 1989, Enzymology method (Methods Enzymol.) 180,51) by dna profiling.

Improve stability and/or improve catalytic activity by ribozyme being modified with nuclease resistance group, for example, 2 '-amino, 2 '-C-allyl group, 2 '-fluorine-based, 2 '-O-methyl, 2 '-H, nucleotide base modify that (summary is seen Usman and Cedergren, 1992, TIBS 17,34; Usman etc., 1994, Nucleic Acids Symp.Ser.31,163; Burgin etc., 1996, biological chemistry 6,14090).

Utilize common method by gel electrophoresis purifying ribozyme, perhaps by high pressure liquid chromatography (HPLC) (HPLC; See Stinchcomb etc., PCT international publication number WO 95/23225 is this its whole being introduced into as a reference) come purifying, and be resuspended in the water.

The sequence of the synthetic ribozyme of effective chemical is shown in table IV-IX in this research.Those skilled in the art will think that these sequences only are the representatives of more these type of sequences, and the enzyme part (except that brachium conjunctivum whole) that has changed ribozyme in described sequence influences activity.For example, the stem ring II sequence that can change (displacement, disappearance and/or insertion) hammerhead ribozyme contains any sequence, as long as can form the stem structure of minimum 2 base pairs.Similarly, the stem ring IV sequence that can change (displacement, disappearance and or insertion) hair clip type ribozyme contains any sequence, as long as can form the stem structure of minimum 2 base pairs.Preferably insert and be no more than 200 bases in these sites.Listed sequence can form ribonucleotide or other Nucleotide or non-nucleotide in table IV-IX.This type of ribozyme (having enzymatic activity) is equivalent to specifically described ribozyme in table.

Optimize ribozyme activity

The catalytic activity of described ribozyme can be according to by Drapper etc. in the present invention, and is the same, described being optimized.Detail will no longer repeat herein, comprise that substantially ribozyme that the length that changes the ribozyme brachium conjunctivum or chemosynthesis have modification (base, sugar and/or phosphoric acid) is to stop it by serum Yeast Nucleic Acid enzyme liberating and/or improve its enzymatic activity and (for example see, Eckstein etc., international publication number WO 92/07065; Perrault etc., 1990, nature 344,565; Pieken etc., 1991, science 253,314; Usman and Cedergren, 1992, biological chemistry science trend (Trends in Biochem.Sci.) 17,334; International publication number WO93/15187 such as Usman; And Rossi etc., international publication number WO91/03162; Sproat, U.S. Patent number 5,334,711; And Burgin etc., the same; All these have described the various chemically modifieds of base, phosphoric acid and/or the sugar moieties that can be used for enzyme RNA molecule).Modification needs with the demand that improves their effectiveness in cell and the removal base shortens RNA generated time and reduction chemical from loop-stem structure.(being incorporated herein all these publications as a reference).

Example in several this areas is arranged, and it has been described and can be introduced into the enzyme nucleic acid molecule and not remarkably influenced catalysis significantly improves their stability and the sugar of effectiveness and modifications of phosphoric acid to nuclease.Improve stability and/or improve catalytic activity by ribozyme being modified with nuclease resistance group, for example, 2 '-amino, 2 '-C-allyl group, 2 '-fluorine-based, 2 '-O-methyl, 2 '-H, nucleotide base modify that (summary is seen Usman and Cedergren, 1992, TIBS 17,34; Usman etc., 1994, NucleicAcids Symp.Ser.31,163; Burgin etc., 1996, biological chemistry 6,14090).The modification of the sugar of enzyme nucleic acid molecule has been carried out describing widely (seeing Eckstein etc., international publication number WO 92/07065 in this area; Perrault etc., nature 1990,344,565-568; Pieken etc., science 1991,253,314-317; Usman and Cedergren, biological chemistry science trend (Trends in Biochem.Sci.) 1992,17,334-339; International publication number WO93/15187 such as Usman; Sproat, U.S. Patent number 5,334,711; And Beigelman etc., 1995, journal of biological chemistry 270,25702; All be incorporated herein by reference at these all these reference) by complete.This type of publication has described that ribozyme is mixed in definite sugar, base and/or phosphoric acid modification etc. and the general method and the strategy that do not suppress catalytic site, and is incorporated herein by reference.In view of this type of instruction, similarly modification can be used to modify nucleic acid catalytic materials of the present invention as described here.

The invention provides the nucleic acid catalytic materials of chemically modified, it is kept or has improved enzymatic activity.This type of nucleic acid is also stronger to the nuclease resistance than the nucleic acid of unmodified usually.Therefore, in cell and/or in the body, activity will can significantly not reduce.As demonstrated here, though this type of ribozyme in cell and/or in the body overall activity to have reduced by 10 times also be effectively (Burgin etc., 1996, biological chemistry 35,14090).This type of ribozyme is called at all RNA ribozymes herein and " has kept " enzymatic activity.

The therapeutic ribozyme that external source gives must be preferably stable in cell, is suppressed the sufficiently long time to reduce unnecessary proteic level until the translation of target RNA.According to the state of disease, this time period was not waited from a few hours to a couple of days.Be clear that in order to bring into play function as effective cell internal therapy agent, ribozyme must have resistance to nuclease.The progress of RNA chemosynthesis (Wincott etc., 1995, nucleic acids research 23,2677; Be incorporated herein by reference at this) expanded the ability of modifying ribozyme, promptly by introducing nucleotide modification to improve its ribozyme stability.

The base that comprises natural base well known in the art (standard) and modification that " Nucleotide " used herein is thought as this area.This base analog is usually located on the 1 ' position of sugar moieties.Nucleotide generally includes a base, sugar and a phosphate group.Nucleotide can for unmodified or modified at sugar, phosphoric acid and/or base portion, (also can be called as nucleotide analog, the Nucleotide of modification, non-natural nucleotide, non-standard Nucleotide etc.; Example is seen Usman and McSwiggen, and is the same; Eckstein etc., PCT international publication number WO 92/07065; Usman etc., PCT international publication number WO93/15187; All all are introduced into as a reference at this).The example that the nucleic acid base of several modifications known in the art is arranged, and recently by Limbach etc., 1994, nucleic acids research 22,2183 is summed up.Can be introduced into the enzyme nucleic acid molecule and some limiting examples of the base modification of its catalytic activity of not remarkably influenced comprise inosine, purine, pyridine-4-ketone, pyridin-2-ones, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, the 3-6-Methyl Uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkyl cytidine(C (for example, the 5-methylcytosine nucleosides), 5-alkyl urea pyrimidine nucleoside (for example, thymine ribonucleoside), 5-halogen uridine (for example, the 5-bromouracil nucleosides) or 6-nitrogen pyrimidine or 6-alkyl pyrimidine (for example, the 6-methyluridine) or the like (Burgin etc., 1996, biological chemistry, 35,14090)." base of modification " meaning aspect this at the nucleotide base except that VITAMIN B4, guanine, cytosine(Cyt) and uridylic on the 1 ' site or its Equivalent; This base analog can be used for the catalytic core and/or the substrate land of enzyme.

" no base " means not to be had base or has other chemical groups to replace the sugar moieties of base on 1 ' site.

" Nucleotide of unmodified " means on the 1 ' carbon that one of bases adenine, cytosine(Cyt), guanine, uridylic be connected to β-D-ribofuranose.

" Nucleotide of modification " means any nucleotide base, has modification in the chemical structure of its nucleotide base at unmodified, sugar and/or phosphoric acid.

Can carry out the practicality that various modifications improve ribozyme to the ribozyme structure.For example, thus this type of modification will improve this type of ribozyme life-span, vitro half-lives, stability and with the simplification that this type of ribozyme is introduced target site improve cell membrane penetrate and make it to have identification and in conjunction with the ability of target cell.

Bestowing of ribozyme

Sullivan etc., PCT WO 94/02595 have described and have been used to give the enzyme RNA general method of molecule.Can by the method for being familiar with known to the those skilled in the art ribozyme be bestowed cell by multiple, comprise, but be not limited to be wrapped in the liposome, by iontherapy or by mixing other carriers, for example in hydrogel, cyclodextrin, biodegradable nanocapsule and the bioadhesive microsphere.In some explanation, can with or need not foregoing carrier the direct ex vivo of ribozyme be thrown and give cell or tissue.Perhaps, by injection or with conduit, infusion pump or support RNA/ carrier combinations part is thrown in.Other dosing ways include, but not limited in the blood vessel, intramuscular, subcutaneous or joint injection, aerosol suck, offer medicine in oral (tablet or pill), part, system, eye, intraperitoneal and/or the sheath.Ribozyme dispensing and the description of bestowing more specifically are provided in Sullivan etc., the same and Draper etc., and among the PCT WO93/23569, it is incorporated herein by reference.

Molecule of the present invention can be used as medicinal agent.Medicinal agent stops, suppresses a kind of generation of morbid state or it is treated (relief of symptoms, preferably all symptoms) to a certain extent in the patient.

By the method for any standard, have or do not have stablizer, damping fluid etc. to form pharmaceutical composition, can bestow electronegative polynucleotide of the present invention (for example, RNA, DNA or protein) and introduce among the patient.When needs utilize lipid or liposome dispensing mechanism, can follow the collocation method of standard.Composition of the present invention can also followingly be configured and use: the tablet, capsule or the elixir that are used for oral dispenser; The suppository that is used for the rectum dispenser; Sterile solution; Be used for suspension of injectable dispenser or the like.

The present invention also comprises the pharmaceutically acceptable preparation of described compound.These preparations comprise the salt of above-claimed cpd, for example, and acid salt, for example hydrochloride, hydrobromate, acetate and benzene sulfonate.

Pharmacology composition or preparation refer to the composition or the preparation of certain form, and described form is suitable for to cell or patient, dispenser in the preferred human body, for example system's dispenser.Suitable form partial dependency approach that use or that enter, for example oral, through skin or by injection.This type of form should not stop composition or preparation to arrive target cell (that is, the electronegative polymer of expection cell that throwing is given).For example, the pharmacology composition that is expelled in the blood flow should be soluble.Other factors are known in this area, and comprise and for example consider toxicity and stop composition or preparation, bring into play the form of its effect.

" system bestows " is meant that the system of the inherent blood flow Chinese traditional medicine of body absorbs or accumulation, and whole body subsequently distributes.Cause that the drug delivery route that system absorbs includes, but are not limited to: in intravenously, subcutaneous, intraperitoneal, suction, oral, the lung and intramuscular.All with the electronegative polymer of purpose, for example nucleic acid is exposed to come-at-able diseased tissue in these drug delivery routes each.Medicine enters the function that the round-robin ratiometer is shown molecular weight or size.Comprise that the liposome of The compounds of this invention or the application of other drug carrier can effectively locate medicine, for example in particular tissue type, in the tissue as reticuloendothelial system (RES).A kind ofly can promote that medicine and the Liposomal formulation that connects each other such as lymphocyte and the isocellular surface of scavenger cell also are effective.This method is by utilizing scavenger cell and lymphocyte to abnormal cells, and for example the hepatocellular immune identification specificity that infects of HCV can improve medicine and gives to the throwing of target cell.

Also with a kind of feature that is applied as of composition, described composition comprises the liposome that contains polyethyleneglycol lipid (liposome that PEG modifies or long-term circulating liposome or stealth (stealth) liposome) of finishing in the present invention.These preparations provide a kind of method that medicine is accumulated at target tissue that is used for increasing.The conditioning and the removing of this class pharmaceutical carrier opposing mononuclear phygocyte system (MPS or RES), therefore can prolong blood circulation time and increase the contacting of institute's packaging medicine and tissue (Lasic etc., chemistry is summarized (Chem.Rev.) 1995,95,2601-2627; Ishiwata etc., chemistry and pharmacy circular (Chem.Pharm.Bull.) 1995,43,1005-1011).This lipoid plastid is indicated in the tumour optionally to be accumulated, and may catch (Lasic etc., science 1995,267,1275-1276 by outer the blending in the target tissue of angiogenesis; Oku etc., 1995, biological chemistry and biophysics journal (Biochim.Biophys.Acta), 1238,86-90).Long-term circulating liposome has improved pharmacokinetics and the pharmacodynamics of DNA and RNA, particularly compares (Liu etc., journal of biological chemistry 1995,42,24864-24870 with traditional known cationic-liposome of accumulating in the MPS tissue; Choi etc., PCT international publication number WO 96/10391; Ansell etc., PCT international publication number WO 96/10390; Holland etc., PCT international publication number WO 96/10392; All these all are introduced into as a reference at this).All these all are introduced into as a reference at this.

In addition, other cationic molecule also can be used to throw in molecule of the present invention.For example, ribozyme can be bonded to glycosylated poly (L-Methionin), its demonstration can improve location (Nakazono etc., 1996, hepatology 23, the 1297-1303 of antisense oligonucleotide in liver; Nahato etc., 1997, biological chemistry and pharmacy (Biochem Pharm.) 53,887-895).Glycosylated poly (L-Methionin) can be covalently attached to enzyme nucleic acid or be incorporated into enzyme nucleic acid by electrostatic interaction.

The present invention also is included as storage or dispenser and the composition for preparing, and it comprises the purpose compound of medicinal significant quantity in pharmaceutically acceptable carrier or thinner.The pharmaceutically acceptable carrier or the thinner that are used for the treatment of application are known at pharmaceutical field, and for example be described in Remington pharmaceutical science (Remington ' sPharmaceutical Sciences), (A.R.Gennaro compiles Mack Publishing Co., 1985) in, be introduced into as a reference this its.For example can add sanitas, stablizer, dyestuff and flavouring agent.The same 1449 pages.These comprise Sodium Benzoate, Sorbic Acid and metagin.In addition, can use antioxidant and suspension agent.

Medicinal effective dose is the required dosage of prevention, the generation that suppresses morbid state or treatment morbid state (relief of symptoms, preferably symptomatology to a certain extent).Medicinal effective dose depends on the type, compositions for use, drug delivery route, the mammalian-type of treatment, selected specific mammiferous corporal characteristic of disease, medicine and other factors of usefulness simultaneously, and the technician of medical field will understand these.Usually, bestow quantity at the activeconstituents of 0.1mg/kg between the 100mg/kg body weight/day according to the polymeric effectiveness of Supreme Being's negative charge.

Perhaps, can be by eukaryotic promoter in cell inner expression enzyme nucleic acid molecule of the present invention (for example, Izant and Weintraub, 1985, science 229,345; McGarry and Lindquist, 1986, institute of NAS newspaper 83,399; Scanlon etc., 1991, institute of NAS newspaper 88,10591-5; Kashani-Sabet etc., 1992, antisense progress (Antisense Res.Dev.) 2,3-15; Dropulic etc., 1992, Journal of Virology 66,1432-41; Weerasinghe etc., 1991, Journal of Virology, 65,5531-4; Ojwang etc., 1992, institute of NAS newspaper 89,10802-6; Chen etc., 1992, nucleic acids research 20,4581-9; Sarver etc., 1990, science 247,1222-1225; Thompson etc., 1995, nucleic acids research 23,2259; Good etc., 1997, gene therapy (Gene Therapy) 4,45; All reference all by complete introducing herein as a reference).Skilled in the art will recognize that any nucleic acid can both be by suitable DNA/RNA vector expression in eukaryotic cell.The activity of this type of nucleic acid can obtain amplifying (Draper etc., PCT WO93/23569, and Sullivan etc., PCT WO94/02595 by by ribozyme it being discharged from original transcripton; Ohkawa etc., 1992, Nucleic Acids Symp.Ser., 27,15-6; Taira etc., 1991, nucleic acids research 19,5125-30; Ventura etc., 1993, nucleic acids research, 21,3249-55; Chowrira etc., 1994, journal of biological chemistry 269,25856; All reference all by complete introducing herein as a reference).

In another aspect of the present invention, the enzyme nucleic acid molecule of cutting target molecule is expressed (seeing Couture etc. for example, 1996, TIG., 12,510) by being inserted into transcription unit in DNA or the RNA carrier.Recombinant vectors is preferably DNA plasmid or virus vector.The virus vector of ribozyme expression can based on, but be not limited to adeno-associated virus (AAV), retrovirus, adenovirus or α virus and make up.Preferred throw as mentioned above give can ribozyme expression recombinant vectors, and in target cell, keep.Perhaps, can utilize the virus vector of transient expression ribozyme.Examples of such carriers can be bestowed as required repeatedly.In case express, ribozyme just cuts said target mrna.Activated ribozyme contains the enzyme center or the core that are equal in the example those, and can be in conjunction with the brachium conjunctivum of target nucleic acid molecule, so that cut at target site.Can there be other sequences of not disturbing this cutting.The dispensing of the carrier of ribozyme expression can be for system, for example bestow by intravenously or intramuscular, by bestowing from the target cell of patient's outer planting, again introduce the patient subsequently, perhaps (summary is seen Couture etc. to any other mode by can introducing the purpose target cell, 1996, TIG.12,510).

Aspect of feature of the present invention, a kind of expression vector that contains nucleotide sequence is disclosed, at least a nucleic acid catalyst of the present invention of described nucleic acid sequence encoding.The mode that can express with a kind of nucleic acid molecule that makes code book invention nucleic acid catalyst this nucleotide sequence that is operably connected.

In feature of the present invention on the other hand, expression vector comprises: a) transcribe Qi Shiqu (for example, eucaryon pol I, II or III open the beginning district) for one; B) transcription termination region (for example, eucaryon pol I, II or III terminator); C) gene of at least a nucleic acid catalyst of the present invention of coding; And wherein described gene be may be operably coupled to described begin district and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.Carrier can comprise or not comprise proteinic open reading frame (ORF) and/or intron (intervening sequence), and described open reading frame is operably connected to the 5 ' side or the 3 ' side of the gene of code book invention nucleic acid catalyst.

Transcribing of ribozyme sequence is promoters driven by eucaryotic RNA polymerase I (pol I), RNA polymerase II (pol II) or RNA polymerase III (pol III).The transcripton of pol II or pol III promoters driven will be in all cells high level expression; The level of given pol II promotor will depend on the character of its contiguous gene regulating sequence (enhanser, silencer etc.) in a given cell.As long as prokaryotic rna polymerase can be expressed, then also can use prokaryotic rna polymerase promotor (Elroy-Stein and Moss, 1990, institute of NAS newspaper, 87,6743-7 in suitable cell; Gao and Huang, 1993, nucleic acids research, 21,2867-72; Lieber etc., 1993, Enzymology method, 217,47-66; Zhou etc., 1990, molecular cytobiology (Mol.Cell.Biol.), 10,4529-37).Verified the ribozyme of several investigators can in mammalian cell, play a role (for example, Kashani-Sabet etc., 1992, antisense progress 2,3-15 by this class promoter expression; Ojwang etc., 1992, institute of NAS newspaper, 89,10802-6; Chen etc., 1992, nucleic acids research, 20,4581-9; Yu etc., 1993 institutes of NAS newspaper, 90,6340-4; L ' Huillier etc., 1992, EMBO's magazine 11,4411-8; Lisziewicz etc., 1993, institute of NAS newspaper, 90,8000-4; Thompson etc., 1995, nucleic acids research 23,2259:Sullenger and Cech, 1993, science, 262,1566).More particularly, transcription unit can effectively produce high density purpose RNA molecule such as ribozyme in cell, described transcription unit for example derived from the unit of U6 small nut encoding gene (snRNA), transfer RNA (tRNA) and adenovirus VA RNA (Thompson etc., the same; Couture and Stinchcomb, 1996, the same; Noonberg etc., 1994, nucleic acids research, 22,2830; Noonberg etc., U.S. Patent number 5,624,803; Good etc., 1997, gene therapy 4,45; Beigelman etc., PCT international publication number WO96/18736; All these publications all are introduced into as a reference at this).Above-mentioned ribozyme transcription unit can be incorporated into for introduction in the variety carrier in the mammalian cell, include but not limited to, (summary is seen Couture and Stinchcomb for plasmid DNA carrier, viral DNA carrier (for example adenovirus or adeno-associated virus (AAV) carrier) or viral rna vector (for example retrovirus or α virus vector), 1996, the same).

On the other hand, the present invention also comprises that with a kind of the expression vector of nucleotide sequence is a feature, at least a catalytic nucleic acid molecule of the present invention of described nucleic acid sequence encoding, and described expression vector comprises this nucleotide sequence in a kind of mode that makes this nucleic acid molecule to express.In one embodiment, expression vector comprises: a) transcribe Qi Shiqu for one; B) transcription termination region; C) the encode gene of at least one described nucleic acid molecule; Wherein described gene be may be operably coupled to described begin district and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.In another embodiment preferred, expression vector comprises: a) transcribe Qi Shiqu for one; B) transcription termination region; C) open reading frame; D) the encode gene of at least one described nucleic acid molecule wherein may be operably coupled to 3 ' of described open reading frame-end with described gene; And wherein described gene be may be operably coupled to described beginning district, described open reading frame and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.In another embodiment, expression vector comprises: a) transcribe Qi Shiqu for one; B) transcription termination region; C) intron; D) the encode gene of at least one described nucleic acid molecule; Wherein described gene be may be operably coupled to described beginning district, described intron and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.In another embodiment, expression vector comprises: a) transcribe Qi Shiqu for one; B) transcription termination region; C) intron; D) open reading frame; E) the encode gene of at least one described nucleic acid molecule wherein may be operably coupled to 3 ' of described open reading frame-end with described gene; And wherein described gene be may be operably coupled to described beginning district, described intron and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.

Interferon, rabbit

Interferon type (IFN) is the natural cytokine of a class, it comprise an IFN-α family that surpasses 25 members (Pesta, 1996, Enzymology method 119,3-14) and IFN-β and IFN-ω.Though (540-552), there are a lot of difference in Diaz etc., genomics (Genomics) 22 in the primary sequence of these molecules, prompting is at the evolutionary divergence of biologic activity to come from identical gene in the evolution.All I type Interferon, rabbit have common biological effect pattern, its start from the combining of IFN and cell surface receptor (Pfeffer and Strulovici, 1992, IFN-α/β strides the film secondary messager.: Interferon, rabbit, principle and medical use (Interfon.Principles and Medical Applications), S.Baron, D.H.Coopenhaver, F.Dianzani, WR.Fleischmann Jr, T.K.Hughes Jr., G.R.Kimpel, D.W.Niesel, G.J.Stanton, and S.K.Tyring, compile, 151-160).In conjunction with postactivated Tyrosylprotein kinase, comprise Janus Tyrosylprotein kinase and stat protein, its cause producing the gene product that several IFN stimulate (Johnson etc., 1994, Scientific Beauty compatriots (Sci.Am.) 270,68-75).The gene product that IFN stimulates causes many biotropisms effects of I type Interferon, rabbit, comprise antiviral, antiproliferative and immunomodulatory effect, the inducing and adjusting (Pestla etc., 1987 of HLA I class and II class of cytokine, biological chemistry yearbook (Annu.Rev.Biochem) 56,727).The example of IFN stimulated gene product comprises 2-5-oligo-adenylate synthetase (2-5 OAS), β ₂-microglobulin, neopterin, p68 kinases and Mx albumen (Chebath and Revel, 1992,2-5A system: 2-5A synthetic enzyme, isozyme and function.: Interferon, rabbit, principle and medical use (Interfon.Principles andMedical Applications), S.Baron, D.H.Coopenhaver, F.Dianzani, W.R.Jr.Fleischmann, T.K.Jr.Hughes, G.R.Kimpel, D.W.Niesel, G.H.Stanton, and S.K.Tyring, compile 225-236; Samuel, 1992, the Pl/eIF-2 α protein kinase that RNA relies on.: Interferon, rabbit, principle and medical use (Interfon.Principles and MedicalApplications), S.Baron, D.H.Coopenhaver, F.Dianzani, W.R.Fleischmann Jr.T.K.Hughes Jr., G.R.Kimpel, D.W.Niesel, G.H.Stanton, and S.K.Tyring, compile 237-250; Horisberger, 1992, MX albumen: function and mechanism of action.: Interferon, rabbit, principle and medical use (Interfon.Principles and MedicalApplications), S.Baron, D.H.Coopenhaver, F.Dianzani, W.R.Fleischmann Jr., T.K.Hughes Jr., G.R.Kimpel, D.W.Niesel, G.J.Stanton, and S.K.Tyring, compile, 215-224).Though all I type IFN have similar biological effect, be not that every kind of I type IFN all has all activity, and under many circumstances, the very big (Fish etc. of activity difference for every kind of IFN hypotype, 1989, Interferon, rabbit research magazine (J.InterferonRes.) 9,97-114; Ozes etc., 1992, Interferon, rabbit research magazine 12,55-59).More particularly, to the molecular hybridization of the research of different subtype IFN-α character and IFN-α show pharmacological property difference (Rubinstein, 1987, Interferon, rabbit research magazine 7,545-551).These pharmacology difference may because of few change to 3 amino-acid residues (Lee etc., 1982, cancer research (CancerRes.) 42,1312-1316).

85 to 166 amino acid are guarded in known IFN-alpha hypotype.Get rid of IFN-α pseudogene, nearly 25 known different I FN-alpha hypotypes.The paired comparisons of these non-allelic genes hypotypes shows that the difference of primary sequence is in 2% to 23% scope.Except naturally occurring IFN, synthesized the non-natural reorganization I type Interferon, rabbit that is known as common interference element (CIFN) as therapeutic compound (Tong etc., 1997, hepatology 26,747-754).

At present Interferon, rabbit be used at least 12 kinds of different indications comprise transmissible disease and autoimmune disease and cancer (Borden, 1992, New England Journal of Medicine (N.Engl.J.Med.) 326,1491-1492).For autoimmune disease, IFN is used to treat rheumatoid arthritis, multiple sclerosis and Crohn ' s disease.For treatment for cancer, IFN is used alone or unites use with multiple different compounds.Used the cancer of the particular type of IFN to comprise squamous cell carcinoma, melanoma, hypernephroma, vascular tumor, hairy cell leukemia and Kaposi ' s sarcoma.In the transmissible disease treatment, IFN increases the activate the phagocytic capacity and the lymphocytic cytotoxic activity of scavenger cell, and suppresses the breeding of cytopathy substance.Specificity indication with IFN treatment comprises: and hepatitis B, 6 and 11 type human papillomaviruss (being Genital warts) (Leventhal etc., 1991, New England Journal of Medicine 325,613-617), chronic granulomatous disease and hepatitis C virus.

In chronic HCV infection treatment, utilize the clinical trials of a lot of good controls of IFN-α to confirm to treat weekly 3 times and when 6 months treatment finishes, cause that among the patients of about 50% (from 40% to 70%) the Serum ALT value reduces (Davis etc., 1989, New England Journal of Medicine 321,1501-1506; Marcellin etc., 1991, hepatology 13,393-397; Tong etc., 1997, hepatology 26,747-754; Tong etc., hepatology 26,1640-1645).Yet, after interferon therapy stops, the about 50% patient's recurrence that responds, " continuing " reactivity that causes estimating by Serum ALT concentration is about 20 to 25%.In addition, the change that utilizes HCV RNA value is as clinical end of the final point, 6 months I type interferon therapies detected confirmation can't detect HCV RNA (Tong etc., 1997, the same) up to 35% patient when treatment finishes.Yet for the ALT end of the final point, about 50% patient stops recurrence in back 6 months in treatment, and the virusology reaction that causes continuing only is 12% (23).The lasting virusology that studies confirm that to the treatment of 48 weeks is reacted up to 25%.

Ribozyme associating IFN has the potential that improves HCV or above-mentioned any other indication result of treatment.Target in disease, for example the ribozyme of the RNA that transmissible disease, autoimmune disease and cancer are relevant can use separately or unite to improve curative effect with other treatment such as IFN.

Embodiment

Be non-restrictive example below, it has shown screening, the separation, synthetic and active of enzyme nucleic acid molecule of the present invention.

The following examples have been described the screening of the ribozyme of cutting HCV RNA.Method described here is represented a scheme, can derive the ribozyme that other HCV of cutting duplicate required RNA target by this scheme.

Embodiment 1: the evaluation of potential ribozyme cleavage site in HCV RNA

Utilize come-at-able site in the sequence of a kind of computer folding algorithm screening HCVRNA.To not form the secondary pleated sheet structure and contain potential tup type and/or the mRNA zone of hair clip type ribozyme cleavage site identifies out.The sequence of these cleavage sites is shown in table IV-VIII.

Embodiment 2: the screening of ribozyme cleavage site in HCV RNA

For detect by the prediction of computer based RNA folding algorithm the site whether with in HCVRNA can be corresponding near the site, select 20 tup type sites to be used for analysis.Genome sequence (list entries=HPCJTA (Acc#D11168 and D01171)) by analyzing HCV and according to the priority in fold arrangement site, and select the target site of ribozyme.Design can be in conjunction with the hammerhead ribozyme (see figure 1) of each target, and by computer folding single analysis (Christoffersen etc., 1994, J.Mol.Struc.Theochem, 31l, 273; Jaeger etc., 1989, institute of NAS newspaper, 86,7706) estimate ribozyme sequence and whether be folded into suitable secondary structure.Those ribozymes that have disadvantageous intramolecular interaction between brachium conjunctivum and catalytic core are not considered.As described below, can select different brachium conjunctivum length to optimize activity.Usually, at least 5 bases can be bonded to target RNA or interact with target RNA on each arm.

By the scanning from all tup type cleavage sites in the HCV RNA sequence of HCV genotype 1b institute infected patient is begun the screening of ribozyme subjects.The results are shown in the table III of this sequential analysis.As seeing, go out 1300 hammerhead ribozyme sites by this Analysis and Identification by the table III.Then, in order to identify the hammerhead ribozyme subjects that in the genomic conservative region of HCV, to cut, finished from the sequence alignment of about 50 HCV strain isolateds of genotype 1a, 1b, 2a, 2b, 2c, 3a, 3b, 4a, 5a and 6 and arranged.In genotype, identify the site in the zone that between all tested strain isolateds, has the maximal sequence homogeny.This analysis is reduced to about 23 (table III) with the hammerhead ribozyme subjects.

Because the genomic height sequence of HCV mutability, being used for extensively, the screening of the ribozyme of treatment application may should relate to the genomic conserved regions of HCV.(5 ' of 5 '-non-coding region (NCR), core protein coding region-end and 30 hammerhead ribozymes of row of 3 '-NCR) are shown in the table IV to be derived from HCV genome conserved regions.Usually, be that the ribozyme of target should be blocked translation with the site that is positioned at HCV genome 5 ' stub area, and being positioned at the ribozyme of genome 3 ' stub area, cleavage site should block rna replicon.

Embodiment 3: the chemosynthesis of ribozyme and purifying

The ribozyme of design tup type or hair clip type primitive and each the site annealing among the RNA courier.Brachium conjunctivum and the complementation of above-mentioned target site sequence.Ribozyme is carried out chemosynthesis.Used synthetic method according to as at Usman etc. (1987; American Chemical Society's magazine (J.Am.Chem.Soc.) 109; 7845), Scaringe etc., (1990, nucleic acids research; 18; 5433) and Wincott etc., the same, described in the synthetic method of conventional RNA; and utilize nucleic acid protection and coupling group commonly used, for example at the dimethoxytrityl of 5 '-end and at the phosphoramidite of 3 '-end.Average per step coupling productive rate is greater than 98%.

By displacement conversion G ₅A ₆Order and with A ₁₄Be replaced as U and synthesize the hammerhead ribozyme (press Hertel etc., 1992, nucleic acids research 20,3252 numbering) of non-activity.The hair clip type ribozyme is divided into two partial synthesis, and the activated ribozyme of reconstruction of annealing then (Chowrira and Burke, 1992, nucleic acids research 20,2835-2840).Utilize the T7 phage rna polymerase also can synthesize ribozyme (Milligan and Uhlenbeck, 1989, Enzymology method 180,51) by dna profiling.Improve stability by ribozyme being modified with nuclease resistance group, for example, 2 '-amino, 2 '-C-allyl group, 2 '-fluorine-based, 2 '-O-methyl, 2 '-H (summary is seen Usman and Cedergren, 1992, and TIBS 17,34; ).Utilize common method by gel electrophoresis purifying ribozyme, perhaps by high pressure liquid chromatography (HPLC) (HPLC; See Wincott etc., the same, this its whole being introduced into as a reference) come purifying, and be resuspended in the water.The sequence of used chemosynthesis ribozyme is shown in table IV-IX in this research.

Embodiment 4: ribozyme is to the external cutting of HCV RNA target

Design and synthesize the ribozyme of target as mentioned above in HCV.Nicking activity that can these ribozymes of vitro detection, for example profit in the following method.Target sequence and nucleotide position in HCV in the table IV, have been provided.

Cleavage reaction: [α- ³²P] there is down the target RNA that is used for total length that the ribozyme cutting detects or part total length, inner marker by the in-vitro transcription preparation in CTP, and by G50 Sephadex gel column rotation chromatography, need not be further purified and promptly can be used as substrate RNA.Perhaps utilize the T4 polynucleotide kinase substrate is carried out 5 '- ³²The p end mark.By cutting damping fluid (50mM Tris-HCl, pH7.5 in the time of 37 ℃, 10mM MgCl at ribozyme ₂) in the ribozyme of purifying of preheating 2 * concentration detect, and by to also in the cutting damping fluid in the equal-volume substrate RNA (being 1-5nM to the maximum) of preheating adding 2 * ribozyme mixture start cleavage reaction.As initial screening, utilize final concentration to detect 1 hour at 37 ℃ for the ribozyme of 40nM or 1mM, that is, ribozyme is excessive.By adding the blue termination reaction of isopyknic 95% methane amide, 20mMEDTA, 0.05% tetrabromophenol sulfonphthalein and 0.05% dimethylbenzene nitrile, subsequently sample is heated to 95 ℃ 2 minutes, cooling rapidly, and be splined on denaturing polyacrylamide gel.The specific RNA cleaved products development that in the radioautograph of gel, makes substrate RNA and produce by the ribozyme cutting.The PhosphorImager of the band by representing intact substrate and cleaved products ^Quantitatively determine the per-cent of cutting.

The ability of embodiment 5:HCV ribozyme cutting HCV RNA in the patients serum

The modification that utilization provides the nuclease resistance is synthesized (Beigelman, 1995, journal of biological chemistry 270,25702) to the ribozyme in the site of target in HCVRNA.Verified, contain average 3 * 10 from chronic hepatitis C patient's serum ⁶The HCV RNA of individual copy/ml.In order further to screen candidate's ribozyme product, utilization isolating HCV RNA from genotype 1b HCV patient's serum has identified the HCV RNA nicking activity of 30 HCV specific ribozymes.The best subjects that screening by HCV genotype 1b is obtained is used from the genotypic strain isolated of HCV widely and is screened, and described genotype comprises 1a, 1b, 2a, 2b, 2c, 3a, 3b, 4a, 5a and 6.Therefore, the ribozyme that is used for further exploitation according to the extensive cutting of ribozyme subjects from the ability screening of the HCV RNA of multiple HCV genotype and quasispecies.

Embodiment 6: ribozyme is to the external cutting of conservative HCVRNA target site

In a genotype and the genome area of 3 high conservatives all arranged between different genotype.These conserved sequences appear at 5 ' of 5 ' and 3 ' non-coding region (NCR) and core protein coding region-end.It is important that these zones are considered to for HCV rna replicon and translation.Therefore, target may have remarkable influence to HCV genotype widely in the therapeutical agent of these conservative HCV genome areas.The key feature that may make it to become effective treatment that the existence of quasispecies and more than a kind of genotype infect.In addition, drug resistance will unlikely take place, because be considered to cause that the sudden change of drug resistance can not occur in the zone of these high conservatives usually.For the chance of target several genes type and reduction generation drug resistance, the applicant has designed has the ribozyme that cuts in the zone of homogeny in above-mentioned conservative region.

5 ' end and 3 ' NCR for 5 ' NCR, core protein coding region have carried out the sequence alignment arrangement.For 5 ' NCR, 34 different strain isolateds representing genotype 1a, 1b, 2a, 2b, 3a, 3b, 4a, 4f and 5a have been carried out alignment arranged.Alignment is arranged and to be comprised from nucleotide site 1 to nucleotide site 350 sequence (18 Nucleotide in ATG atg start codon downstream), utilizes the reference as numbering of the sequence " HPCK1S1 " reported.For the core protein coding region, 44 different strain isolateds representing genotype 1a, 1b, 2a, 2b, 2c, 3a, 3b, 4a, 4c, 4f, 5a and 6a have been carried out alignment arranged.These alignment are arranged and are comprised 600 Nucleotide, start from 8 Nucleotide in upstream of ATG atg start codon.Reference as numbering has utilized the sequence of being reported " HPCCOPR ", and the 8th Nucleotide " C " of atg start codon ATG upstream is appointed as " 1 ".For 3 ' NCR district, 20 different strain isolateds representing genotype 1b, 2a, 2b, 3a and 3b have been carried out alignment arranged.The sequence in 235 Nucleotide that comprise genome 3 ' end is arranged in these alignment, and the sequence of being reported " D85516 " is used as the reference of numbering, and will be appointed as " 1 " from the 235th Nucleotide of 3 ' end.

In the alignment arrangement analysis process in each zone, each sequence and reference sequences (top definite) are separately compared, determine zone identical between all strain isolateds.In canonical sequence, determine all potential ribozyme sites.Select the most prerequisite condition in ribozyme site to be: on each position in cleavage site and brachium conjunctivum, the site should have 100% homogeny between all strain isolateds that alignment is arranged.Selection meets the ribozyme site of these standards.In addition, it is as follows to have worked out two specific concessions: 1) if potential ribozyme site has 100% sequence homogeny at all the nucleotide position places except 1 or 2, detect that locational real Nucleotide so in its differentiated strain isolated.If that Nucleotide is to make to be designed to allow the ribozyme of " G:U waves " base pairing to select that site so to all strain isolated performance functions.2), detect the genotype of the strain isolated that contains the different IPs thuja acid so if potential ribozyme site has 100% sequence homogeny at all the nucleotide position places except 1 or 2.If the genotype of its differentiated strain isolated is very rare, so also select that site.

Nomenclature below that identified and ribozyme following indication site utilize: " genome area that contains the site " is " nucleotide position of cleavage site 5 ' end " (according to canonical sequence recited above and numbering) subsequently.For example, 67 Nucleotide places ribozyme cleavage site is designated as " 5-67 " in 5 ' NCR, and 48 places ribozyme cleavage site is designated as " c48 " in the core encoder district.

In external HCV cutting detects, a lot of these ribozymes are screened, select the ribozyme subjects that is suitable for cell culture studies.The ribozyme target that choosing is used to screen is translated necessary 5 ' UTR district in HCV.All guard between 8 main HCV genotype and 18 hypotypes in these sites, and have the homology of height at each the HCV strain isolated that is used for above-mentioned analysis.From human patients, separate the HCV RNA of 4 different genotype (1b, 2a, 4 and 5), and utilize RT-PCR amplification 5 ' HCV UTR and 5 ' core area.(Ambion Inc.) prepares run-off transcription (transcriptons of～750 nt) in 5 ' HCV UTR district from the RT-PCR product, described RT-PCR product contains a T7 promotor to utilize the method for T7 Megascript transcript reagent box and manufacturers.Filter the uncorporated Nucleotide of removal by the column spinner on Bio-Gel P-60 resin (Bio-Rad).Utilize polynucleotide kinase (Boehringer/Mannheim) and 150 μ Ci/ μ l γ-32P-ATP (NEN) with the method for enzyme manufacturers with ³²P carries out 5 '-end mark to filtering transcripton.The transcripton that kinases is handled is rotated purifying once more to remove uncorporated γ-32P-ATP and carry out gel-purified on 5% polyacrylamide gel.

Select the ribozyme in target various sites in the table IV, and on 5 ' HCV UTR transcripton sequence, detect the efficient of RNA cutting.As previously described, 15 ribozymes (Wincott etc., the same) have been synthesized.

By cutting damping fluid (50mM TRIS pH7.5,10mM MgCl at ribozyme ₂, the RNase inhibition (Boehringer/Mannheim) of 10 units, 10mM DTT, 0.5 μ g tRNA) in the purifying ribozyme of preheating 2 * (2 μ m) concentration detect, and by to also in the cutting damping fluid in the equal-volume substrate RNA (final concentration of 17.46pmole) of preheating adding 2 * ribozyme mixture start cleavage reaction.Utilize the ribozyme of final concentration 1 μ M that detection was carried out 24 hours at 37 ℃, promptly ribozyme is excessive.By adding the blue termination reaction of isopyknic 95% methane amide, 20mM EDTA, 0.05% tetrabromophenol sulfonphthalein and 0.05% dimethylbenzene nitrile, subsequently sample is heated to 95 ℃ 2 minutes, cooling rapidly, and be splined on denaturing polyacrylamide gel.The specific RNA cleaved products that the cutting of substrate RNA and ribozyme is produced is developed.The PhosphorImager of the band by representing intact substrate and cleaved products ^Quantitatively determine the per-cent of cutting.

By comparing with the RNA marker, the size of viewed cutting fragment is relevant with the clip size of supposition from gel.Determine the optical density(OD) of purpose cutting fragment by the phosphorimage plate, and from the high-density of every kind of HCV genotype transcripton being detected to the minimum grade of arranging, wherein high-density is represented maximum cleaved products.For genotype that each detected (15 detect in the ribozyme) be 5 to 3 the highest given grades of cutting ribozyme of rank, be 4 to subsequently 3 the given grades of high-density, or the like.The grade of every kind of ribozyme is averaged between the genotype that is detected.With single ribozyme grade point and average ribozyme grade point mapping and comparison.Result (Fig. 2) shows much can both produce high-caliber cutting in the ribozyme that detects at these and irrelevant with genotype.Particularly, target is in site HCV.5-258, HCV.5-294, HCV.5-313 (Sakamoto etc., Journal of Clinical Investigation (J ClinicalInvestigation) 1996,98 (12): 2720-2728) as if show a kind of consistent RNA cut mode with the ribozyme of HCV.5-318 (table IV).

Embodiment 7: utilize the ribozyme of target HCV to suppress uciferase activity in the OST7 cell

Utilize dual reporter gene system to detect the ability that suppresses HCV RNA in the cell of ribozyme, described dual reporter gene system utilizes Lampyridea and Renilla luciferase (Fig. 3).The ribozyme target can stop transcripton to translate into luciferase in 5 ' HCV UTR district after its cutting.With the OST-7 cell in the DMEM substratum of the L-glutaminate that contains 10% foetal calf serum, 1% penicillin/streptomycin and 1% with 12,500 cell inoculations in every hole in 96 orifice plates (Packard) of opaque wall, and be incubated overnight at 37 ℃.With a kind of T7 of containing promotor and express the plasmid (T7C1-341 (Wang etc. of 5 ' HCV UTR and Photinus pyralis LUC, 1993, Journal of Virology 67,3338-3344)) mix, add the reagent (T7C1-341 (4 μ g/ml), the contrast of pRLSV40 renilla luciferase (6 μ g/ml), ribozyme (250nM), transfection reagent (28.5 μ g/ml)) that ribozyme and cation lipid form 5 * concentration subsequently with pRLSV40Renilla control plasmid (Promega company).

With compounding mixture 37 ℃ of incubations 20 minutes.Remove substratum from cell, and Xiang Kongzhong adds 120 μ l Opti-mem substratum, add 5 * compounding mixture of 30 μ l subsequently.The Opti-mem that in the hole that remains with the cell that is untreated, adds 150 μ l.With compounding mixture incubation 4 hours on the OST-7 cell,, and utilize two luciferase detection kit luminous signal to be carried out quantitatively according to the method (Promega company) of manufacturers with passive lysis buffer (Promega company) cracking.In the table IV, provided used ribozyme sequence.Used ribozyme contains tup type primitive.To hammerhead ribozyme carry out chemically modified in case ribozyme by forming (seeing, for example Fig. 7) at 5 locational ribose residues; Position 4 has 2 '-C-allyl group or 2 '-amido modified; Position 7 has 2 '-amido modified or 2-O-methyl modification; Remaining nucleotide position contains the displacement of 2 '-O-methyl; Contain the thiophosphoric acid ester interchange at 5 ' 4 terminal Nucleotide.In addition, 3 ' of ribozyme end comprises one 3 '-3 ' inversion abasic moiety (no base ribodesose that connects; IH).The data of giving (Fig. 4) be fluorescence ratio between Photinus pyralis LUC and Renilla luciferase.With respect to the renilla luciferase, all targets can both reduce the signal of Photinus pyralis LUC in the ribozyme of 5 ' HCV UTR.

Embodiment 9: compare the inhibition to uciferase activity that ribozyme mediates with the non-activity contrast of ribozyme in the OST-7 cell

Above-mentioned dual reporter gene system is used for determining comparing with the non-activity contrast of ribozyme the level that the uciferase activity by the ribozyme mediation reduces.As above synthetic ribozyme and non-activity contrast thereof at site HCV 313 and 318 (table IV), described ribozyme has the chemical constitution described in the embodiment in front.The non-activity contrast has the nucleotide base identical with active ribozyme to be formed, but nucleotide sequence is upset.The method that is used for the detection of tissue culture and luciferase is fully according to given at embodiment 8, except the ribozyme concentration in 5 * compounding mixture is 1mM (final concentration on the cell is 200nM).

The result provides in Fig. 5.Compare with non-activity contrast with being untreated, target can reduce the activity of Photinus pyralis LUC greatly in the ribozyme of HCV.5-318.Compare with the non-activity contrast, target slightly reduces the activity of Photinus pyralis LUC in the ribozyme of HCV.5-313.

Embodiment 10: ribozyme is to the inhibition of virus replication

In the HCV course of infection, viral RNA shows as the potential target of ribozyme cutting in plurality of processes: the shell of undressing, translation, rna replicon and packing.Any first phase of target RNA in these steps is easier or more difficult to be cut by ribozyme.Though in HCV 5 ' UTR/ luciferase reporter gene system (embodiment 9), simulated at HCV and opened contact between beginning ribosome entry site(RES) (IRES) and translating equipment, in the OST7 system, do not reappeared these other viral process.The RNA/ protein complex product relevant with the target viral RNA do not exist yet.In addition, these processes link up in the cell that HCV infects, and it can further influence the accessibility of target RNA.Therefore, whether our the detection design ribozyme that is used to cut HCV5 ' UTR can play a role to the virus replication system.

Recently, Lu and Wimmer have identified a HCV-poliovirus mosaic, wherein the IRES of poliovirus by replace from the IRES of HCV (Lu and Wimmer, 1996, institute of NAS newspaper 93,1412-1417).Poliovirus (PV) and HCV are similar to be a kind of positive chain RNA virus, but different with HCV be that it is a nonenveloped virus, and can in cell cultures, effectively duplicate.PV compares with wild-type, and the HCV-PV mosaic is expressed the stable shift report type of biting for a short time.

Ribozyme below synthetic is used for test (table VIII): target in the site 183 ribozyme (35 '-terminal thiophosphatephosphorothioate connects), at the contrast that upsets in site 183, at the ribozyme (35 '-terminal thiophosphatephosphorothioate connects) in site 318, target in the site 183 ribozyme (45 '-terminal thiophosphatephosphorothioate connects), target in the site 183 non-activity ribozyme (45 '-terminal thiophosphatephosphorothioate connects).Infect the HeLa cell with the HCV-PV mosaic also handled with ribozyme in 30 minutes immediately.With 9000-10, the density of 000 cells/well is inoculated in HeLa in 96 orifice plates at the bottom of the U type and at 5%CO ₂Down in 37 ℃ of incubations 24 hours.By in the DMEM that contains 5% foetal calf serum (FBS) with 10 * ribozyme (2000nM) and 10 * cation lipid (80 μ g/ml) mix the transfection that realizes ribozyme (200nM).Make ribozyme/lipid complex in 37 ℃ at 5%CO ₂Following incubation 15 minutes.With substratum sucking-off from the cell, and replace the DMEM (GibcoBRL) that 80 μ l contain 5%FBS serum, add the 10X mixture of 20 μ l subsequently.With cell at 5%CO ₂Down in 37 ℃ with mixture incubation 24 hours.

By the plaque test HCV-PV output of handling cell is carried out quantitatively (Fig. 6 A).By virus dilution sample in serum-free DMEM (Gibco BRL) and add 100 μ l and carried out the plaque test in 30 minutes to HeLa cell monolayer in 6 orifice plates (～80% merges).The cell monolayer that cover to infect with 3ml 1.2% agar (Sigma), and in 37 ℃ at 5%CO ₂Following incubation.After 2 to 3 days, remove tectum, with cell monolayer with 1.2% violet staining, and counting plaque forming unit.Data are shown among Fig. 6 A.Compare with the contrast that upsets, the ribozyme that is directed to site 183 suppresses level＞80% (P＜0.05) (Fig. 6 A, preceding two bars) that HCV-PV duplicates.In addition, 3 or 4 thiophosphatephosphorothioate stabilization same effectively (each compares equal P＜0.05 with contrast) (in Fig. 6 A, comparing first and the 4th bar) in suppressing virus replication.Ribozyme at site 318 also has the significantly effect of (P＜0.05) (comparing second and the 3rd bar in Fig. 6 A) of statistics to virus replication.

For the cutting mechanism that confirms ribozyme is the inhibition reason that viewed HCV-PV duplicates, the cell that HCV-PV is infected is used and is contained a sudden change at the remaining with the brachium conjunctivum sequence of site 183 in catalytic core and handle with the ribozyme (table I) that weakens nicking activity.Compare with the cell of handling with the contrast ribozyme upset, the virus replication in these cells is not suppressed (Fig. 6 A, the 4th and the 5th bar), shows that the ribozyme nicking activity is that the observed inhibition that HCV-PV is duplicated is required.In addition, target duplicates not effect (Fig. 6 B) in the ribozyme in the site 183 of HCV 5 ' UTR for wild-type PV.These data produce evidence to show that the inhibition that HCV-PV is duplicated of ribozyme mediation depends on HCV 5 ' UTR, rather than the generally inhibition that PV is duplicated.

Also target in having detected single infectious cycle at the HeLa cell, the ribozyme in site 183 is suppressed the ability (Fig. 8) that HCV-PV duplicates.Obviously lack (in back 8 hours＞80% the inhibition of infection, P＜0.001) with the virus that the target cell that 183 ribozyme (7/4 form) is handled in the site produces than the cell of using the control treatment of upsetting.

Embodiment 11: the length that shortens ribozyme

On each brachium conjunctivum, all contain 7 Nucleotide at all ribozymes described in the embodiment 10 above, and contain the stem II element (7/4 form) of 4 base pairings.For the medicine manufacturing of therapeutic ribozyme, if possible, it is useful that sequence length is minimized.Therefore following shortening target is in the ribozyme in site 183: by remove outermost Nucleotide from each brachium conjunctivum, so that ribozyme has 6 Nucleotide in each brachium conjunctivum, and stem II district is the length (6/4 form) of 4 base pairings; In the stem II, remove a base pair (2 Nucleotide) and produce the stem II (7/3 form) that contains 3 base pairings; Perhaps from each brachium conjunctivum, remove a Nucleotide and the stem II is shortened a base pair (6/3 form).(diagram of each of these ribozymes is seen Fig. 7).The ribozyme of all detected forms produces significant suppress (Fig. 8) to virus replication, in 7/4,7/3 and 6/3 form on 8 hours the time point (for form of ownership P＜0.001 in whole time course) much at one.The shortest ribozyme (6/3 form) that is detected (＞90% inhibition, P＜0.001) is more effective slightly than 7/4 ribozyme (～80% inhibition, P＜0.001).6/3 ribozyme may have in the HCV-PV mosaic the stronger ability near site 183.

The conjoint therapy of embodiment 12:HCV ribozyme and Interferon, rabbit

In perfect medium (DMEM+5%FBS) with HeLa cell (10,000 cells in every hole) with the interferon-alpha pre-treatment of 12.5 units/ml or only used the perfect medium pre-treatment 4 hours, infected 30 minutes with MOI=0.1 with HCV-PV then.Remove the virus inoculation thing then, and in perfect medium, utilizing cation lipid to transmit 24 hours in the ribozyme (Rz) in HCV site 183 or the contrast (BAC) of bonding force weakening the 200nM target, wherein said BAC has the sudden change that seriously undermines ribozyme activity at the catalytic core of ribozyme.After 24 hours, come releasing virus, and virus is carried out quantitatively by the plaque detection by freezing/melt 3 cracking cells.Viral yield is expressed as average plaque forming unit (pfu/ml)+SEM of every ml.Data is shown among Figure 10.

In the cell of control treatment, viral yield has been reduced about 10 with Interferon, rabbit (IFN) pre-treatment ^-1(BAC+IFN is than BAC).The cell that ribozyme is handled produces comparison according to the cell of handling few 2 * 10 ^-1Virus (Rz is than BAC).The combination treatment of Rz and IFN treatment makes the viral yield synergetic property reduce by 4 * 10 ^-2(Rz+IFN is than BAC).Additive effect only will cause 3 * 10 ^-1Reduction (1 * 10 ^-1+ 2 * 10 ^-1).

Embodiment 13: utilize other ribozyme primitives to suppress hepatitis C virus

To multiple different ribozyme primitives (RPI primitive 1-3; Fig. 9) detect it suppresses the HCV breeding in tissue culture ability.A case description of RPI primitive I is in Kore etc., and 1998, nucleic acids research 26, among the 4116-4120, and a case description of RPI primitive II is in Ludwig and Sproat, among the PCT international publication number WO 98/58058.RPI primitive III is a kind of new ribozyme primitive, and it is that the applicant develops recently, and has detected an example of this primitive at this.

The OST7 cell is maintained in adjusting type Eagle ' the s substratum (GIBCO BRL) of the Dulbecco ' s that is supplemented with 10% foetal calf serum, L-glutaminate (2mM) and penicillin/streptomycin.For transfection, the density of OST-7 cell with 12,500 cells/well is inoculated in 96 orifice plates (PackardInstruments) of opaque wall, and at 5%CO ₂Down in 37 ℃ of incubations 24 hours.Realize the cotransfection of target reporter gene HCVT7C (0.8 μ g/ml), contrast reporter gene pRLSV40 (1.2 μ g/ml) and ribozyme 50-200nM by following method: 5 * mixture of preparation HCVT7C (4 μ g/ml), pRLSV40 (6 μ g/ml), ribozyme (250-1000nM) and cation lipid (28.5 μ g/ml) in the OPTI-MEM of 150 μ l serum-frees (GIBCO BRL).At 5%CO ₂Made in 20 minutes in 37 ℃ of incubations down and can form reporter gene/ribozyme/lipid complex.Sucking-off substratum from the OST-7 cell replaces 120 μ l serum-free Opti-MEM (GIBCO BRL) substratum, immediately adds 5 * reporter gene/ribozyme/lipid complex of 30 μ l.With cell at 5%CO ₂Down in 37 ℃ with mixture incubation 4 hours.As carrying out the luciferase detection described in the embodiment 7.The summarization of data is in the table IX, and the result of every kind of primitive lists together with its contrast.Compare in the ribozyme (irrelevant contrast) of any HCV with target not, all ribozyme primitives can both reduce the amount of the HCV that cell produces.

Cell cultures detects

Though the report (as follows) that existing HCV duplicates in cell cultures, these systems are difficult to repetition, and confirmed unreliable.Therefore, because situation also is so during other anti-HCV therapies such as exploitation such as Interferon, rabbit and virazole etc., so the applicant can directly enter Clinical feasibility research confirmed security in zooscopy after.

Several pieces of nearest reports have proved growth in vitro (Mizutani etc., biological chemistry and the biophysical studies news flash (Biochem Biophys Res Commun) 1996,227 (3): 822-826 of HCV in the human cell line; Tagawa etc., gastroenterology and hepatology magazine (Joumal ofGasteroenterology and Hepatology) 1995,10 (5): 523-527; Cribier etc., general virology magazine (Joumal of General Virology) 76 (10): 2485-2491; Seipp etc., general virology magazine 1997,78 (10): 2467-2478; Iacovacci etc., virological investigation (ResearchVirology) 1997,148 (2): 147-151; Iocavacci etc., hepatology 1997,26 (5): 1328-1337; Ito etc., general virology magazine 1996,77 (5): 1043-1054; Nakajima etc., Journal of Virology 1996,70 (5): 3325-3329; Mizutani etc., Journal of Virology 1996,70 (10): 7219-7223; Valli etc., virological investigation 1995,146 (4): 285-288; Kato etc., biological chemistry and biophysical studies news flash 1995,206 (3): 863-869).In T and B clone and be derived from the clone of human liver cell and all shown duplicating of HCV.Utilization detects based on the detection of RT-PCR or b-DNA and has proved and duplicate.Will emphasize importantly in the recent period that publication about the HCV cell cultures has write down reaches 6 months duplicate.

Except the clone that can infect with HCV, several groups report is with successful conversion (Harada etc., the general virology magazine 1995,76 (5): 1215-1221 of total length or the genomic cDNA clone of section H CV pair cell system; Haramatsu etc., viral hepatitis magazine (Joumal of ViralHepatitis) 1997,4S (1): 61-67; Dash etc., American Journal of Pathology (American Journalof Pathology) 1997,151 (2): 363-373; Mizuno etc., gastroenterology (Gasteroenterology) 1995,109 (6): 1933-40; Yoo etc., Journal of Virology 1995,69 (1): 32-38).

Animal model

The best animal model that HCV infects is a chimpanzee.In addition, infecting the chronic hepatitis caused by HCV is very similar in chimpanzee and people.Though be correlated with clinically, the chimpanzee model meets with the obstruction of several application, and it makes the utilization of this model very difficult.These comprise: high cost, the animal that need hatch for a long time and lack sufficient amount.Because these factors, the rodents model of chronic hepatitis C infection is attempted to develop by a lot of groups.Though direct infection does not also become possibility, several groups have reported the part or all of genomic stable transfection of HCV (Yamamoto etc., hepatology 1997,22 (3): 847-855 in rodents; Galun etc., transmissible disease magazine (Joumal of InfectiousDisease) 1995,172 (1): 25-30; Koike etc., general virology magazine 1995,76 (12): 3031-3038; Pasquinelli etc., hepatology 1997,25 (3): 719-727; Hayashi etc., Princess Takamatsu Symp 1995,25:1430149; Mariya K, YotsuyanagiH, Shintani Y, Fujie H, Ishibashi K, Matsuura Y, Miyamura T, Koike K. hepatitis C virus core albumen is induced the liver fat sex change in transgenic mice.General virology magazine 1997,78 (7): 1527-1531; Takehara etc., hepatology 1995,21 (3): 746-751; Kawamura etc., hepatology 1997,25 (4): 1014-1021).In addition, the people's of HCV infection liver transplantation causes can detecting HCVRNA for a long time in animal blood in the mouse body of immunocompromised host.

Diagnostic use

Ribozyme of the present invention can be used as the existence that diagnostic tool detects genetics drift and the sudden change in diseased cells or detects HCVRNA in cell.

Sudden change in the feasible any zone that can detect at this molecule of the substantial connection between ribozyme activity and the target RNA structure, described sudden change has changed base pairing and the three-dimensional structure of target RNA.By utilizing multiple described in the present invention ribozyme, can draw the collection of illustrative plates that Nucleotide changes, described Nucleotide changes for being important at 26S Proteasome Structure and Function external and RNA in cell and tissue.Ribozyme to the cutting of target RNA can be used for inhibition of gene expression also (basically) determine of the effect of specific gene product in progression of disease.By this way, can determine other genetics targets as the disease important medium.Possibility by combination therapy is provided (for example, multiple target unite in heterogeneic ribozyme, with known small molecules inhibition link coupled ribozyme or with ribozyme and/or other chemistry or biomolecules carry out intermittence and treat), these tests will cause the better healing to progression of disease.So the external ability that is applied in of other of ribozyme of the present invention is well-known, and comprise the detection that the mRNA relevant with the HCV correlation behavior existed.After the method for utilizing standard is treated with ribozyme, this type of RNA is detected by the existence of determining cleaved products.

In a specific example, the ribozyme that only can cut wild-type or mutant form target RNA is used to detect.First ribozyme is used for identifying the wild type rna that exists in sample, and second ribozyme will be used to identify the mutant rna in the sample.As the reaction pair photograph, will prove the relative efficiency of ribozyme in reaction with the synthetic substrate of two kinds of ribozymes cutting wild-types and mutant rna and to the shortage of the cutting of " non-target " RNA kind.The cleaved products of synthetic substrate also can be used as the molecular weight marker that wild-type and mutant rna are analyzed among the sample group.Therefore, each analysis will need the sample of two kinds of ribozymes, two kinds of substrates and a unknown, and these will be merged into 6 reactions.Utilize the RNA enzyme protection to test to determine that the existence of cleaved products is so that can analyze total length and the cutting fragment of every kind of RNA in a swimming lane of polyacrylamide gel.The result is quantitatively understood the expression of mutant rna and the risk of purpose phenotypic alternation in target cell of supposition is unwanted fully.Protein product has participated in phenotype formation, and (that is, the expression of mRNA HCV) is enough to determine risk.Be used for two kinds of transcriptons if will have the probe of suitable activity specific, just rna level qualitative enough so, and can reduce the cost of initial diagnosis.No matter rna level is carried out qualitative still quantitative comparison, higher mutant form will be relevant with higher risk with the ratio of wild-type.

Additional use

The likely effectiveness of sequence-specific enzyme nucleic acid molecule of the present invention may have many same application (Nathans etc. that have for DNA institute with the DNA restriction endonuclease to the research of RNA, 1975, biological chemistry yearbook (Ann.Rev.Biochem.) 44:273).For example, the pattern of restriction fragment can be used for establishing the sequence relation between two kinds of relevant RNA, and big RNA can be cut into specifically the fragment to the more favourable size of research.The ability of ribozyme being carried out the sequence-specific transformation will help in the cutting of unknown nucleotide sequence RNA.

Other embodiments are included in the scope of following claim.

The feature of table 1 natural nuclear enzyme

Group-

Size :～150 to greater than 1000 Nucleotide.

In target sequence, be right after 5 ' of cleavage site and need locate a U.

In 5 ' of cleavage site-side in conjunction with 4-6 Nucleotide.

Reaction mechanism: attack to produce by 3 ' of guanosine-OH and have 3 '-OH and 5 '-cleaved products of guanosine.

Need extra protein cofactor to help fold and keep active structure in some cases.

Surpass 300 members that are known as such.In tetrahymena thermophila rRNA, fungi plastosome, chloroplast(id), T4 phage, blue-green algae or the like, be found to be intervening sequence.

Main by phylogenetic comparison, mutagenesis and biochemical research ^[1,2]Determine main constitutional features.

A kind of ribozyme has been determined complete kinetics framework ^[3,4,5,6]

Ribozyme research folding and the substrate grappling is underway ^[7,8,9]

1 Michel, Francois; Westhof, the slick substrate of Eric..Natural structure biology (Nat.Struct.Biol.) (1994), 1 (1), 5-7.

2 Lisacek, Frederique; Diaz, Yolande; The automatic evaluation of Michel, Francois.. group-core in genomic dna sequence.Molecular biology magazine (J.Mol.Biol.) (1994), 235 (4), 1206-17.

3 Herschlag, Daniel; Cech, Thomas R.. tetrahymena thermophila ribozyme is to the catalysis of RNA cutting.To with the kinetic description of the reaction of avtive spot complementary RNA substrate.Biological chemistry (Biochemistry) (1990), 29 (44), 10159-71.

4 HerSchlag, Daniel; Cech, Thomas R.. is by the catalysis of tetrahymena thermophila's ribozyme to the RNA cutting.2. form the kinetic description of reaction of the RNA substrate of a mispairing at avtive spot.Biological chemistry (1990), 29 (44), 10159-71.

5 Knitt, Deborah S.; Herschlag, the pH dependency of Daniel.. thermophilas ribozyme discloses the non-traditional source of a kind of tangible pKa.Biological chemistry (1996), 35 (5), 1560-70.

6 Bevilacqua, Philip C.; Suginoto, Naoki; Tumer, DouglaS H.. is for the mechanical framework by second step of the montage of thermophilas ribozyme catalysis.Biological chemistry (1996), 35 (2), 648-58.

7 Li, Yi; Bevilacqua, Philip C.; Mathews, David; Turner, Douglas H.. be by thermokinetics and the activation parameter of thermophilas ribozyme in conjunction with a kind of pyrene labeled substrate: grappling is not a diffusion control, but drive by favourable entropy change.Biological chemistry (1995), 34 (44), 14394-9.

8 Banerjee, AlokeRaj; Turner, the time-dependent manner of Douglas H.. chemically modified are disclosed in the slow step in the folding of I group ribozyme.Biological chemistry (1995), 34 (19), 6504-12.

Important residue has been carried out the research of chemically modified fully ^[10,11]

Little (4-6nt) binding site can make this ribozyme too non-special to the cutting of target RNA, yet the thermophilas group-has been used to by repairing a kind of " defective " beta-galactosidase enzymes courier on the courier who new beta-galactosidase enzymes sequence is connected to defective ^[12]

RNA enzyme PRNA (M1 RNA)

Size :～290 to 400 Nucleotide.

A kind of RNA part of ribonucleoprotein enzyme of omnipresence.

Cutting tRNA precursor is to form sophisticated tRNA ^[13]

Reaction mechanism: may pass through M ²⁺The attack of-OH produces has 3 '-OH and 5 '-cleaved products of phosphoric acid.

In prokaryotic cell prokaryocyte and eukaryotic cell, all find RNA enzyme P.The RNA subunit of bacterium, yeast, rodents and primates is checked order.

Might raise endogenous RNA enzyme P by external guide sequence (EGS) with the hybridization of target RNA and be used for the treatment of application ^[14,15]

Identified contacting of important phosphate group and 2 ' OH recently ^[16,17]

9 Zarrinkar, Patrick P.; Williamson, the periphery of James R..P9.1-P9.2 is extended help and is instructed the folding of thermophilas ribozyme.Nucleic acids research (1996), 24 (5), 854-8.

10 Strobel, Scott A.; The ditch identification that the G.cntdot.U that Cech, Thomas R.. are conservative at thermophilas ribozyme reaction site place is right.Science (Washington D.C.) (1995), 267 (5198), 675-9.

11 Strobel, Scott A.; Cech, Thomas R.. amine outside the right ring of the conservative G.cntdot.U at thermophilas ribozyme cleavage site place causes 5 '-selection of splice site and transition state stable.Biological chemistry (1996), 35 (4), 1201-11.

12 Sullenger, Bruce A.; Cech, Thomas R.. by target by ribozyme mediation through the reparation of the trans-splicing of orientation to defective mRNA.Nature (Nature) (London) (1994), 371 (6498), 619-22.

13 Robertson, H.D.; Altman, S.; Smith, J.D. journal of biological chemistry, 247,5243-5251 (1972).

14 Forster, Anthony C.; Altman, the external guide sequence of a Sidney. RNA enzyme.Science (Washington D.C., 1883-) (1990), 249 (4970), 783-6.

15 Yuan, Y.; Hwang, E.S.; Altman, S. is by the target cutting of people RNA enzyme P to mRNA.Newspaper (1992) 89, the 8006-10. of institute of NAS

16 Harris, Michael E.; Pace, the evaluation of Norman R. related phosphate group in the catalysis of ribozyme rna enzyme P RNA.RNA(1995),1(2),210-18.

17 Pan, Tao; Loria, Andrew; Zhong, Kun. explore three grades of interactions among the RNA: between RNA enzyme P RNA and preceding-tRNA 2 '-the contacting of hydroxyl-base.Institute of NAS newspaper (1995), 92 (26), 12510-14.

Group-

Size: greater than 1000 Nucleotide.

. confirmed the trans cutting of target RNA recently ^[18,19]

Do not determine the sequence requirement fully.

Reaction mechanism: 2 of inner adenosine '-OH produce have 3 '-cleaved products of OH and contain 3 '-5 ' and " lasso trick " RNA of one 2 '-5 ' tapping point.

Except RNA cutting with is connected, have only natural nuclear enzyme to be proved to participate in DNA and cut ^[20,21]

Main constitutional features takes place to have established more to a great extent by system ^[22]

Begin to identify important 2 '-the OH contact ^[23]

The kinetics framework just under study for action ^[24]

Neurospora VS RNA

Size :～144 Nucleotide.

Confirmed the trans cutting of hair clip type target RNA recently ^[25]

Do not determine the sequence requirement fully.

18 Pyle, AnnaMarie; Green, JustinB.. makes up the kinetics framework of a group-ribozyme activity: combination and reactivity is quantitative between structural domain.Biological chemistry (1994), 33 (9), 2716-25.

19 Michels, WilliamJ.Jr.; Pyle, AnnaMarie. group-are transformed into the ribozyme of the multiple conversion of selectivity cutting oligonucleotide: reaction mechanism and structure/emic explanation.Biological chemistry (1995), 34 (9), 2965-77.

20 Zimmerly, Steven; Guo, Huatao; Eskes, Robert; Yang, Jian; Perlman, Philip S.; Lambowitz, Alan M.. group-RNA are the catalyst components of the DNA restriction endonuclease relevant with the intron movability.Cell (Cell) (Cambridge, Mass.) (1995), 83 (4), 529-38.

21 Griffin, Edmund A., Jr.; Qin, Zhifeng; Michels, Williams J., Jr.; Pyle, the group-ribozyme that Anna Marie. is connected with RNA and does not contact with 2 ' of substrate-hydroxyl with similar efficient cutting DNA.Chemistry and biology (Chem.Biol.) (1995), 2 (11), 761-70.

22 Michel Francois; The structure and the activity of Ferat Jean Luc. group-.Biological chemistry yearbook (1995), 64,435-61.

23 Abramovitz, Dana L.; Friedman, Richard A.; Pyle, the katalysis of Anna Marie. 2 '-hydroxyl in the group-avtive spot.Science (Washington D.C.) (1996), 271 (5254), 1410-13.

24 Daniels, Danette L.; Michels, William J., Jr.; Pyle, two competition approach of Anna Marie. group-self-splicing: the quantitative analysis of vitro reactions rate and product.Molecular biology magazine (J.Mol.Biol.) (1996), 256 (1), 31-49.

25 Guo, Hans C.T.; Collins, Richard A.. is by a kind of effective trans cutting that is derived from the ribozyme of neurospora VS RNA to a kind of stem loop RNA substrate.EMBO's magazine (EMBOJ.) (1995), 14 (2), 368-76.

Reaction mechanism: by 2 '-key that OH attacks easy fracture produce have 2 ', 3 '-cyclic phosphate and 5 '-cleaved products of OH end.

Do not determine binding site and topology requirement fully.

Such has only 1 known member.Be found among the neurospora VS RNA.

Hammerhead ribozyme

(with reference to seeing text)

Size :～13 to 40 Nucleotide.

Need be at the target sequence UH of next-door neighbour's cleavage site 5 ' locate.

Nucleotide in the cleavage site both sides in conjunction with variable number.

Reaction mechanism: by 2 '-OH attack 5 ' of easy fracture key bring in produce have 2 ', 3 '-cyclic phosphate and 5 '-cleaved products of OH end.

Such has 14 known members.Be found in the phytopathogen (virusoid) of the multiple RNA of utilization as infectant.

Determine basic constitutional features to a great extent, comprised 2 crystalline structure ^[26,27]

Confirmed minimum connection activity (being used for carrying out genetic modification) by in-vitro screening ^[28]

2 or a plurality of ribozyme have been established complete kinetics framework ^[29]

Important residue has been carried out the research of chemically modified in depth ^[30]

The hair clip type ribozyme

Size :～50 Nucleotide.

Need be at the target sequence GUC of next-door neighbour's cleavage site 3 ' locate.

In conjunction with cleavage site 5 '-4-6 Nucleotide of side and cleavage site 3 '-Nucleotide of the variable number of side.

26 Scott, W.G., Finch, J.T., Aaron, the crystalline structure of a K. full RNA hammerhead ribozyme: the mechanism of a kind of supposition of RNA catalyze cleavage.Cell, (1995), 81,991-1002.

27 McKay, the 26S Proteasome Structure and Function of hammerhead ribozyme: not intact story.RNA,(1996),2,395-403.

28 Long, D., Uhlenbeck, O., Hertel, the connection of K. hammerhead ribozyme.U.S. Patent number 5,633,133.

29 Hertel, K.J., Herschlag, D., Uhlenbeck, the kinetics and the thermodynamics framework of the reaction of O. hammerhead ribozyme.Biological chemistry, (1994) 33,3374-3385.

30 Beigelman, L, etc., the chemically modified of hammerhead ribozyme.Journal of biological chemistry, (1995) 270,25702-25708.

Reaction mechanism: by 2 '-OH attack easy fracture key 5 ' bring in produce have 2 ', 3 '-cyclic phosphate and 5 '-cleaved products of OH end.

Such has 3 known members.Being found in 3 kinds utilizes in the phytopathogen (satellite RNA of nepovirus, arabis mosaic virus and witloof yellow mottle poison) of RNA as infectant.

Determined basic constitutional features to a great extent ^{[31,32,33,34]}

Connecting active (except nicking activity) makes ribozyme carry out genetic modification by in-vitro screening ^[35]

1 kind of ribozyme has been established complete kinetics framework ^[36]

Begin the chemically modified research of important residue ^[37,38]

Hepatitis D virus (HDV) ribozyme

Size :～60 Nucleotide.

Confirmed trans cutting to target RNA ^[39]

31 Hampel, Arnold; Tritz, Richard; Hicks, Margaret; Cruz, Phillip. " hair clip type " catalytic RNA model: the evidence that spiral exists and the sequence requirement of substrate RNA.Nucleic acids research (Nucleic Acids Res.) (1990), 18 (2), 299-304.

32 Chowrira Bharat M.; Berzal-Herranz, Alfredo; Burke, John M.. hair clip type ribozyme is implemented the required novel guanosine of catalysis.Nature (London) (1991), 354 (6351), 320-2.

33 Berzal-Herranz, Alfredo; Joseph, Simpson; Chowrira, Bharat M.; Butcher, Samuel E.; Burke, the basic nucleotide sequence and the secondary structure element of John M.. hair clip type ribozyme.EMBO's magazine (1993), 12 (6), 2567-73.

34 Joseph, Simpson; Berzal-Herranz, Alfredo; Chowrira, Bharat M.; Butcher, Samuel E.. screens principle by the substrate of the hair clip type ribozyme that in-vitro screening, sudden change and alternative substrate analysis are determined.Gene and growth (Genes Dev.) (1993), 7 (1), 130-8.

35 Berzal-Herranz, Alfredo; Joseph, Simpson; Burke, John M.. by the catalytic cutting in regular turn of RNA and ligation to the in-vitro screening of active hair clip type ribozyme.Gene and growth (1992), 6 (1), 129-34.

36 Hegg, Lisa A.; Fedor, catalytic kinetics and thermodynamics between Martha J.. hair clip type ribozyme molecule.Biological chemistry (1995), 34 (48), 15813-28.

37 Grasby, Jane A.; Mersmann, Karin; Singh, Mohinder; The required purine functional group of the catalytic of RNA cutting in the basic residue of Gait Michael J.. hair clip type ribozyme.Biological chemistry (1995), 34 (12), 4068-76.

38 Schmidt, Sabine; Beigelman, Leonid; Karpeisky, Alexander; Usman, Nassim; Sorensen, Ulrik S.; Encircle the requirement of the RNA cutting of basic nucleotide residue among the B in the Gait, Michael J.. hair clip type ribozyme to base and sugar.The essence of secondary structure.Nucleic acids research (1996), 24 (4), 573-81.

39 Perrotta, AnneT.; Been, Michael D.. is by the cutting of the ribozyme that is derived from hepatitis D virus RNA sequence to oligoribonucleotide.Biological chemistry (1992), 31 (1), 16-21.

Though need not cleavage site 5 ' sequence, determine binding site and topology requirement fully.Folding ribozyme contains a false knot structure ^[40]

Reaction mechanism: by 2 '-OH attack easy fracture key 5 ' bring in produce have 2 ', 3 '-cyclic phosphate and 5 '-cleaved products of OH end.

Such has only 2 known members.Be found among the people HDV.

The ring form of HDV is activated and shows the nuclease stability that has improved ^[41]

40 Perrotta, Anne T.; Been, the required false knot spline structure of Michael D.. hepatitis D virus RNA oneself cutting.Nature (London) (1991), 350 (6317), 434-6.

41 Puttaraju, M.; Perrotta, Anne T.; Been, the hepatitis D virus ribozyme of a Michael D.. annular trans-acting.Nucleic acids research (1993), 21 (18), 4253-8.

Table II: 2.5 μ mol RNA synthesis cycle reagent equivalent quantity waiting time ^*Phosphoramidite 6.5 163 μ L 2.5S-ethyl tetrazoliums 23.8 238 μ l 2.5

5 seconds N-Methylimidazole 186 233 μ L of diacetyl oxide 100 233 μ L 5 seconds

TCA 83.2 1.73mL 21 seconds

Iodine 8.0 1.18mL 45 seconds

Acetonitrile NA 6.67mL NA ^*Waiting time is not included in the duration of contact in the transmittance process

Table III: ribozyme screening feature

Feature	Quantity
		HCV genome length	????9436?kb
All tup type cleavage sites *	????1300
		Conservative region tup type cleavage site **	????23

^*HCV genotype 1b is the prototype strain

^*Arrange based on sequence alignment HCV genotype 1a, 1b, 1c, 2a, 2b, 2c, 3a, 3b, 4a, 4c, 4f, 5a and 6a

Table IV: the hammerhead ribozyme that is derived from HCV genome conserved regions

Title	Substrate	Ribozyme sequence
			?5’NCR
?HCV.5-50	????CUACUGU?C?UUCACGC	?GCGUGAA?CUGAUGAGGCCGUUAGGCCGAA?ACAGUAG
			?HCV.5-67	????AAAGCGU?C?UAGCCAU	?AUGGCUA?CUGAUGAGGCGGUUAGGCCGAA?ACGCUUU
?HCV.5-69	????AGCGUCU?A?GCCAUGG	?CCAUGGC?CUGAUGAGGCCGUUAGGCCGAA?AGACGCU
			?HCV.5-92	????UGAGUGU?C?GUGCAGC	?GCUGCAC?CUGAUGAGGCCGUUAGGCCGAA?ACACUCA
?HCV.5-130	????GAGCCAU?A?GUGGUCU	?AGACCAC?CUGAUGAGGCCGUUAGGCCGAA?AUGGCUC
			?HCV.5-136	????UAGUGGU?C?UGCGGAA	?UUCCGCA?CUGAUGAGGCCGUUAGGCCGAA?ACCACUA
?HCV.5-153	????GGUGAGU?A?CACCGGA	?UCCGGUG?CUGAUGAGCCCCUUAGGCCGAA?ACUCACC
			?HCV.5-180	????ACCGGGU?C?CUUUCUU	?AAGAAAG?CUGAUGAGGCCGUUAGGCCGAA?ACCCGGU
?HCV.5-183	????GGGUCCU?U?UCUUGGA	?UCCAAGA?CUGAUGACGCCGUUAGGCCGAA?AGGACCC
			?HCV.5-184	????GGUCCUU?U?CUUGGAU	?AUCCAAG?CUGAUGAGGCCGUUAGGCCGAA?AAGGACC
?HCV.5-258	????GUUGGGU?C?GCGAAAG	?CUUUCGC?CUGAUGAGGCCGUUAGGCCGAA?ACCCAAC
			?HCV.5-270	????AAGGCCU?U?GUGGUAC	?GUACCAC?CUGAUGAGGCCGUUAGGCCGAA?AGGCCUU
?HCV.5-294	????GGGUGCU?U?GCGAGUG	?CACUCGC?CUGAUGAGGCCGUUAGGCCGAA?AGCACCC
			?HCV.5-313	????GGGAGGU?C?UCGUAGA	?UCUACGA?CUGAUGAGGCCGUUAGGCCGAA?ACCUCCC
?HCV.5-315	????GAGGUCU?C?GUAGACC	?GGUCUAC?CUGAUGAGGCCGUUAGGCCGAA?AGACCUC
			?HCV.5-318	????GUCUCGU?A?GACCGUG	?CACGGUC?CUGAUGAGGCCGUUAGGCCGAA?ACGAGAC
?CoreRegtow
			?HCV.C-30	????UAAACCU?C?AAAGAAA	?UUUCUUU?CUGAUGAGGCCGUUAGGCCGAA?AGGUUUA
?HCV.C-40	????CAAACGU?A?ACACCAA	?UUGGUGU?CUGAUGAGGCCGUUAGGCCGAA?ACGUUUG
			?HCV.C-60	????CAACCGU?C?GCCCACA	?UGUGGGC?CUGAUGAGGCCGUUAGGCCGAA?ACGGUUG
?HCV.C-175	????GAGCGGU?C?ACAACCU	?ACGUUGU?CUGAUGAGGCCGUUAGGCCGAA?ACCGCUC
			?HCV.C-374	????GUAAGGU?C?AUCGAUA	?UAUCGAU?CUGAUGAGGCCGUUAGGCCGAA?ACCUUAC
?3’NCR
			?HCV.3-118	????UUUUUUU?U?UUUUUUU	?AAAAAAA?CUGAUGAGGCCGUUAGGCCGAA?AAAAAAA
?HCV.3-145	????GGUGGCU?C?CAUCUUA	?UAAGAUG?CUGAUGAGGCCGUUAGGCCGAA?AGCCACC
			?HCV.3-149	????GCUCCAU?C?UUAGCCC	?GGGCUAA?CUGAUGAGGCCGUUAGGCCGAA?AUGGAGC
?HCV..3-151	????UCCAUCU?U?AGCCCUA	?UAGGGCU?CUGAUGAGGCCGUUAGGCCGAA?AGAUGGA
			?HCV.3-152	????CCAUCUU?A?GCCCUAG	?CUAGGGC?CUGAUGAGGCCGUUAGGCCGAA?AAGAUGG
?HCV.3-158	????UAGCCCU?A?GUCACGG	?CCGUGAC?CUGAUGAGGCCGUUAGGCCGAA?AGGGCUA
			?HCV.3-161	????CCCUAGU?C?ACGGCUA	?UAGCCGU?CUGAUGAGGCCGUUAGGCCGAA?ACUAGGG
?HCV.3-168	????CACGGCU?A?GCUGUGA	?UCACAGC?CUGAUGAGGCCGUUAGGCCGAA?AGCCGUG
			?HCV.3-181	????GAAAGGU?C?CGUCAGC	?GCUCACG?CUGAUGAGGCCGUUAGGCCGAA?ACCUUUC

Table V: HCV hammerhead ribozyme and target sequence

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					????1	HCV-27	????27	????DAUGGUG?CUGAUGAG?X?CGAA?AGUGUCG	????CGACACU?C?CACCAUA
????2	HCV-114	????114	????GGUCCUG?CUGAUGAG?X?CGAA?AGGCUGC	????GCAGCCU?C?CAGGACC
					????3	HCV-128	????128	????CUCCCGG?CUGADGAG?X?CGAA?AGGGGGG	????CCCCCCU?C?CCGGGAG
????4	HCV-148	????148	????UUCCGCA?CUGAUGAG?X?CGAA?ACCACUA	????UAGUGGU?C?UGCGGAA
					????5	HCV-165	????165	????UCCGGUG?CUGAUGAG?X?CGAA?ACUCACC	????GGUGAGU?A?CACCGGA
????6	HCV-175	????175	????UCCUGGC?CUGAUGAG?X?CGAA?AUUCCGG	????CCGGAAU?U?GCCAGGA
					????7	HCV-199	????199	????UUGAUCC?CUGAUGAG?X?CGAA?AGAAAGG	????CCUUUCU?U?GGAUCAA
????8	HCV-213	????213	????AGGCAUU?CUGAUGAG?X?CGAA?AGCGGGU	????ACCCGCU?C?AAUGCCU
					????9	HCV-252	????252	????ACUCGGC?CUGAUGAG?X?CGAA?AGCAGUC	????GACUGCU?A?GCCGAGU
???10	HCV-260	????260	????CCAACAC?CUGAUGAG?X?CGAA?ACUCGGC	????GCCGAGU?A?GUGUUGG
					???11	HCV-265	????265	????GCGACCC?CUGAUGAG?X?CGAA?ACACUAC	????GUAGUGU?U?GGGUCGC
???12	HCV-270	????270	????CUUUCGC?CUGAUGAG?X?CGAA?ACCCAAC	????GUUGGGU?C?GCGAAAG
					???13	HCV-288	????288	????CAGGCAG?CUGAUGAG?X?CGAA?ACCACAA	????UUGUGGU?A?CUGCCUG
???14	HCV-298	????298	????AGCACCC?CUGAUGAG?X?CGAA?AUCAGGC	????GCCUGAU?A?GGGUGCU
					???15	HCV-306	????306	????CACUCGC?CUGAUGAG?X?CGAA?AGCACCC	????GGGUGCU?U?GCGAGUG
???16	HCV-325	????325	????UCUACGA?CUGAUGAG?X?CGAA?ACCUCCC	????GGGAGGU?C?UCGUAGA
					???17	HCV-327	????327	????GGUCUAC?CUGAUGAG?X?CGAA?AGACCUC	????GAGGUCU?C?GUAGACC
???18	HCV-330	????330	????CACGGUC?CUGAUGAG?X?CGAA?ACGAGAC	????GUCUCGU?A?GACCGUG
					???19	HCV-407	????407	????GGAACUU?CUGAUGAG?X?CGAA?ACGUCCU	????AGGACGU?C?AAGUUCC
???20	HCV-412	????412	????GCCCGGG?CUGAUGAG?X?CGAA?ACUUGAC	????GUCAAGU?U?CCCGGGC
					???21	HCV-413	????413	????CGCCCGG?CUGAUGAG?X?CGAA?AACUUGA	????UCAAGUU?C?CCGGGCG
???22	HCV-426	????426	????ACGAUCU?CUGADGAG?X?CGAA?ACCACCG	????CGGUGGU?C?AGAUCGU
					???23	HCV-472	????472	????CACACCC?CUGAUGAG?X?CGAA?ACGUGGG	????CCCACGU?U?GGGUGUG
???24	HCV-489	????489	????GUCUUCC?CUGAUGAG?X?CGAA?AGUCGCG	????CGCGACU?A?GGAAGAC
					???25	HCV-498	????498	????CGUUCGG?CUGAUGAG?X?CGAA?AGUCUUC	????GAAGACU?U?CCGAACG
???26	HCV-499	????499	????CCGUUCG?CUGADGAG?X?CGAA?AAGUCUU	????AAGACUU?C?CGAACGG
					???27	HCV-508	????508	????AGGUUGC?CUGAUGAG?X?CGAA?ACCGUUC	????GAACGGU?C?GCAACCU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?28	?HCV-534	?534	????UUGGGGA?CUGAUGAG?X?CGAA?AGGUUGU	????ACAACCU?A?UCCCCAA
?29	?HCV-536	?536	????CCUUGGG?CUGAUGAG?X?CGAA?AUAGGUU	????AACCUAU?C?CCCAAGG
					?30	?HCV-546	?546	????GGUCGGC?CUGAUGAG?X?CGAA?AGCCUUG	????CAAGGCU?C?GCCGACC
?31	?HCV-561	?561	????CAGGCCC?CUGAUGAG?X?CGAA?ACCCUCG	????CGAGGGU?A?GGGCCUG
					?32	?HCV-573	?573	????CCAGGCU?CUGAUGAG?X?CGAA?AGCCCAG	????CUGGGCU?C?AGCCUGG
?33	?HCV-583	?583	????CCAAGGG?CUGAUGAG?X?CGAA?ACCCAGG	????CCUGGGU?A?CCCUUGG
					?34	?HCV-588	?588	????AGGGGCC?CUGAUGAG?X?CGAA?AGGGUAC	????GUACCCU?U?GGCCCCU
?35	?HCV-596	?596	????UGCCAUA?CUGAUGAG?X?CGAA?AGGGGCC	????GGCCCCU?C?UAUGGCA
					?36	?HCV-598	?598	????AUUGCCA?CUGAUGAG?X?CGAA?AGAGGGG	????CCCCUCU?A?UGGCAAU
?37	?HCV-632	?632	????GUGACAG?CUGAUGAG?X?CGAA?AGCCAUC	????GAUGGCU?C?CUGUCAC
					?38	?HCV-637	?637	????GCGGGGU?CUGAUGAG?X?CGAA?ACAGGAG	????CUCCUGU?C?ACCCCGC
?39	?HCV-649	?649	????AGGCCGG?CUGAUGAG?X?CGAA?AGCCGCG	????CGCGGCU?C?CCGGCCU
					?40	?HCV-657	?657	????CCCCAAC?CYGAYGAG?X?CGAA?AGGCCGG	????CCGGCCU?A?GUUGGGG
?41	?HCV-660	?660	????GGGCCCC?CUGAUGAG?X?CGAA?ACUAGGC	????GCCUAGU?U?GGGGCCC
					?42	?HCV-696	?696	????UUACCCA?CUGAUGAG?X?CGAA?AUUGCGC	????GCGCAAU?C?UGGGUAA
?43	?HCV-707	?707	????UAUCGAU?CUGAUGAG?X?CGAA?ACCUUAC	????GUAAGGU?C?AUCGAUA
					?44	?HCV-710	?710	????GGGUAUC?CUGAUGAG?X?CGAA?AUGACCU	????AGGUCAU?C?GAUACCC
?45	?HCV-714	?714	????GUGAGGG?CUGAUGAG?X?CGAA?AUCGAUG	????CAUCGAU?A?CCCUCAC
					?46	?HCV-730	?730	????GUCGGCG?CUGAUGAG?X?CGAA?AGCCGCA	????UGCGGCU?U?CGCCGAC
?47	?HCV-731	?731	????GGUCGGC?CUGAUGAG?X?CGAA?AAGCCGC	????GCGGCUU?C?GCCGACC
					?48	?HCV-748	?748	????CGGAAUG?CUGAUGAG?X?CGAA?ACCCCAU	????AUGGGGU?A?CAUUCCA
?49	?HCV-752	?752	????CGAGCGG?CUGAUGAG?X?CGAA?AUGUACC	????GGUACAU?U?CCGCUCG
					?50	?HCV-753	?753	????ACGAGCG?CUGAUGAG?X?CGAA?AAUGUAC	????GUACAUU?C?CGCUCGU
?51	?HCV-758	?758	????CGCCGAC?CUGAUGAG?X?CGAA?AGCGGAA	????UUCCGCU?C?GUCGGCG
					?52	?HCV-761	?761	????GGGCGCC?CUGAUGAG?X?CGAA?ACGAGCG	????CGCUCGU?C?GGCGCCC
?53	?HCV-773	?773	????CGCCCCC?CUGAUGAG?X?CGAA?AGGGGGG	????CCCCCCU?A?GGGGGCG
					?54	?HCV-806	?806	????GAACCCG?CUGAUGAG?X?CGAA?ACACCAU	????AUGGUGU?C?CGGGUUC
?55	?HCV-812	?812	????CCUCCAG?CUGAUGAG?X?CGAA?ACCCGGA	????UCCGGGU?U?CUGGAGG
					?56	?HCV-813	?813	????UCCUCCA?CYGAYGAG?X?CGAA?AACCCGG	????CCGGGUU?C?UGGAGGA
?57	?HCV-832	?832	????UGUUGCG?CUGAUGAG?X?CGAA?AGUUCAC	????GUGAACU?A?CGCAACA

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					58	?HCV-847	?847	????ACCGGGC?CUGAUGAG?X?CGAA?AGUUCCC	????GGGAACU?U?GCCCGGU
59	?HCV-855	?855	????AAAGAGC?CUGAUGAG?X?CGAA?ACCGGGC	????GCCCGGU?U?GCUCUUU
					60	?HCV-859	?859	????AGAGAAA?CUGAUGAG?X?CGAA?AGCAACC	????GGUUGCU?C?UUUCUCU
61	?HCV-982	?982	????UGCCUCA?CUGAUGAG?X?CGAA?ACACAAU	????AUUGUGU?A?UGAGGCA
					62	?HCV-1001	?1001	????UAUGCAU?CUGAUGAG?X?CGAA?AUCAUGC	????GCAUGAU?C?AUGCAUA
63	?HCV-1022	?1022	????CGCAGGG?CUGAUGAG?X?CGAA?ACGCACC	????GGUGCGU?A?CCCUGCG
					64	?HCV-1031	?1031	????UCUCCCG?CUGAUGAG?X?CGAA?ACGCAGG	????CCUGCGU?U?CGGGAGA
65	?HCV-1032	?1032	????UUCUCCC?CUGAUGAG?X?CGAA?AACGCAG	????CUGCGUU?C?GGGAGAA
					66	?HCV-1048	?1048	????ACAACGG?CUGAUGAG?X?CGAA?AGGCGUU	????AACGCCU?C?CCGUUGU
67	?HCV-1053	?1053	????ACCCAAC?CUGAUGAG?X?CGAA?ACGGGAG	????CUCCCGU?U?GUUGGGU
					68	?HCV-1056	?1056	????GCUACCC?CUGAUGAG?X?CGAA?ACAACGG	????CCGUUGU?U?GGGUAGC
69	?HCV-1061	?1061	????UGAGCGC?CUGAUGAG?X?CGAA?ACCCAAC	????GUUGGGU?A?GCGCUCA
					70	?HCV-1127	?1127	????GCAAGUC?CUGAUGAG?X?CGAA?ACGUGGC	????GCCACGU?C?GACUUGC
71	?HCV-1132	?1132	????AACGAGC?CUGAUGAG?X?CGAA?AGUCGAC	????GUCGACU?U?GCUCGUU
					72	?HCV-1136	?1136	????CCCCAAC?CUGAUGAG?X?CGAA?AGCAAGU	????ACUUGCU?C?GUUGGGG
73	?HCV-1139	?1139	????CCGCCCC?CUGAUGAG?X?CGAA?ACGAGCA	????UGCUCGU?U?GGGGCGG
					74	?HCV-1153	?1153	????GGAACAG?CUGAUGAG?X?CGAA?AAGCGGC	????GCCGCUU?U?CUGUUCC
75	?HCV-1154	?1154	????CGGAACA?CUGAUGAG?X?CGAA?AAAGCGG	????CCGCUUU?C?UGUUCCC
					76	?HCV-1158	?1158	????AUGGCGG?CUGAUGAG?X?CGAA?ACAGAAA	????UUUCUGU?U?CCGCCAU
77	?HCV-1159	?1159	????CAUGGCG?CUGAUGAG?X?CGAA?AACAGAA	????UUCUGUU?C?CGCCAUG
					78	?HCV-1168	?1168	????CCCCACG?CUGAUGAG?X?CGAA?ACAUGGC	????GCCAUGU?A?CGUGGGG
79	?HCV-1189	?1189	????GAAAACG?CUGAUGAG?X?CGAA?AUCCGCA	????UGCGGAU?C?CGUUUUC
					80	?HCV-1193	?1193	????CGAGGAA?CUGAUGAG?X?CGAA?ACGGAUC	????GAUCCGU?U?UUCCUCC
81	?HCV-1194	?1194	????ACGAGGA?CUGAUGAG?X?CGAA?AACGGAU	????AUCCGUU?U?UCCUCGU
					82	?HCV-1195	?1195	????GACGAGG?CUGAUGAG?X?CGAA?AAACGGA	????UCCGUUU?U?CCUCGUC
83	?HCV-1196	?1196	????AGACGAG?CUGAUGAG?X?CGAA?AAAACGG	????CCGUUUU?C?CUCGUCU
					84	?HCV-1280	?1280	????GACCUGA?CUGAUGAG?X?CGAA?ACAUGGC	????GCCAUGU?A?UCAGGUC
85	?HCV-1282	?1282	????GUGACCU?CUGAUGAG?X?CGAA?AUACAUG	????CAUGUAU?C?AGGUCAC
					86	?HCV-1287	?1287	????AUGCGGU?CUGAUGAG?X?CGAA?ACCUGAU	????AUCAGGU?C?ACCGCAU
87	?HCV-1373	?1373	????UAUCCAC?CUGAUGAG?X?CGAA?ACAGCUU	????AAGCUGU?C?GUGGAUA

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					88	?HCV-1380	1380	????GCCACCA?CUGAUGAG?X?CGGA?AUCCACG	????CGUGGAU?A?UGGUGGC
89	?HCV-1406	1406	????CCGCUAG?CUGAUGAG?X?CGAA?ACUCCCC	????GGGGAGU?C?CUAGCGG
					90	?HCV-1409	1409	????GGCCCGC?CUGAUGAG?X?CGAA?AGGACUC	????GAGUCCU?A?GCGGGCC
91	?HCV-1418	1418	????AGUAGGC?CUGAUGAG?X?CGAA?AGGCCCG	????CGGGCCU?U?GCCUAAU
					92	?HCV-1423	1423	????GGAAUAG?CUGAUGAG?X?CGAA?AGGCAAG	????CUUGCCU?A?CUAUUCC
93	?HCV-1426	1426	????CAUGGAA?CUGAUGAG?X?CGAA?AGUAGGC	????GCCUACU?A?UUCCAUG
					94	?HCV-1428	1428	????ACCAUGG?CUGAUGAG?X?CGAA?AUAGUAG	????CUACUAU?U?CCAUGGU
95	?HCV-1429	1429	????CACCAUG?CUGAUGAG?X?CGAA?AAUAGUA	????UACUAUU?C?CAUGGUG
					96	?HCV-1727	1727	????ACUUGUC?CUGAUGAG?X?CGAA?AUGGAGC	????GCUCCAU?C?GACAAGU
97	?HCV-1735	1735	????CUGAGCG?CUGAUGAG?X?CGAA?ACUUGUC	????GACAAGU?U?CGCUCAG
					98	?HCV-1736	1736	????CCUGAGC?CUGAUGAG?X?CGAA?AACUUGU	????ACAAGUU?C?GCUCAGG
99	?HCV-1740	1740	????CAUCCCU?CUGAUGAG?X?CGAA?AGCGAAC	????GUUCGCU?C?AGGGAUG
					100	?HCV-1757	1757	????UAUAGGU?CUGAUGAG?X?CGAA?AUGGGGC	????GCCCCAU?C?ACCUAUA
101	?HCV-1762	1762	????CUCGGUA?CUGAUGAG?X?CGAA?AGGUGAU	????AUCACCU?A?UACCGAG
					102	?HCV-1795	1795	????CCAGCAG?CUGAUGAG?X?CGAA?AAGGCCU	????AGGCCUU?A?CUGCUGG
103	?HCV-1806	1806	????GGUGCGU?CUGAUGAG?X?CGAA?AUGCCAG	????CUGGCAU?U?ACGCACC
					104	?HCV-1807	1807	????AGGUGCG?CUGAUGAG?X?CGAA?AAUGCCA	????UGGCAUU?A?CGCACCU
105	?HCV-1815	1815	????CACUGCC?CUGAUGAG?X?CGAA?AGGUGCG	????CGCACCU?C?GGCAGUG
					106	?HCV-1827	1827	????GGUACGA?CUGAUGAG?X?CGAA?ACCACAC	????GUGUGGU?A?UCGUACC
107	?HCV-1829	1829	????CAGGUAC?CUGAUGAG?X?CGAA?AUACCAC	????GUGGUAU?C?GUACCUG
					108	?HCV-1832	1832	????ACGCAGG?CUGAUGAG?X?CGAA?ACGAUAC	????GUAUCGU?A?CCUGCGU
109	?HCV-1840	1840	????CACCUGC?CUGAUGAG?X?CGAA?ACGCAGG	????CCUGCGU?C?GCAGGUG
					110	?HCV-1854	1854	????UACACUG?CUGAUGAG?X?CGAA?ACCACAC	????GUGUGGU?C?CAGUGUA
111	?HCV-1883	1883	????CCACUAC?CUGAUGAG?X?CGAA?ACAGGGC	????GCCCUGU?U?GUAGUGG
					112	?HCV-1886	1886	????UCCCCAC?CUGAUGAG?X?CGAA?ACAACAG	????CUGUUGU?A?GUGGGGA
113	?HCV-1902	1902	????CCGGACC?CUGAUGAG?X?CGAA?AUCGGUC	????GACCGAU?C?GGUCCGG
					114	?HCV-1906	1906	????GGCACCG?CUGAUGAG?X?CGAA?ACCGAUC	????GAUCGGU?C?CGGUGCC
115	?HCV-1917	1917	????UUAUACG?CUGAUGAG?X?CGAA?AGGGGCA	????UGCCCCU?A?CGUAUAA
					116	?HCV-1921	1921	????CCAGUUA?CUGAUGAG?X?CGAA?ACGUAGG	????CCUACGU?A?UAACUGG
117	?HCV-1923	1923	????CCCCAGU?CUGAUGAG?X?CGAA?AUACGUA	????UACGUAU?A?ACUGGGG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?118	?HCV-1990	?1990	????ACAGCCA?CUGAUGAG?X?CGAA?ACCAGUU	????AACUGGU?U?UGGCUGU
?119	?HCV-1991	?1991	????UACAGCC?CUGAUGAG?X?CGAA?AACCAGU	????ACUGGUU?U?GGCUGUA
					?120	?HCV-1998	?1998	????AUCCAUG?CUGAUGAG?X?CGAA?ACAGCCA	????UGGCUGU?A?CAUGGAU
?121	?HCV-2043	?2043	????UUGCACG?CUGAUGAG?X?CGAA?AGGGCCC	????GGGCCCU?C?CGUGCAA
					?122	?HCV-2054	?2054	????CCCCCCC?CUGAUGAG?X?CGAA?AUGUUGC	????GCAACAU?C?GGGGGGG
?123	?HCV-2063	?2063	????GGUUGCC?CUGAUGAG?X?CGAA?ACCCCCC	????GGGGGGU?C?GGCAACC
					?124	?HCV-2072	?2072	????UCAAGGU?CUGAUGAG?X?CGAA?AGGUUGC	????GCAACCU?C?ACCUUGA
?125	?HCV-2077	?2077	????GCAGGUC?CUGAUGAG?X?CGAA?AGGUGAG	????CUCACCU?U?GACCUGC
					?126	?HCV-2121	?2121	????UUUGUGU?CUGAUGAG?X?CGAA?AGUGGCC	????GGCCACU?U?ACACAAA
?127	?HCV-2122	?2122	????UUUUGUG?CUGAUGAG?X?CGAA?AAGUGGC	????GCCACUU?A?CACAAAA
					?128	?HCV-2137	?2137	????UGGCCCC?CUGAUGAG?X?CGAA?AGCCACA	????UGUGGCU?C?GGGGCCA
?129	?HCV-2149	?2149	????AGGUGUU?CUGAUGAG?X?CGAA?ACCAUGG	????CCAUGGU?U?AACACCU
					?130	?HCV-2150	?2150	????UAGGUGU?CUGAUGAG?X?CGAA?AACCAUG	????CAUGGUU?A?ACACCUA
?131	?HCV-2219	?2219	????CCUUAAA?CUGAUGAG?X?CGAA?AUGGUAA	????UUACCAU?C?UUUAAGG
					?132	?HCV-2221	?2221	????AACCUUA?CUGAUGAG?X?CGAA?AGAUGGU	????ACCAUCU?U?UAAGGUU
?133	?HCV-2261	?2261	????CAGCACU?CUGAUGAG?X?CGAA?AGCCUGU	????ACAGGCU?U?AGUGCUG
					?134	?HCV-2262	?2262	????GCAGCAC?CUGAUGAG?X?CGAA?AAGCCUG	????CAGGCUU?A?GUGCUGC
?135	?HCV-2295	?2295	????AGGUCGC?CUGAUGAG?X?CGAA?ACGCUCU	????AGAGCGU?U?GCGACCU
					?136	?HCV-2320	?2320	????GAGCUCC?CUGAUGAG?X?CGAA?AUCUGUC	????GACAGAU?C?GGAGCUC
?137	?HCV-2327	?2327	????GCGGGCU?CUGAUGAG?X?CGAA?AGCUCCG	????CGGAGCU?C?AGCCCGC
					?138	?HCV-2344	?2344	????UGUCGUG?CUGAUGAG?X?CGAA?ACAGCAG	????CUGCUGU?C?CACGACA
?139	?HCV-2417	?2417	????UCUGAUG?CUGAUGAG?X?CGAA?AGGUGGA	????UCCACCU?C?CAUCAGA
					?140	?HCV-2421	?2421	????AUGUUCU?CUGAUGAG?X?CGAA?AUGGAGG	????CCUCCAU?C?AGAACAU
?141	?HCV-2429	?2429	????CGUCCAC?CUGAUGAG?X?CGAA?AUGUUCU	????AGAACAU?C?GUGGACG
					?142	?HCV-2534	?2534	????AGGCACA?CUGAYGAG?X?CGAA?ACGCGCG	????CGCGCGU?C?UGUGCCU
?143	?HCV-2585	?2585	????GGUUCUC?CUGAUGAG?X?CGAA?AGGGCGG	????CCGCCCU?A?GAGAACC
					?144	?HCV-2600	?2600	????CGUUGAG?CUGAUGAG?X?CGAA?ACCACCA	????UGGUGGU?C?CUCAACG
?145	?HCV-2603	?2603	????CCGCGUU?CUGAUGAG?X?CGAA?AGGACCA	????UGGUCCU?C?AACGCGG
					?146	?HCV-2671	?2671	????CUUGAUG?CUGAUGAG?X?CGAA?ACCAGGC	????GCCUGGU?A?CAUCAAG
?147	?HCV-2675	?2675	????UGCCCUU?CUGAUGAG?X?CGAA?AUGUACC	????GGUACAU?C?AAGGGCA

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					148	?HCV-2690	?2690	????CCCCAGG?CUGAUGAG?X?CGAA?ACCAGCC	?GGCUGGU?C?CCUGGGG
149	?HCV-2704	?2704	????CAGAGCA?CUGAUGAG?X?CGAA?AUGCCGC	?GCGGCAU?A?UGCUCUG
					150	?HCV-2709	?2709	????CCGUACA?CUGAUGAG?X?CGAA?AGCAUAU	?AUAUGCU?C?UGUACGG
151	?HCV-2713	?2713	????CACGCCG?CUGAUGAG?X?CGAA?ACAGAGC	?GCUCUGU?A?CGGCGUG
					152	?HCV-2738	?2738	????CCAGCAG?CUGAUGAG?X?CGAA?AGCAGGA	?UCCUGCU?C?CUGCUGG
153	?HCV-2763	?2763	????AUGGCGU?CUGAUGAG?X?CGAA?AGCCCGU	?ACGGGCU?U?ACGCCAU
					154	?HCV-2764	?2764	????CAUGGCG?CUGAUGAG?X?CGAA?AAGCCCG	?CGGGCUU?A?CGCCAUG
155	?HCV-2878	?2878	????GUAUUGU?CUGAUGAG?C?CGAA?ACCACCA	?UGGUGGU?U?ACAAUAC
					156	?HCV-2879	?2879	????AGUAUUG?CUGAUGAG?X?CGAA?AACCACC	?GGUGGUU?A?CAAUACU
157	?HCV-2884	?2884	????GAUAAAG?CUGAUGAG?X?CGAA?AUUGUAA	?UUACAAU?A?CUUUAUC
					158	?HCV-2987	?2887	????GGUGAUA?CUGAUGAG?X?CGAA?AGUAUUG	?CAAUACU?U?UAUCACC
159	?HCV-2888	?2888	????UGGUGAU?CUGAUGAG?X?CGAA?AAGUAUU	?AAUACUU?U?AUCACCA
					160	?HCV-2910	?2910	????ACGCACA?CUGAUGAG?X?CGAA?AUGCGCC	?GGCGCAU?U?UGUGCGU
161	?HCV-2911	?2911	????CACGCAC?CUGAUGAG?X?CGAA?AAUGCGC	?GCGCAUU?U?GUGCGUG
					162	?HCV-2924	?2924	????GAGGGGG?CUGAUGAG?X?CGAA?ACCCACA	?UGUGGGU?C?CCCCCUC
163	?HCV-2931	?2931	????ACAUUGA?CUGAUGAG?X?CGAA?AGGGGGG	?CCCCCCU?C?UCAAUGU
					164	?HCV-2933	?2933	????GGACAUU?CUGAUGAG?X?CGAA?AGAGGGG	?CCCCUCU?C?AAUGUCC
165	?HCV-2939	?2939	????CCCCCCG?CUGAUGAG?X?CGAA?ACAUUGA	?UCAAUGU?C?CGGGGGG
					166	?HCV-2958	?2958	????AGGAUGA?CUGAUGAG?X?CGAA?AGCAUCG	?CGAUGCU?A?UCAUCCU
167	?HCV-2960	?2960	????GGAGGAU?CUGAUGAG?X?CGAA?AUAGCAU	?AUGCUAU?C?AUCCUCC
					168	?HCV-2963	?2963	????UGAGGAG?CUGAUGAG?X?CGAA?AUGAUAG	?CUAUCAU?C?CUCCUCA
169	?HCV-2966	?2966	????AUGUGAG?CUGAUGAG?X?CGAA?AGGAUGA	?UCAUCCU?C?CUCACAU
					170	?HCV-2969	?2969	????CACAUGU?CUGAUGAG?X?CGAA?AGGAGGA	?UCCUCCU?C?ACAUGUG
171	?HCV-3059	?3059	????UCGCAGU?CUGAUGAG?X?CGAA?AUGGCAG	?CUGCCAU?A?ACUGCGA
					172	?HCV-3138	?3138	????UGGACGU?CUGAUGAG?X?CGAA?AUGGCCU	?AGGCCAU?U?ACGUCCA
173	?HCV-3139	?3139	????UUGGACG?CUGAUGAG?X?CGAA?AAUGGCC	?GGCCAUU?A?CGUCCAA
					174	?HCV-3143	?3143	????CCAUUUG?CUGAUGAG?X?CGAA?ACGUAAU	?AUUACGU?C?CAAAUGG
175	?HCV-3154	?3154	????CUUCAUG?CUGAUGAG?X?CGAA?AGGCCAU	?AUGGCCU?U?CAUGAAG
					176	?HCV-3155	?3155	????GCUUCAU?CUGAUGAG?X?CGAA?AAGGCCA	?UGGCCUU?C?AUGAAGC
177	?HCV-3209	?3209	????AAUCCUG?CUGAUGAG?X?CGAA?AGCGGGG	?CCCCGCU?A?CAGGAUU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					178	?HCV-3216	?3216	????UGGGCCC?CUGAUGAG?X?CGAA?AUCCUGU	????ACAGGAU?U?GGGCCCA
179	?HCV-3233	?3233	????GGUCUCG?CUGAUGAG?X?CGAA?AGGCCCG	????CGGGCCU?A?CGAGACC
					180	?HCV-3242	?3242	????CCACCGC?CUGAUGAG?X?CGAA?AGGUCUC	????GAGACCU?U?GCGGUGG
181	?HCV-3263	?3263	????AGAAGAC?CUGAUGAG?X?CGAA?ACGGGCU	????AGCCCGU?C?GUCUUCU
					182	?HCV-3266	?3266	????CAGAGAA?CUGAUGAG?X?CGAA?ACGACGG	????CCGUCGU?C?UUCUCUG
183	?HCV-3268	?3268	????GUCAGAG?CUGAUGAG?X?CGAA?AGACGAC	????GUCGUCU?U?CUCUGAC
					184	?HCV-3290	?3290	????AGGUGAU?CUGAUGAG?X?CGAA?AUCUUGG	????CCAAGAU?C?AUCACCU
185	?HCV-3293	?3293	????CCCAGGU?CUGAUGAG?X?CGAA?AUGAUCU	????AGAUCAU?C?ACCUGGG
					186	?HCV-3329	?3329	????CCAAGAU?CUGAUGAG?X?CGAA?AUGUCCC	????GGGACAU?C?AUCUUGG
187	?HCV-3332	?3332	????GUCCCAA?CUGAUGAG?X?CGAA?AUGAUGU	????ACAUCAU?C?UUGGGAC
					188	?HCV-3334	?3334	????CAGUCCC?CUGAUGAG?X?CGAA?AGAUGAU	????AUCAUCU?U?GGGACUG
189	?HCV-3347	?3347	????GGGCGGA?CUGAUGAG?X?CGAA?ACGGGCA	????UGCCCGU?C?UCCGCCC
					190	?HCV-3349	?3349	????UCGGGCG?CUGAUGAG?X?CGAA?AGACGGG	????CCCGUCU?C?CGCCCGA
191	?HCV-3371	?3371	????CCAGAAG?CUGAUGAG?X?CGAA?AUCUCCC	????GGGAGAU?A?CUUCUGG
					192	?1HCV-3416	?3416	????GGGCAAG?CUGAUGAG?X?CGAA?AGUCGCC	????GGCGACU?C?CUUGCCC
193	?HCV-3419	?3419	????UGGGGGC?CUGAUGAG?X?CGAA?AGGAGUC	????GACUCCU?U?GCCCCCA
					194	?HCV-3428	?3428	????AGGCCGU?CUGAUGAG?X?CGAA?AUGGGGG	????CCCCCAU?C?ACGGCCU
195	?HCV-3482	?3482	????GGCCUGU?CUGAUGAG?X?CGAA?AGGCUAG	????CUAGCCU?C?ACAGGCC
					196	?HCV-3518	?3518	????CCACUUG?CUGAUGAG?X?CGAA?ACCUCCC	????GGGCGGU?U?CAAGUGG
197	?HCV-3519	?3519	????ACCACUU?CUGAUGAG?X?CGAA?AACCUCC	????GGAGGUU?C?AAGUGGU
					198	?HCV-3527	?3527	????CGGUGGA?CUGAUGAG?X?CGAA?ACCACUU	????AAGUGGU?U?UCCACCG
199	?HCV-3528	?3528	????GCGGUGG?CUGAUGAG?X?CGAA?AACCACU	????AGUGGUU?U?CCACCGC
					200	?HCV-3529	?3529	????UGCGGUG?CUGAUGAG?X?CGAA?AAACCAC	????GUGGUUU?C?CACCGCA
201	?HCV-3576	?3576	????ACGGUCC?CUGAUGAG?X?CGAA?ACACACA	????UGUGUGU?U?GGACCGU
					202	?HCV-3601	?3601	????GGUCUUU?CUGAUGAG?X?CGAA?AGCCGGC	????GCCGGCU?C?AAAGACC
203	?HCV-3611	?3611	????GGCCGGC?CUGAUGAG?X?CGAA?AGGGUCU	????AGACCCU?A?GCCGGCC
					204	?HCV-3684	?3684	????GCCCCGG?CUGAUGAG?X?CGAA?AGGCGCA	????UGCGCCU?C?CCGGGGC
205	?HCV-3696	?3696	????GUAAGGG?CUGAUGAG?X?CGAA?ACGCGCC	????GGCGCGU?U?CCCUUAC
					206	?HCV-3697	?3697	????UGUAAGG?CUGAUGAG?X?CGAA?AACGCGC	????GCGCGUU?C?CCUUACA
207	?HCV-3701	?3701	????AUGGUGU?CUGAUGAG?X?CGAA?AGGGAAC	????GUUCCCU?U?ACACCAU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?208	?HCV-3702	?3702	????CAUGGUG?CUGAUGAG?X?CGAA?AAGGGAA	?????UUCCCUU?A?CACCAUG
?209	?HCV-3724	?3724	????GAGGUCC?CUGAUGAG?X?CGAA?AGCUACC	?????GGUAGCU?C?GGACCUC
					?210	?HCV-3731	?3731	????CCAGAUA?CUGAUGAG?X?CGAA?AGGUCCG	?????CGGACCU?C?UAUCUGG
?211	?HCV-3733	?3733	????GACCAGA?CUGAUGAG?X?CGAA?AGAGGUC	?????GACCUCU?A?UCUGGUC
					?212	?HCV-3735	?3735	????GUGACCA?CUGAUGAG?X?CGAA?AUAGAGG	?????CCUCUAU?C?UGGUCAC
?213	?HCV-3740	?3740	????GUCUCGU?CUGAUGAG?X?CGAA?ACCAGAU	?????AUCUGGU?C?ACGAGAC
					?214	?HCV-3761	?3761	????GCACCGG?CUGAUGAG?X?CGAA?AUGACGU	?????ACGUCAU?U?CCGGUCG
?215	?HCV-3762	?3762	????CGCACCG?CUGAUGAG?X?CGAA?AAUGACG	?????CGUCAUU?C?CGGUGCG
					?216	?HCV-3786	?3786	????CUCCCCC?CGGAUGAG?X?CGAA?ACCGUCA	?????UGACGGU?C?GGGGGAG
?217	?HCV-3797	?3797	????GGGACAG?CUGAUGAG?X?CGAA?AGGCUCC	?????GGAGCCU?A?CUGUCCC
					?218	?HCV-3802	?3802	????UCUGGGG?CUGAUGAG?X?CGAA?ACAGUAG	?????CUACUGU?C?CCCCAGA
?219	?HCV-3835	?3835	????GCCACCC?CUGAUGAG?X?CGAA?AAGAGCC	?????GGCUCUU?C?GGGUGGC
					?220	?HCV-3851	?3851	????AAGGGCA?CUGAUGAG?X?CGAA?AGCAGUG	?????CACUGCU?C?UGCCCUU
?221	?HCV-3858	?3858	????UGCCCCG?CUGAUGAG?X?CGAA?AGGGCAG	?????CUGCCCU?U?CGGGGCA
					?222	?HCV-3859	?3859	????GUGCCCC?CUGAUGAG?X?CGAA?AAGGGCA	?????UGCCCUU?C?GGGGCAC
?223	?HCV-3872	?3872	????AGAUGCC?CUGAUGAG?X?CGAA?ACAGCGU	?????ACGCUGU?A?GGCAUCU
					?224	?HCV-3878	?3878	????CCCGGAA?CUGAUGAG?X?CGAA?AUGCCUA	?????UAGGCAU?C?UUCCGGG
?225	?HCV-3880	?3880	????AGCCCGG?CUGAUGAG?X?CGAA?AGAUGCC	?????GGCAUCU?U?CCGGGCU
					?226	?HCV-3881	?3881	????CAGCCCG?CUGAUGAG?X?CGAA?AAGAUGC	?????GCAUCUU?C?CGGGCUG
?227	?HCV-3908	?3908	????CCUUCGC?CUGAUGAG?X?CGAA?ACCCCCC	?????GGGGGGU?U?GCGAAGG
					?228	?HCV-4056	?4056	????GGCACUU?CUGAUGAG?X?CGAA?AGUGCUC	?????GAGCACU?A?AAGUGCC
?229	?HCV-4072	?4072	????GGCUGCG?CUGAUGAG?X?CGAA?ACGCAGC	?????GCUGCGU?A?CGCAGCC
					?230	?HCV-4087	?4087	????UACCUUG?CUGAUGAG?X?CGAA?ACCCUUG	?????CAAGGGU?A?CAAGGUA
?231	?HCV-4115	?4115	????UGGCGGC?CUGAUGAG?X?CGAA?ACAGAUG	?????CAUCUGU?U?GCCGCCA
					?232	?HCV-4175	?4175	????CAGUUCU?CUGAUGAG?X?CGAA?AUGUUGG	?????CCAACAU?C?AGAACUG
?233	?HCV-4187	?4187	????UGGUCCU?CUGAUGAG?X?CGAA?ACCCCAG	?????CUGGGGU?A?AGGACCA
					?234	?HCV-4228	?4228	????CUUACCA?CUGAUGAG?X?CGAA?AGGUGGA	?????UCCACCU?A?UGGUAAG
?235	?HCV-4233	?4233	????AGGAACU?CUGAUGAG?X?CGAA?ACCAUAG	?????CUAUGGU?A?AGUUCCU
					?236	?HCV-4237	?4237	????GGCAAGG?CUGAUGAG?X?CGAA?ACUUACC	?????GGUAAGU?U?CCUUGCC
?237	?HCV-4238	?4238	????CGGCAAG?CUGAUGAG?X?CGAA?AACUUAC	?????GUAAGUU?C?CUUGCCG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?238	?HCV-4241	?4241	????CGUCGGC?CUGAUGAG?X?CGAA?AGGAACU	????AGUUCCU?U?GCCGACG
?239	?HCV-4280	?4280	????CACAUAU?CUGAUGAG?X?CGAA?AUGAUAU	????AUAUCAU?A?AUAUGUG
					?240	?HCV-4283	?4283	????CAUCACA?CUGAUGAG?X?CGAA?AUUAUGA	????UCAUAAU?A?UGUGAUG
?241	?HCV-4337	?4337	????GGUCCAG?CUGAUGAG?X?CGAA?ACUGUGC	????GCACAGU?C?CUGGACC
					?242	?HCV-4370	?4370	????GCACGAC?CUGAUGAG?X?CGAA?AGCFGCG	????CGCGGCU?C?GUCGUGC
?243	?HCV-4373	?4373	????CGAGCAC?CUGAUGAG?X?CGAA?ACGAGCC	????GGCUCGU?C?GUGCUCG
					?244	?HCV-4379	?4379	????CGGUGGC?CUGAUGAG?X?CGAA?AGCACGA	????UCGUGCU?C?GCCACCG
?245	?HCV-4425	?4425	????UCCUCAA?CUGAUGAG?X?CGAA?AUUUGGG	????CCCAAAU?A?UUGAGCA
					?246	?HCV-4444	?4444	????AGUGUUG?CUGAUGAG?X?CGAA?ACAGAGC	????GCUCUGU?C?CAACACU
?247	?HCV-4460	?4460	????AGAAGGG?CUGAUGAG?X?CGAA?AUCUCUC	????GAGAGAU?C?CCCUUCU
					?248	?HCV-4481	?4481	????CGAGGGG?CUGAUGAG?X?CGAA?AUGGCCU	????AGGCCAU?C?CCCCUCG
?249	?HCV-4487	?4487	????UGGCCUC?CUGAUGAG?X?CGAA?AGGGGGA	????UCCCCCU?C?GAGGCCA
					?250	?HCV-4496	?4496	????CCCCCUU?CUGAUGAG?X?CGAA?AUGGCCU	????AGGCCAU?C?AAGGGGG
?251	?HCV-4528	?4528	????CUUCUUG?CUGAUGAG?X?CGAA?AGUGGCA	????UGCCACU?C?CAAGAAG
					?252	?HCV-4577	?4577	????CGGCAUU?CUGAUGAG?X?CGAA?AUUCCGA	????UCGGAAU?C?AAUGCCG
?253	?HCV-4586	?4586	????AAUACGC?CUGAUGAG?X?CGAA?ACGGCAU	????AUGCCGU?A?GCGUAUU
					?254	?HCV-4591	?4591	????CCGGUAA?CUGAUGAG?X?CGAA?ACGCUAC	????GUAGCGU?A?UUACCGG
?255	?HCV-4593	?4593	????CCCCGGU?CUGAUGAG?X?CGAA?AUACGCU	????AGCGUAU?U?ACCGGGG
					?256	?HCV-4594	?4594	????ACCCCGG?CUGAUGAG?X?CGAA?AAUACGC	????GCGUAUU?A?CCGGGGU
?257	?HCV-4616	?4616	????UCGGUAU?CUGAUGAG?X?CGAA?ACGGACA	????UGUCCGU?C?AUACCGA
					?258	?HCV-4619	?4619	????UAGUCGG?CUGAUGAG?X?CGAA?AUGACGG	????CCGUCAU?A?CCGACUA
?259	?HCV-4626	?4626	????UCUCCGC?CUGAUGAG?X?CGAA?AGUCGGU	????ACCGACU?A?GCGGAGA
					?260	?HCV-4672	?4672	????ACCGGUG?CUGAUGAG?X?CGAA?AGCCCGU	????ACGGGCU?A?CACCGGU
?261	?HCV-4697	?4697	????UGCAGUC?CUGAUGAG?X?CGAA?AUCACCG	????CGGUGAU?C?GACUGCA
					?262	?HCV-4789	?4789	????UGAGCGC?CUGAUGAG?X?CGAA?ACACCGC	????GCGGUGU?C?GGGCUCA
?263	?HCV-4795	?4795	????CCGUUGU?CUGAUGAG?X?CGAA?AGCGCGA	????UCGCGCU?C?ACAACGG
					?264	?HCV-4920	?4920	????UCAUACC?CUGAUGAG?X?CGAA?AGCACAG	????CUGUGCU?U?GGUAUGA
?265	?HCV-4924	?4924	????GAGCUCA?CUGAUGAG?X?CGAA?ACCAAGC	????GCUUGGU?A?UGAGCUC
					?266	?HCV-4931	?4931	????CGGGCGU?CUGAUGAG?X?CGAA?AGCUCAU	????AUGAGCU?C?ACGCCCG
?267	?HCV-4947	?4947	????CUGACUG?CUGAUGAG?X?CGAA?AGUCUCA	????UGAGACU?A?CAGUCAG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					268	?HCV-4952	4952	????GCAACCU?CUGAUGAG?X?CGAA?ACUGUAG	????CUACAGU?C?AGGUUGC
269	?HCV-4957	4957	????AGCCCGC?CUGAUGAG?X?CGAA?ACCUGAC	????GUCAGGU?U?GCGGGCU
					270	?HCV-4965	4965	????UUCAGGU?CUGAUGAG?X?CGAA?AGCCCGC	????GCGGGCU?U?ACCUGAA
271	?HCV-4966	4966	????AUUCAGG?CUGAUGAG?X?CGAA?AAGCCCG	????CGGGCUU?A?CCUGAAU
					272	?HCV-4974	4974	????CCUGGUG?CUGAUGAG?X?CGAA?AUUCAGG	????CCUGAAU?A?CACCAGG
273	?HCV-4984	4984	????GACGGGC?CUGAUGAG?X?CGAA?ACCCUGG	????CCAGGGU?U?GCCCGUC
					274	?HCV-4991	4991	????CCUGGCA?CUGAUGAG?X?CGAA?ACGGGCA	????UGCCCGU?C?UGCCAGG
275	?HCV-5004	5004	????AACUCCA?CUGAUGAG?X?CGAA?AUGGUCC	????GGACCAU?C?UGGAGUU
					276	?HCV-5102	5102	????GGUAUGC?CUGAUGAG?X?CGAA?ACCAGGU	????ACCUGGU?A?GCAUACC
277	?HCV-5107	5107	????GGCUUGG?CUGAUGAG?X?CGAA?AUGCUAC	????GUAGCAU?A?CCAAGCC
					278	?HCV-5133	5133	????GGAGCCU?CUGAUGAG?X?CGAA?AGCCCUG	????CAGGGCU?C?AGGCUCC
279	?HCV-5218	5218	????UAGCCUA?CUGAUGAG?X?CGAA?ACAACAG	????CUGCUGU?A?UAGGCUA
					280	?HCV-5220	5220	????CCUAGCC?CUGAUGAG?X?CGAA?AUACAGC	????GCUGUAU?A?GGCUAGG
281	?HCV-5306	5306	????UAGUGAC?CUGAUGAG?X?CGAA?ACCUCCA	????UGGAGGU?C?GUCACUA
					282	?HCV-5309	5309	????UGCUAGU?CUGAUGAG?X?CGAA?ACGACCU	????AGGUCGU?C?ACUAGCA
283	?HCV-5313	5313	????CAGGUGC?CUGAUGAG?X?CGAA?AGUGACG	????CGUCACU?A?GCACCUG
					284	?HCV-5330	5330	????CUCCGCC?CUGAUGAG?X?CGAA?ACCAGCA	????UGCUGGU?A?GGCGGAG
285	?HCV-5339	5339	????CUGCAAG?CUGAUGAG?X?CGAA?ACUCCGC	????GCGGAGU?C?CUUGCAG
					286	?HCV-5342	5342	????GAGCUGC?CUGAUGAG?X?CGAA?AGGACUC	????GAGUCCU?U?GCAGCUC
287	?HCV-5359	5359	????CAGGCAA?CUGAUGAG?X?CGAA?AUGCGGC	????GCCGCAU?A?UUGCCUG
					288	?HCV-5361	5361	????GUCAGGC?CUGAUGAG?X?CGAA?AUAUGCG	????CGCAUAU?U?GCCUGAC
289	?HCV-5376	5376	????ACCACAC?CUGAUGAG?X?CGAA?ACCGGUU	????AACCGGU?A?GUGUGGU
					290	?HCV-5399	5399	????ACAAAAU?CUGAUGAG?X?CGAA?AUCCUAC	????GUAGGAU?C?AUUUUGU
291	?HCV-5423	5423	????CGGGAAC?CUGAUGAG?X?CGAA?ACAGCCG	????CGGCUGU?U?GUUCCCG
					292	?HCV-5426	5426	????UGUCGGG?CUGAUGAG?X?CGAA?ACAACAG	????CUGUUGU?U?CCCGACA
293	?HCV-5427	5427	????CUGUCGG?CUGAUGAG?X?CGAA?AACAACA	????UGUUGUU?C?CCGACAG
					294	?HCV-5524	5524	????CUGCUUG?CUGAUGAG?X?CGAA?ACUGCUC	????GAGCAGU?U?CAAGCAG
295	?HCV-5525	5525	????UCUGCUU?CUGAUGAG?X?CGAA?AACUGCU	????AGCAGUU?C?AAGCAGA
					296	?HCV-5583	5583	????ACCACGG?CUGAUGAG?X?CGAA?AGCAGCG	????CGCUGCU?C?CCGUGGU
297	?HCV-5596	5596	????CCACCUG?CUGAUGAG?X?CGAA?ACUCCAC	????GUGGAGU?C?CAGGUGG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?298	?HCV-5612	?5612	????AGGCCUC?CUGAUGAG?X?CGAA?AGGGCCC	????GGGCCCU?U?GAGGCCU
?299	?HCV-5620	?5620	????UGCCCAG?CUGAUGAG?X?CGAA?AGGCCUC	????GAGGCCU?U?CUGGGCA
					?300	?HCV-5621	?5621	????UUGCCCA?CUGAUGAG?X?CGAA?AAGGCCU	????AGGCCUU?C?UGGGCAA
?301	?HCV-5674	?5674	????AGUGGAU?CUGAUGAG?X?CGAA?AGCCUGC	????GCAGGCU?U?AUCCACU
					?302	?HCV-5675	?5675	????GAGUGGA?CUGAUGAG?X?CGAA?AAGCCUG	????CAGGCUU?A?UCCACUC
?303	?HCV-5767	?5767	????GAUGUUG?CUGAUGAG?X?CGAA?ACAGGAG	????CUCCUGU?U?CAACAUC
					?304	?HCV-5768	?5768	????AGAUGUU?CUGAUGAG?X?CGAA?AACAGGA	????UCCUGUU?C?AACAUCU
?305	?HCV-5801	?5801	????GAGGAGC?CUGAUGAG?X?CGAA?AGUUGAG	????CUCAACU?C?GCUCCUC
					?306	?HCV-5805	?5805	????CUGGGAG?CUGAUGAG?X?CCAA?AGCGAGU	????ACUCGCU?C?CUCCCAG
?307	?HCV-5821	?5821	????GAAGGCC?CUGAUGAG?X?CGAA?AAGCAGC	????GCUGCUU?C?GGCCUUC
					?308	?HCV-5827	?5827	????GCCCACG?CUGAUGAG?X?CGAA?AGGCCGA	????UCGGCCU?U?CGUGGGC
?309	?HCV-5828	?5828	????CGCCCAC?CUGAUGAG?X?CGAA?AAGGCCG	????CGGCCUU?C?GUGGGCG
					?310	?HCV-5843	?5843	????CACCGGC?CUGAUGAG?X?CGAA?AUGCCGG	????CCGGCAU?U?GCCGGUG
?311	?HCV-5858	?5858	????UGCUGCC?CUGAUGAG?X?CGAA?ACGGCCG	????CGGCCAU?U?GGCAGCA
					?312	?HCV-5867	?5867	????CAAGGCC?CUGAUGAG?X?CGAA?AUGCUGC	????GCAGCAU?A?GGCCUUG
?313	?HCV-5873	?5873	????CCUUCCC?CUGAUGAG?X?CGAA?AGGCCUA	????UAGGCCU?U?GGGAAGG
					?314	?HCV-5905	?5905	????CGCUCCA?CUGAUGAG?X?CGAA?AGCCCGC	????GCGGGCU?A?UGGAGCG
?315	?HCV-5930	?5930	????AAGCCAC?CUGAUGAG?X?CGAA?AGUGCAC	????GUGCACU?C?GUGGCUU
					?316	?HCV-5937	?5937	????ACCUUAA?CUGAUGAG?X?CGAA?AGCCACG	????CGUGGCU?U?UUAAGGU
?317	?HCV-5938	?5938	????GACCUUA?CUGAUGAG?X?CGAA?AAGCCAC	????GUGGCUU?U?UAAGGUC
					?318	?HCV-5939	?5939	????UGACCUU?CUGAUGAG?X?CGAA?AAAGCCA	????UGGCUUU?U?AAGGUCA
?319	?HCV-5940	?5940	????AUGACCU?CUGAUGAG?X?CGAA?AAAAGCC	????GGCUUUU?A?AGGUCAU
					?320	?HCV-5945	?5945	????CGCUCAU?CUGAUGAG?X?CGAA?ACCUUAA	????UUAAGGU?C?AUGAGCG
?321	?HCV-5965	?5965	????CUCGGCG?CUGAUGAG?X?CGAA?AGGGCGC	????GCGCCCU?C?CGCCGAG
					?322	?HCV-5981	?5981	????GCAAGUU?CUGAUGAG?X?CGAA?ACCAGGU	????ACCUGGU?U?AACUUGC
?323	?HCV-5982	?5982	????AGCAAGU?CUGAUGAG?X?CGAA?AACCAGG	????CCUGGUU?A?ACUUGCU
					?324	?HCV-5990	?5990	????UGGCAGG?CUGAUGAG?X?CGAA?AGCAAGU	????ACUUGCU?C?CCUGCCA
?325	?HCV-6004	?6004	????GCCGGGG?CUGAUGAG?X?CGAA?AGAGGAU	????AUCCUCU?C?CCCCGGC
					?326	?HCV-6020	?6020	????CCCCGAC?CUGAUGAG?X?CGAA?ACCAGGG	????CCCUGGU?C?GUCGGGG
?327	?HCV-6023	?6023	????CGACCCC?CUGAUGAG?X?CGAA?ACGACCA	????UGGUCGU?C?GGGGUCG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?328	?HCV-6029	?6029	????CACACAC?CUGAUGAG?X?CGAA?ACCCCGA	????UCGGGGU?C?GUGUGUG
?329	?HCV-6044	?6044	????GACGCAG?CUGAUGAG?X?CGAA?AUUGCUG	????CAGCAAU?C?CUGCGUC
					?330	?HCV-6051	?6051	????ACGUGCC?CUGAUGAG?X?CGAA?ACGCAGG	????CCUGCGU?C?GGCACGU
?331	?HCV-6106	?6106	????CGAAGCG?CUGAUGAG?X?CGAA?ACGCUAU	????AUAGCGU?U?CGCUUCG
					?332	?HCV-6107	?6107	????GCGAAGC?CUGAUGAG?X?CGAA?AACGCUA	????UAGCGUU?C?GCUUCGC
?333	?HCV-6111	?6111	????CCCCGCG?CUGAUGAG?X?CGAA?AGCGAAC	????GUUCGCU?U?CGCGGGG
					?334	?HCV-6413	?6413	????UUUGCAU?CUGAUGAG?X?CGAA?AUGCCGU	????ACGGCAU?C?AUGCAAA
?335	?HCV-6574	?6574	????CCUGGAA?CUGAUGAG?X?CGAA?AGUUCGG	????CCGAACU?A?UUCCAGG
					?336	?HCV-6576	?6576	????GCCCUGG?CUGAUGAG?X?CGAA?AUAGUUC	????GAACUAU?U?CCAGGGC
?337	?HCV-6577	?6577	????CGCCCUG?CUGAUGAG?X?CGAA?AAUAGUU	????AACUAUU?C?CAGGGCG
					?338	?HCV-6637	?6637	????GUAGUGG?CUGAUGAG?X?CGAA?AGUCCCC	????GGGGACU?U?CCACUAC
?339	?HCV-6638	?6638	????CGUAGUG?CUGAUGAG?X?CGAA?AAGUCCC	????GGGACUU?C?CACUACG
					?340	?HCV-6643	?6643	????CGUCACG?CUGAUGAG?X?CGAA?AGUGGAA	????UUCCACU?A?CGUGACG
?341	?HCV-6671	?6671	????GGCAUUU?CUGAUGAG?X?CGAA?ACGUUGU	????ACAACGU?A?AAAUGCC
					?342	?HCV-6703	?6703	????GGUGAAG?CUGAUGAG?X?CGAA?AUUCGGG	????CCCGAAU?U?CUUCACC
?343	?HCV-6704	?6704	????CGGUGAA?CUGAUGAG?X?CGAA?AAUUCGG	????CCGAAUU?C?UUCACCG
					?344	?HCV-6706	?6706	????UUCGGUG?CUGAUGAG?X?CGAA?AGAAUUC	????GAAUUCU?U?GACCGAA
?345	?HCV-6707	?6707	????AUUCGGU?CUGAUGAG?X?CGAA?AAGAAUU	????AAUUCUU?C?ACCGAAU
					?346	?HCV-6715	?6715	????CCCGUCC?CUGAUGAG?X?CGAA?AUUCGGU	????ACCGAAU?U?GGACGGG
?347	?HCV-6730	?6730	????CCUGUGC?CUGAUGAG?X?CGAA?ACCGCAC	????GUGCGGU?U?GCACAGG
					?348	?HCV-6739	?6739	????CGGAGCG?CUGAUGAG?X?CGAA?ACCUGUG	????CACAGGU?A?CGCUCCG
?349	?HCV-6744	?6744	????CACGCCG?CUGAUGAG?X?CGAA?AGCGUAC	????GUACGCU?C?CGGCGUG
					?350	?HCV-6759	?6759	????CGUAGGA?CUGAUGAG?X?CGAA?AGGUCUG	????CAGACCU?C?UCCUACG
?351	?HCV-6761	?6761	????CCCGUAG?CUGAUGAG?X?CGAA?AGAGGUC	????GACCUCU?C?CUACGGG
					?352	?HCV-6764	?6764	????CCUCCCG?CUGAUGAG?X?CGAA?AGGAGAG	????CUCUCCU?A?CGGGAGG
?353	?HCV-6776	?6776	????GGAAUGU?CUGAUGAG?X?CGAA?ACAUCCU	????AGGAUGU?C?ACAUUCC
					?354	?HCV-6782	?6782	????CGACCUG?CUGAUGAG?X?CGAA?AAUGUGA	????UCACAUU?C?CAGGUCG
?355	?HCV-6788	?6788	????UGAGCCC?CUGAUGAG?X?CGAA?ACCUGGA	????UCCAGGU?C?GGGCUCA
					?356	?HCV-6794	?6794	????AUUGGUU?CUGAUGAG?X?CGAA?AGCCCGA	????UCGGGCU?C?AACCAAU
?357	?HCV-6802	?6802	????AACCAGG?CUGAUGAG?X?CGAA?AUUGGUU	????AACCAU?A?CCUGGUU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?358	?HCV-6809	6809	????GUGACCC?CUGAUGAG?X?CGAA?ACCAGGU	????ACCUGGU?U?GGGUCAC
?359	?HCV-6814	6814	????GAGCUGU?CUGAUGAG?X?CGAA?ACCCAAC	????GUUGGGU?C?ACAGCUC
					?360	?HCV-6821	6821	????CGCAUGG?CUGAUGAG?X?CGAA?AGCUGUG	????CACAGCU?C?CCAUGCG
?361	?HCV-6906	6906	????GCCAGCC?CUGAUGAG?X?CGAA?ACGUUUA	????UAAACGU?A?GGCUGGC
					?362	?HCV-6922	6922	????GGGGGGA?CUGAUGAG?X?CGAA?ACCCCCU	????AGGGGGU?C?UCCCCCC
?363	?HCV-6924	6924	????GAGGGGG?CUGAUGAG?X?CGAA?AGACCCC	????GGGGUCU?C?CCCCCUC
					?364	?HCV-6931	6931	????GGCCAAG?CUGAUGAG?X?CGAA?AGGGGGG	????CCCCCCC?C?CUUGGCC
?365	?HCV-6934	6934	????GCUGGCC?CUGAUGAG?X?CGAA?AGGAGGG	????CCCUCCU?U?GGCCAGC
					?366	?HCV-6943	6943	????AGCUGAA?CUGAUGAG?X?CGAA?AGCUGGC	????GCCAGCU?C?UUCAGCU
?367	?HCV-6958	6958	????CGCAGAC?CUGAUGAG?X?CGAA?AUUGGCU	????AGCCAAU?U?GUCUGCG
					?368	?HCV-6961	6961	????AGGCGCA?CUGAUGAG?X?CGAA?ACAAUUG	????CAAUUGU?C?UGCGCCU
?369	?HCV-7034	7034	????GCCACAG?CUGAUGAG?X?CGAA?AGGUUGG	????CCAACCU?C?CUGUGGC
					?370	?HCV-7118	7118	????CCGCUCG?CUGAUGAG?X?CGAA?AGCGGGU	????ACCCGCU?U?CGAGCGG
?371	?HCV-7119	7119	????UCCGCUC?CUGAUGAG?X?CGAA?AAGCGGG	????CCCGCUU?C?GAGCGGA
					?372	?HCV-7145	7145	????CAACGGA?CUGAUGAG?X?CGAA?ACUUCCC	????GGGAAGU?A?UCCGUUG
?373	?HCV-7195	7195	????UAUGGGC?CUGAUGAG?X?CGAA?ACGCGGG	????CCCGCGU?U?GCCCAUA
					?374	?HCV-7202	7202	????GUGCCCA?CUGAUGAG?X?CGAA?AUGGGCA	????UGCCCAU?A?UGGGCAC
?375	?HCV-7218	7218	????GGGUUGU?CUGAUGAG?X?CGAA?AUCCGGG	????CCCGGAU?U?ACAACCC
					?376	?HCV-7219	7219	????AGGGUUG?CUGAUGAG?X?CGAA?AAUCCGG	????CCGGAUU?A?CAACCCU
?377	?HCV-7234	7234	????GGACUCU?CUGAUGAG?X?CGAA?ACAGUGG	????CCACUGU?U?AGAGUCC
					?378	?HCV-7235	7235	????AGGACUC?CUGAUGAG?X?CGAA?AACAGUG	????CACUGUU?A?GAGUCCU
?379	?HCV-7251	7251	????UAGUCCG?CUGAUGAG?X?CGAA?ACUUUUC	????CAAAAGU?C?CGGACUA
					?380	?HCV-7258	7258	????AGGGACG?CUGAUGAG?X?CGAA?AGUCCGG	????CCGGACU?A?CGUCCCU
?381	?HCV-7262	7262	????CCGGAGG?CUGAUGAG?X?CGAA?ACGUAUGU	????ACUACGU?C?CCUCCGG
					?382	?HCV-7266	7266	????ACCGCCG?CUGAUGAG?X?CGAA?AGGGACG	????CGUCCCU?C?CGGCGGU
?383	?HCV-7288	7288	????AGGCGGC?CUGAUGAG?X?CGAA?AUGGGCA	????UGCCCAU?U?GCCGCCU
					?384	?HCV-7296	7296	????CCCGUGG?CUGAUGAG?X?CGAA?AGGCCGC	????GCCGCCU?A?CCACGGG
?385	?HCV-7354	7354	????CACGGUG?CUGAUGAG?X?CGAA?ACUCUGU	????ACAGAGU?C?CACCGUG
					?386	?HCV-7386	7386	????GUCUUAG?CUGAUGAG?X?CGAA?AGCCAGC	????GCUGGCU?A?CUAAGAC
?387	?HCV-7389	7389	????AAAGUCU?CUGAUGAG?X?CGAA?AGUAGCC	????GGCUACU?A?AGACUUU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?388	?HCV-7395	?7395	????CUGCCGA?CUGAUGAG?X?CGAA?AGUCUUA	????UAAGACU?U?UCGGCAG
?389	?HCV-7396	?7396	????GCUGCCG?CUGAUGAG?X?CGAA?AAGUCUU	????AAGACUU?U?CGGCAGC
					?390	?HCV-7397	?7397	????AGCUGCC?CUGAUGAG?X?CGAA?AAAGUCU	????AGACUUU?C?GGCAGCU
?391	?HCV-7411	?7411	????GGCCGAC?CUGAUGAG?X?CGAA?AUCCGGA	????UCCGGAU?C?GUCGGCC
					?392	?HCV-7414	?7414	????AACGGCC?CUGAUGAG?X?CGAA?ACGAUCC	????GGAUCGU?C?GGCCGUU
?393	?HCV-7421	?7421	????CGCUGUC?CUGAUGAG?X?CGAA?ACGGCCG	????CGGCCGU?U?GACAGCG
					?394	?HCV-7498	?7498	????CAUGGAG?CUGAUGAG?X?CGAA?AGUACGA	????UCGUACU?C?CUCCAUG
?395	?HCV-7501	?7501	????GGGCAUG?CUGAUGAG?X?CGAA?AGGAGUA	????UACUCCU?C?CAUGCCC
					?396	?HCV-7514	?7514	????CCCCCUC?CUGAUGAG?X?CGAA?AGGGGGG	????CCCCCCU?U?GAGGGGG
?397	?HCV-7539	?7539	????UCGCUGA?CUGAUGAG?X?CGAA?AUCAGGG	????CCCUGAU?C?UCAGCGA
					?398	?HCV-7541	?7541	????CGUCGCU?CUGAUGAG?X?CGAA?AGAUCAG	????CUGAUCU?C?AGCGACG
?399	?HCV-7552	?7552	????AGACCAA?CUGAUGAG?X?CGAA?ACCCGUC	????GACGGGU?C?UUGGUCU
					?400	?HCV-7554	?7554	????GUAGACC?CUGAUGAG?X?CGAA?AGACCCG	????CGGGUCU?U?GGUCUAC
?401	?HCV-7558	?7558	????CACGGUA?CUGAUGAG?X?CGAA?ACCAAGA	????UCUUGGU?C?UACCGUG
					?402	?HCV-7560	?7560	????CUCACGG?CUGAUGAG?X?CGAA?AGACCAA	????UUGGUCU?A?CCGUGAG
?403	?HCV-7589	?7589	????AGCAGAC?CUGAUGAG?X?CGAA?AUGUCGU	????ACGACAU?C?GUCUGCU
					?404	?HCV-7592	?7592	????AGCAGCA?CUGAUGAG?X?CGAA?ACGAUGU	????ACAUCGU?C?UGCUGCU
?405	?HCV-7600	?7600	????GGACAUU?CUGAUGAG?X?CGAA?AGCAGCA	????UGCUGCU?C?AAUGUCC
					?406	?HCV-7606	?7606	????UGUGUAG?CUGAUGAG?X?CGAA?ACAUUGA	????UCAAUGU?C?CUACACA
?407	?HCV-7667	?7667	????ACGCGUU?CUGAUGAG?X?CGAA?AUGGGCA	????UGCCCAU?C?AACGCGU
					?408	?HCV-7723	?7723	????ACUGCGG?CUGAUGAG?X?CGAA?AUGUUGU	????ACAACAU?C?CCGCAGU
?409	?HCV-7775	?7775	????CGUCCAG?CUGAUGAG?X?CGAA?ACUUGCA	????UGCAAGU?C?CUGGACG
					?410	?HCV-7789	?7789	????GUCCCGG?CUGAUGAG?X?CGAA?AGUGGUC	????GACCACU?A?CCGGGAC
?411	?HCV-7899	?7839	????AGAAGUU?CUGAUGAG?X?CGAA?AGCCUUA	????UAAGGCU?A?AACUUCU
					?412	?HCV-7847	?7847	????CUACGGA?CUGAUGAG?X?CGAA?AGAAGUU	????AACUUCU?A?UCCGUAG
?413	?HCV-7849	?7849	????UUCUACG?CUGAUGAG?X?CGAA?AUAGAAG	????CUUCUAU?C?CGUAGAA
					?414	?HCV-7853	?7853	????CUUCUUC?CUGAUGAG?X?CGAA?ACGGAUA	????UAUCCGU?A?GAAGAAG
?415	?HCV-7894	?7894	????AAAUUUA?CUGAUGAG?X?CGAA?AUUUGGC	????GCCAAAU?C?UAAAUUU
					?416	?HCV-7896	?7896	????CCAAAUU?CUGAUGAG?X?CGAA?AGAUUUG	????CAAAUCU?A?AAUUUGG
?417	?HCV-7900	?7900	????AUAGCCA?CUGAUGAG?X?CGAA?AUUUAGA	????UCUAAAU?U?UGGCUAU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					?418	?HCV-7901	?7901	????CAUAGCC?CUGAUGAG?X?CGAA?AAUUUAG	?CUAAAUU?U?GGCUAUG
?419	?HCV-7906	?7906	????UGCCCCA?CUGAUGAG?X?CGAA?AGCCAAA	?UUUGGCU?A?UGGGGCA
					?420	?HCV-7955	?7955	????CGGAGCG?CUGAUGAG?X?CGAA?AUGUGGU	?ACCACAU?C?CGCUCCG
?421	?HCV-7960	?7960	????CCACACG?CUGAUGAG?X?CGAA?AGCGGAU	?AUCCGCU?C?CGUGUGG
					?422	?HCV-8075	?8075	????AUACGAU?CUGAUGAG?X?CGAA?AGGCGAG	?CUCGCCU?U?AUCGUAU
?423	?HCV-8076	?8076	????AAUACGA?CUGAUGAG?X?CGAA?AAGGCGA	?UCGCCUU?A?UCGUAUU
					?424	?HCV-8078	?8078	????GGAAUAC?CUGAUGAG?X?CGAA?AUAAGGC	?GCCUUAU?C?GUAUUCC
?425	?HCV-8170	?8170	????GAAUCCG?CUGAUGAG?X?CGAA?ACGAGGA	?UCCUCGU?A?CGGAUUC
					?426	?HCV-8176	?8176	????GUACUGG?CUGAUGAG?X?CGAA?AUCCGUA	?UACGGAU?U?CCAGUAC
?427	?HCV-8182	?8182	????AGGAGAG?CUGAUGAG?X?CGAA?ACUGGAA	?UUCCAGU?A?CUCUCCU
					?428	?HCV-8187	?8187	????UGCCCAG?CUGAUGAG?X?CGAA?AGAGUAC	?GUACUCU?C?CUGGGCA
?429	?HCV-8201	?8201	????GGAACUC?CUGAUGAG?X?CGAA?ACCCGCU	?AGGCGGU?U?GAGUUCC
					?430	?HCV-8206	?8206	????CACCAGG?CUGAUGAG?X?CGAA?ACUCAAC	?GUUGAGU?U?CCUGGUG
?431	?HCV-8207	?8207	????UCACCAG?CUGAUGAG?X?CGAA?AACUCAA	?UUGAGUU?C?CUGGUGA
					?432	?HCV-8227	?8227	????UUUCUUU?CUGAUGAG?X?CGAA?AUUUCCA	?UGGAAAU?C?AAAGAAA
?433	?HCV-8357	?8357	????GCGACUU?CUGAUGAG?X?CGAA?AUGGCCU	?AGGCCAU?A?AAGUCGC
					?434	?HCV-8362	?8362	????CGUGAGC?CUGAUGAG?X?CGAA?ACUUUAU	?AUAAAGU?C?GCUCACG
?435	?HCV-8366	?8366	????GCUCCGU?CUGAUGAG?X?CGAA?AGCGACU	?AGUCGCU?C?ACGGAGC
					?436	?HCV-8378	?8378	????CGAUGUA?CUGAUGAG?X?CGAA?AGCCGCU	?AGCGGCU?C?UACAUCG
?437	?HCV-8380	?8380	????CCCGAUG?CUGAUGAG?X?CGAA?AGAGCCG	?CGGCUCU?A?CAUCGGG
					?438	?HCV-8384	?8384	????GGCCCCC?CUGAUGAG?X?CGAA?AUGUAGA	?UCUACAU?C?GGGGGCC
?439	?HCV-8424	?8424	????CGGCGAU?CUGAUGAG?X?CGAA?ACCGCAG	?CUGCGGU?U?AUCGCCG
					?440	?HCV-8425	?8425	????CCGGCGA?CUGAUGAG?X?CGAA?AACCGCA	?UGCGGUU?A?UCGCCGG
?441	?HCV-8427	?8427	????CACCGGC?CUGAUGAG?X?CGAA?AUAACCG	?CGGUUAU?C?GCCGGUG
					?442	?HCV-8460	?8460	????CCGCAGC?CUGAUGAG?X?CGAA?AGUCGUC	?GACGACU?A?GCUGCGG
?443	?HCV-8508	?8508	????GCAGCUC?CUGAUGAG?X?CGAA?ACAGGCC	?GGCCUGU?C?GAGCUGC
					?444	?HCV-8522	?8522	????AGUCCUG?CUGAUGAG?X?CGAA?AGCUUUG	?CAAAGCU?C?CAGGACU
?445	?HCV-8540	?8540	????CGUUCAC?CUGAUGAG?X?CGAA?AGCAUCG	?CGAUGCU?C?GUGAACG
					?446	?HCV-8558	?8558	????UAACGAC?CUGAUGAG?X?CGAA?AGGUCGU	?AGCACCU?U?GUCGUUA
?447	?HCV-8561	?8561	????AGAUAAC?CUGAUGAG?X?CGAA?ACAAGGU	?ACCUUGU?C?GUUAUCU

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					448	HCV-8564	?8564	????CACAGAU?CUGAUGAG?X?CGAA?ACGACAA	????UUGUCGU?U?AUCUGUG
449	HCV-8638	?8638	????GGGGGCA?CUGAUGAG?X?CGAA?AGUACCU	????AGGUACU?C?UGCCCCC
					450	HCV-8671	?8671	????CAAGUCG?CUGAUGAG?X?CGAA?AUUCUGG	????CCAGAAU?A?CGACUUG
451	HCV-8698	?8698	????GUUGGAG?CUGAUGAG?X?CGAA?AGCGUGA	????UCAUGCU?C?CUCCAAC
					452	HCV-8701	?8701	????CACGUUG?CUGAUGAG?X?CGAA?AGGAGCA	????UGCUCCU?C?CAACGUG
453	HCV-8728	?8728	????UUUGCCG?CUGAUGAG?X?CGAA?AUGCGUC	????GACGCAU?C?CGGCAAA
					454	HCV-8774	?8774	????CCCGUGC?CUGAUGAG?X?CGAA?AGGGGGG	????CCCCCCU?U?GCACGGG
455	HCV-8842	?8842	????GGGCGCA?CUGAUGAG?X?CGAA?ACAUGAU	????AUCAUGU?A?UGCGCCC
					456	HCV-8854	?8854	????UGCCCAU?CUGAUGAG?X?CGAA?AGGUGGG	????CCCACCU?U?AUGGGCA
457	HCV-8855	?8855	????UUGCCCA?CUGAUGAG?X?CGAA?AAGGUGG	????CCACCUU?A?UGGGCAA
					458	HCV-8871	?8871	????GUCAUCA?CUGAUGAG?X?CGAA?AAUCAUC	????GAUGAUU?U?UGAUGAC
459	HCV-8880	?8880	????AAGAAGU?CUGAUGAG?X?CGAA?AGUCAUC	????GAUGACU?C?ACUUCUU
					460	HCV-8931	?8931	????AUCUGAC?CUGAUGAG?X?CGAA?AUCCAGG	????CCUGGAU?U?GUCAGAU
461	HCV-8934	?8934	????UAGAUCU?CUGAUGAG?X?CGAA?ACAAUCC	????GGAUUGU?C?AGAUCUA
					462	HCV-8939	?8939	????CCCCGUA?CUGAUGAG?X?CGAA?AUCUGAC	????GUCAGAU?C?UACGGGG
463	HCV-8941	?8941	????GGCCCCG?CUGAUGAG?X?CGAA?AGAUCUG	????CAGAUCU?A?CGGGGCC
					464	HCV-9065	?9065	????GUUUCCU?CUGAUGAG?X?CGAA?AGGCAUG	????CAUGCCU?C?AGGAAAC
465	HCV-9074	?9074	????GUACCCC?CUGAUGAG?X?CGAA?AGUUUCC	????GGAAACU?U?GGGGUAC
					466	HCV-9080	?9080	????AGGGCGG?CUGAUGAG?X?CGAA?ACCCCAA	????UUGGGGU?A?CCGCCCU
467	HCV-9088	?9088	????GACUCGC?CUGAUGAG?X?CGAA?AGGGCGG	????CCGCCCU?U?GCGAGUC
					468	HCV-9095	?9095	????GUCUCCA?CUGAUGAG?X?CGAA?ACUCGCA	????UGCGAGU?C?UGGAGAC
469	HCV-9119	?9119	????UAGCGCG?CUGAUGAG?X?CGAA?ACACUUC	????GAAGUGU?C?CGCGCUA
					470	HCV-9126	?9126	????AGUAGCC?CUGAUGAG?X?CGAA?AGCGCGG	????CCGCGCU?A?GGCUACU
471	HCV-9131	?9131	????GGGACAG?CUGAUGAG?X?CGAA?ACGGUAG	????CUAGGCU?A?CUGUCCC
					472	HCV-9136	?9136	????CCCUUGG?CUGAUGAG?X?CGAA?ACAGUAG	????CUACUGU?C?CCAAGGG
473	HCV-9226	?9226	????CAGCUGG?CUGAUGAG?X?CGAA?ACGCGGC	????GCCGCGU?C?CCAGCUG
					474	HCV-9238	?9238	????GCUGGAC?CUGAUGAG?X?CGAA?ACUCCAG	????CUGGACU?U?GUCCAGC
475	HCV-9241	?9241	????CCAGCUG?CUGAUGAG?X?CGAA?ACAAGUC	????GACUUGU?C?CAGCUGG
					476	HCV-9250	?9250	????AGCAACG?CUGAUGAG?X?CGAA?ACCAGCU	????AGCUGGU?U?CGUUGCU
477	HCV-9251	?9251	????CAGCAAC?CUGAUGAG?X?CGAA?AACCAGC	????GCUGGUU?C?GUUGCUG

Numbering	Title	Nucleotide position	Hammerhead ribozyme	Substrate
					478	?HCV-9254	?9254	????AACCAGC?CUGAUGAG?X?CGAA?ACGAACC	????GGUUCGU?U?GCUGGUU
479	?HCV-9278	?9278	????UGUGAUA?CUGAUGAG?X?CGAA?AUGUCUC	????GAGACAU?A?UAUCACA
					480	?HCV-9280	?9280	????GCUGUGA?CUGAUGAG?X?CGAA?AUAUGUC	????GACAUAU?A?UCACAGC
481	?HCV-9282	?9282	????AGGCUGU?CUGAUGAG?X?CGAA?AUAUAUG	????CAUAUAU?C?ACAGCCU
					482	?HCV-9292	?9292	????GGCACGA?CUGAUGAG?X?CGAA?ACAGGCU	????AGCCUGU?C?UCGUGCC
483	?HCV-9326	?9326	????GUAGGAG?CUGAUGAG?X?CGAA?AGGCACC	????GGUGCCU?A?CUCCUAC
					484	?HCV-9329	?9329	????AAAGUAG?CUGAUGAG?X?CGAA?AGUAGGC	????GCCUACU?C?CUACUUU
485	?HCV-9332	?9332	????CGGAAAG?CUGAUGAG?X?CGAA?AGGAGUA	????UACUCCU?A?CUUUCCG
					486	?HCV-9335	?9335	????CUACGGA?CUGAUGAG?X?CGAA?AGUAGGA	????UCCUACU?U?UCCGUAG
487	?HCV-9336	?9336	????CCUACGG?CUGAUGAG?X?CGAA?AAGUAGG	????CCUACUU?U?CCGUAGG
					488	?HCV-9337	?9337	????CCCUACG?CUGAUGAG?X?CGAA?AAAGUAG	????CUACUUU?C?CGUAGGG
489	?HCV-9341	?9341	????CUACCCC?CUGAUGAG?X?CGAA?ACGGAAA	????UUUCCGU?A?GGGGUAG
					490	?HCV-9347	?9347	????AGAUGCC?CUGAUGAG?X?CGAA?ACCCCUA	????UAGGGGU?A?GGCAUCU
491	?HCV-9353	?9353	????GCAGGUA?CUGAUGAG?X?CGAA?AUGCCUA	????UAGGCAU?C?UACCUGC
					492	?HCV-9355	?9355	????GAGCAGG?CUGAUGAG?X?CGAA?AGAUGCC	????GGCAUCU?A?CCUGCUC
493	?HCV-9362	?9362	????GGUUGGG?CUGAUGAG?X?CGAA?AGCAGGU	????ACCUGCU?C?CCCAACC
					494	?HCV-9385	?9385	????GAGUGAU?CUGAUGAG?X?CGAA?AGCUCCC	????GGGAGCU?A?AUCACUC
495	?HCV-9388	?9388	????CUGGAGU?CUGAUGAG?X?CGAA?AUUAGCU	????AGCUAAU?C?ACUCCAG
					496	?HCV-9392	?9392	????UGGCCUG?CUGAUGAG?X?CGAA?AGUGAUU	????AAUCACU?C?CAGGCCA
497	?HCV-9402	?9402	????GAUGGCC?CUGAUGAG?X?CGAA?AUUGGCC	????GGCCAAU?A?GGCCAUC

Wherein on behalf of the length of stem II district (Hertel etc., 1992, nucleic acids research, 20: 3252) the stem II of HH ribozyme, " X " can be 2 base pairs.

Table VI: other HCV tup type (HH) ribozyme and target sequence

The position	Ribozyme	Substrate
			????14	????CGCCCCC?CUGAUGAG?X?CGAA?AUCGGGG	?CCCCGAU?U?GGGGGCG
????34	????AGUGAUC?CUGAUGAG?X?CGAA?AUGGUGG	?CCACCAU?A?GAUCACU
			????38	????GGGGAGU?CUGAUGAG?X?CGAA?AUCUAUG	?CAUAGAU?C?ACUCCCC
????42	????CACAGGG?CUGAUGAG?X?CGAA?AGUGAUC	?GAUCACU?C?CCCUGUG
			????57	????AAGACAG?CUGAUGAG?X?CGAA?AGUUCCU	?AGGAACU?A?CUGUCUU
????62	????GCGUGAA?CUGAUGAG?X?CGAA?ACAGUAG	?CUACUGU?C?UUCACGC
			????64	????CUGCGUG?CUGAUGAG?X?CGAA?AGACAGU	?ACUGUCU?U?CACGCAG
????65	????UCUGCGU?CUGAUGAG?X?CGAA?AAGACAG	?CUGUCUU?C?ACGCAGA
			????79	????AUGGCUA?CUGAUGAG?X?CGAA?ACGCUUU	?AAAGCGU?C?UAGCCAU
????81	????CCAUGGC?CUGAUGAG?X?CGAA?AGACGCU	?AGCGUCU?A?GCCAUGG
			????92	????UCAUACU?CUGAUGAG?X?CGAA?ACGCCAU	?AUGGCGU?U?AGUAUGA
????93	????CUCAUAC?XUGAUGAG?X?CGAA?AACGCCA	?UGGCGUU?A?GUAUGAG
			????96	????ACACUCA?CUGAUGAG?X?CGAA?ACUAACG	?CGUUAGU?A?UGAGUGU
????104	????GCUGCAC?CUGAUGAG?X?CGAA?ACACUCA	?UGAGUGU?C?GUGCAGC
			????142	????AGACCAC?CUGAUGAG?X?CGAA?AUGGCUC	?GAGCCAU?A?GUGGUCU
????192	????AAGAAAG?CUGAUGAG?X?CGAA?ACCCGGU	?ACCGGGU?C?CUUUCUU
			????195	????UCCAAGA?CUGAUGAG?X?CGAA?AGGACCC	?GGGUCCU?U?UCUUGGA
????196	????AUCCAAG?CUGAUGAG?X?CGAA?AAGGACC	?GGUCCUU?U?CUUGGAU
			????197	????GAUCCAA?CUGAUGAG?X?CGAA?AAAGGAC	?GUCCUUU?C?UUGGAUC
????204	????GCGGGUU?CUGAUGAG?X?CGAA?AUCCAAG	?CUUGGAU?C?AACCCGC
			????227	????ACGCCCA?CUGAUGAG?X?CGAA?AUCUCCA	?UGGAGAU?U?UGGGCGU
????228	????CACGCCC?XUGAUGAG?X?CGAA?AAUCUCC	?GGAGAUU?U?GGGCGUG
			????282	????GUACCAC?CUGAUGAG?X?CGAA?AGGCCUU	?AAGGCCU?U?GUGGUAC
????354	????GGUUUAG?CUGAUGAG?X?CGAA?AUUCGUG	?CACGAAU?C?CUAAACC
			????357	????UGAGGUU?CIGAUGAG?X?CGAA?AGGAUUC	?GAAUCCU?A?AACCUCA
????363	????UUUCUUU?CUGAUGAG?X?CGAA?AGGUUUA	?UAAACCU?C?AAAGAAA
			????381	????UAGGUGU?CUGAUGAG?X?CGAA?ACGUUUG	?CAAACGU?A?ACACCUA
????388	????GCGGCGG?CUGAUGAG?X?CGAA?AGGUGUU	?AACACCU?A?CCGCCGC

The position	Ribozyme	Substrate
			????431	????CACCAAC?CUGAUGAG?X?CGAA?AUCUGAC	?GUCAGAU?C?GUUGGUG
????434	????CUCCACC?CUGAUGAG?X?CGAA?ACGAUCU	?AGAUCGU?U?GGUGGAG
			????443	????ACACGUA?CUGAUGAG?X?CGAA?ACUCCAC	?GUGGAGU?U?UACGUGU
????444	????AACACGU?CUGAUGAG?X?CGAA?AACUCCA	?UGGAGUU?U?ACGUGUU
			????445	????CAACACG?CUGAUGAG?X?CGAA?AAACUCC	?GGAGUUU?A?CGUGUUG
????451	????GCGCGGC?CUGAUGAG?X?CGAA?ACACGUA	?UACGUGU?U?GCCGCGC
			????516	????CUUCCAC?CUGAUGAG?X?CGAA?AGGUUGC	?GCAACCU?C?GUGGAAG
????688	????AUUGCGC?CUGAUGAG?X?CGAA?ACCUCCG	?CGGAGGU?C?GCGCAAU
			????702	????AUGACCU?CUGAUGAG?X?CGAA?ACCCAGC	?UCUGGGU?A?AGGUCAU
????719	????CGCACGU?CUGAUGAG?X?CGAA?AGGGUAU	?AUACCCU?C?ACGUGCG
			????740	????ACCCCAU?CUGAUGAG?X?CGAA?AGGUCGG	?CCGACCU?C?AUGGGGU
????861	????AUAGAGA?CUGAUGAG?X?CGAA?AGAGCAA	?UUGCUCU?U?UCUCUAU
			????862	????GAUAGAG?CUGAUGAG?X?CGAA?AAGAGCA	?UGCUCUU?U?CUCUAUC
????863	????AGAUAGA?CUGAUGAG?X?CGAA?AAAGAGC	?GCUCUUU?C?UCUAUCU
			????865	????GAAGAUA?CUGAUGAG?X?CGAA?AGAAAGA	?UCUUUCU?C?UAUCUUC
????867	????AGGAAGA?CUGAUGAG?X?CGAA?AGAGAAA	?UUUCUCU?A?UCUUCCU
			????869	????AGAGGAA?CUGAUGAG?X?CGAA?AUAGAGA	?UCUCUAU?C?UUCCUCU
????871	????CAAGAGG?CUGAUGAG?X?CGAA?AGAUAGA	?UCUAUCU?U?CCUCUUG
			????872	????CCAAGAG?CUGAUGAG?X?CGAA?AAGAUAG	?CUAUCUU?C?CUCUUGG
????875	????GGGCCAA?CUGAUGAG?X?CGAA?AGGAAGA	?UCUUCCU?C?UUGGCCC
			????877	????CAGGGCC?CUGAUGAG?X?CGAA?AGAGGAA	?UUCCUCU?U?GGCCCUG
????889	????CAAACAG?CUGAUGAG?X?CGAA?ACAGCAG	?CUGCUGU?C?CUGUUUG
			????894	????AUGGUCA?CUGUAGAG?X?CGAA?ACAGGAC	?GUCCUGU?U?UGACCAU
????895	????GAUGGUC?CUGAUGAG?X?CGAA?AACAGGA	?UCCUGUU?U?GACCAUC
			????902	????AAGCUGG?CUGAUGAF?X?CGAA?AUGGUCA	?UGACCAU?C?CCAGCUU
????909	????UAAGCGG?CUGAUGAG?X?CGAA?AGCUGGG	?CCCAGCU?U?CCGCUUA
			????910	????AUAAGCG?CUGAUGAG?X?CGAA?AAGCUGG	?CCAGCUU?C?CGCUUAU
????915	????ACCUGAU?CUGAUGAG?X?CGAA?AGCGGAA	?UUCCGCU?U?AUCAGGU
			????916	????CACCUGA?CUGAUGAG?X?CGAA?AAGCGGA	?UCCGCUU?A?UCAGGUG
????918	????CGCACCU?CUGAUGAG?X?CGAA?AUAAGCG	?CGCUUAU?C?AGGUGCG

The position	Ribozyme	Substrate
			????934	????CAGCCCG?CUGAUGAG?X?CGAA?AUGCGUU	?AACGCAU?C?CGGGCUG
????943	????GACAUGG?CUGAUGAG?X?CGAA?ACAGCCC	?GGGCUGU?A?CCAUGUC
			????950	????CAUUCGU?CUGAUGAG?X?CGAA?ACAUGGU	?ACCAUGU?C?ACGAAUG
????964	????UGAGUUG?CUGAUGAG?X?CGAA?AGCAGUC	?GACUGCU?C?CAACUCA
			????970	????AAUGCUU?CUGAUGAG?X?CGAA?AGUUGGA	?UCCAACU?C?AAGCAUU
????977	????CAUACAC?CUGAUGAG?X?CGAA?AUGCUUG	?CAAGCAU?U?GUGUAUG
			????1008	????CCGGGGG?CUGAUGAG?X?CGAA?AUGCAUG	?CAUGCAU?A?CCCCCGG
????1067	????UGGGAGU?CUGAUGAG?X?CGAA?AGCGCUA	?UAGCGCU?C?ACUCCCA
			????1071	????AGCGUGG?CUGAUGAG?X?CGAA?AGUGAGC	?GCUCACU?C?CCACGCU
????1079	????UGGCCGC?CUGAUGAG?X?CGAA?AGCGUGG	?CCACGCU?C?GCGGCCA
			????1100	????UAGUGGG?CUGAUGAG?X?CGAA?AUGCUGG	?CCAGCAU?C?CCCACUA
????1107	????AUUGUCG?CUGAUGAG?X?CGAA?AGUGGGG	?CCCCACU?A?CGACAAU
			????1115	????GGCGUCG?CUGAUGAG?X?CGAA?AUUGUCG	?CGACAAU?A?CGACGCC
????1152	????GAACAGA?CUGAUGAG?X?CGAA?AGCGGCC	?GGCCGCU?U?UCUGUUC
			????1181	????AUCCGCA?CUGAUGAG?X?CGAA?AGGUCCC	?GGGACCU?C?UGCGGAU
????1199	????GGGAGAC?CUGAUGAG?X?CGAA?AGGAAAA	?UUUUCCU?C?CUCUCCC
			????1202	????ACUGGGA?CUGAUGAG?X?CGAA?ACGAGGA	?UCCUCGU?C?UCCCAGU
????1204	????CAACUGG?CUGAUGAG?X?CGAA?AGACGAG	?CUCGUCU?C?CCAGUUG
			????1210	????GGUGAAC?CUGAUGAG?X?CGAA?ACUGGGA	?UCCCAGU?U?GUUCACC
????1213	????GAAGGUG?CUGAUGAG?X?CGAA?ACAACUG	?CAGUUGU?U?CACCUUC
			????1214	????AGAAGGU?CUGAUGAG?X?CGAA?AACAACU	?AGUUGUU?C?ACCUUCU
????1219	????AGGCGAG?CUGAUGAG?X?CGAA?AGGUGAA	?UUCACCU?U?CUCGCCU
			????1220	????GAGGCGA?CUGAUGAG?X?CGAA?AAGGUGA	?UCACCUU?C?UCGCCUC
????1222	????GCGAGGC?CUGAUGAG?X?CGAA?AGAAGGU	?ACCUUCU?C?GCCUCGC
			????1227	????UACCGGC?CUGAUGAG?X?CGAA?AGGCGAG	?CUCGCCU?C?GCCGGUA
????1234	????UGUCUCA?CUGAUGAG?X?CGAA?ACCGGCG	?CGCCGGU?A?UGAGACA
			????1244	????AGUCCUG?CUGAUGAG?X?CGAA?ACUGUCU	?AGACAGU?A?CAGGACU
????1257	????AUUGAGC?CUGAUGAG?X?CGAA?AUUGCAG	?CUGCAAU?U?GCUCAAU
			????1261	????AUAGAUU?CUGAUGAG?X?CGAA?AGCAAUU	?AAUUGCU?C?AAUCUAU
????1265	????CGGGAUA?CUGAUGAG?X?CGAA?AUUGAGC	?GCUCAAU?C?UAUCCCG

The position	Ribozyme	Substrate
			????1267	????GCCGGGA?CUGAUGAG?X?CGAA?AGAUUGA	?UCAAUCU?A?UCCCGGC
????1269	????UGGCCGG?CUGAUGAG?X?CGAA?AUAGAUU	?AAUCUAU?C?CCGGCCA
			????1299	????AUAUCCC?CUGAUGAG?X?CGAA?AGCCAUG	?CAUGGCU?U?GGGAUAU
????1305	????AUCAUCA?CUGAUGAG?X?CGAA?AUCCCAA	?UUGGGAU?A?UGAUGAU
			????1321	????UGUAGGC?CUGAUGAG?X?CGAA?ACCAGUU	?AACUGGU?C?GCCUACA
????1326	????GCUGUUG?CUGAUGAG?X?CGAA?AGGCGAC	?GUCGCCU?A?CAACAGC
			????1337	????ACACCAC?CUGAUGAG?X?CGAA?AGGGCUG	?CAGCCCU?A?GUGGUGU
????1345	????UAACUGC?CUGAUGAG?X?CGAA?ACACCAC	?GUGGUGU?C?GCAGUUA
			????1351	????CCGGAGU?CUGAUGAG?X?CGAA?ACUGCGA	?UCGCAGU?U?ACUCCGG
????1352	????UCCGGAG?CUGAUGAG?X?CGAA?AACUGCG	?CGCAGUU?A?CUCCGGA
			????1355	????GGAUCCG?CUGAUGAG?X?CGAA?AGUAACU	?AGUUACU?C?CGGAUCC
????1361	????CUUGUGG?CUGAUGAG?X?CGAA?AUCCGGA	?UCCGGAU?C?CCACAAG
			????1449	????AAGACCU?CUGAUGAG?X?CGAA?AGCCCAG	?CUGGGCU?A?AGGUCUU
????1454	????CAAUCAA?CUGAUGAG?X?CGAA?ACCUUAG	?CUAAGGU?C?UUGAUUG
			????1456	????CACAAUC?CUGAUGAG?X?CGAA?AGACCUU	?AAGGUCU?U?GAUUGUG
????1460	????ACAUCAC?CUGAUGAG?X?CGAA?AUCAAGA	?UCUUGAU?U?GUGAUGU
			????1468	????AAAGAGU?CUGAUGAG?X?CGAA?ACAUCAC	?GUGAUGU?U?ACUCUUU
????1469	????CAAAGAG?CUGAUGAG?X?CGAA?AACAUCA	?UGAUGUU?A?CUCUUUG
			????1472	????CGGCAAA?CUGAUGAG?X?CGAA?AGUAACA	?UGUUACU?C?UUUGCCG
????1474	????GCCGGCA?CUGAUGAG?X?CGAA?AGAGUAA	?UUACUCU?U?UGCCGGC
			????1475	????CGCCGGC?CUGAUGAG?X?CGAA?AAGAGUA	?UACUCUU?U?GCCGGCG
????1484	????CCCCGUC?CUGAUGAG?X?CGAA?ACGCCGG	?CCGGCGU?U?GACGGGG
			????1493	????UGUAAGU?CUGAUGAG?X?CGAA?ACCCCGU	?ACGGGGU?C?ACUUACA
????1497	????GUCGUGU?CUGAUGAG?X?CGAA?AGUGACC	?GGUCACU?U?ACACGAC
			????1498	????UGUCGUG?CUGAUGAG?X?CGAA?AAGUGAC	?GUCACUU?A?CACGACA
????1513	????AGCUUGC?CUGAUGAG?X?CGAA?ACCCCCC	?GGGGGGU?C?GCAAGCU
			????1521	????GUGUGGC?CUGAUGAG?X?CGAA?AGCUUGC	?GCAAGCU?C?GCCACAC
????1538	????AGGACGU?CUGAUGAG?X?CGAA?ACGCUCU	?AGAGCGU?C?ACGUCCU
			????1543	????GAAGAAG?CUGAUGAG?X?CGAA?ACGUGAC	?GUCACGU?C?CUUCUUC
????1546	????GGUGAAG?CUGAUGAG?X?CGAA?AGGACGU	?ACGUCCU?U?CUUCACC

The position	Ribozyme	Substrate
			????1547	????GGGUGAA?CUGAUGAG?X?CGAA?AAGGACG	?CGUCCUU?C?UUCACCC
????1549	????UUGGGUG?CUGAUGAG?X?CGAA?AGAAGGA	?UCCUUCU?U?CACCCAA
			????1550	????CUUGGGU?CUGAUGAG?X?CGAA?AAGAAGG	?CCUUCUU?C?ACCCAAG
????1574	????UGAGCUG?CUGAUGAG?X?CGAA?AUUCUCU	?AGAGAAU?C?CAGCUCA
			????1580	????UGUUUAU?CUGAUGAG?X?CGAA?AGCUGGA	?UCCAGCU?C?AUAAACA
????1583	????UGGUGUU?CUGAUGAG?X?CGAA?AUGAGCU	?AGCUCAU?A?AACACCA
			????1607	????UCCUGUU?CUGAUGAG?X?CGAA?AUGUGCC	?GGCACAU?C?AACAGGA
????1636	????GUUGAGG?CUGAUGAG?X?CGAA?AUUCAUU	?AAUGAAU?C?CCUCAAC
			????1640	????CGGUGUU?CUGAUGAG?X?CGAA?AGGGAUU	?AAUCCCU?C?AACACCG
????1651	????GGCAAAG?CUGAUGAG?X?CGAA?ACCCGGU	?ACCGGGU?U?CUUUGCC
			????1652	????CGGCAAA?CUGAUGAG?X?CGAA?AACCCGG	?CCGGGUU?C?UUUGCCG
????1654	????UGCGGCA?CUGAUGAG?X?CGAA?AGAACCC	?GGGUUCU?U?UGCCGCA
			????1655	????GUGCGGC?CUGAUGAG?X?CGAA?AAGAACC	?GGUUCUU?U?GCCGCAC
????1666	????UGCGUAG?CUGAUGAG?X?CGAA?ACAGUGC	?GCACUGU?U?CUACGCA
			????1667	????GUGCGUA?CUGAUGAG?X?CGAA?AACAGUG	?CACUGUU?C?UACGCAC
????1669	????GUGUGCG?CUGAUGAG?X?CGAA?AGAACAG	?CUGUUCU?A?CGCACAC
			????1681	????CGAGUUG?CUGAUGAG?X?CGAA?ACUUGUG	?CACAAGU?U?CAACUCG
????1682	????ACGAGUU?CUGAUGAG?X?CGAA?AACUUGU	?ACAAGUU?C?AACUCGU
			????1687	????UCCGGAC?CUGAUGAG?X?CGAA?AGUUGAA	?UUCAACU?C?GUCCGGA
????1690	????GCAUCCG?CUGAUGAG?X?CGAA?ACGAGUU	?AACUCGU?C?CGGCUGC
			????1723	????GUCGAUG?CUGAUGAG?X?CGAA?AGCUGCA	?UGCAGCU?C?CAUCGAC
????1764	????GGCUCGG?CUGAUGAG?X?CGAA?AUAGGUG	?CACCUAU?A?CCGAGCC
			????1773	????AGGUCCC?CUGAUGAG?X?CGAA?AGGCUCG	?CGAGCCU?A?GGGACCU
????1785	????GGCCUCU?CUGAUGAG?X?CGAA?AUCCAGG	?CCUGGAU?C?AGAGGCC
			????1794	????CAGCAGU?CUGAUGAG?X?CGAA?AGGCCUC	?GAGGCCU?U?ACUGCUG
????1861	????GAAACAG?CUGAUGAG?X?CGAA?ACACUGG	?CCAGUGU?A?CUGUUUC
			????1866	????GGGGUGA?CUGAUGAG?X?CGAA?ACAGUAC	?GUACUGU?U?UCACCCC
????1867	????UGGGGUG?CUGAUGAG?X?CGAA?AACAGUA	?UACUGUU?U?CACCCCA
			????1868	????UUGGGGU?CUGAUGAG?X?CGAA?AAACAGU	?ACUGUUU?C?ACCCCAA
????1955	????UGUUGAG?CUGAUGAG?X?CGAA?AGCAGCA	?UGCUGCU?U?CUCAACA

The position	Ribozyme	Substrate
			????1956	????UUGUUGA?CUGAUGAG?X?CGAA?AAGCAGC	?GCUGCUU?C?UCAACAA
????1958	????UGUUGUU?CUGAUGAG?X?CGAA?AGAAGCA	?UGCUUCU?C?AACAACA
			????2020	????CUUGGUG?CUGAUGAG?X?CGAA?ACCCAGU	?ACUGGGU?U?CACCAAG
????2021	????UCUUGGU?CUGAUGAG?X?CGAA?AACCCAG	?CUGGGUU?C?ACCAAGA
			????2094	????CGAAAGC?CUGAUGAG?X?CGAA?AUCCGUG	?CACGGAU?U?GCUUUCG
????2098	????CUUCCGA?CUGAUGAG?X?CGAA?AGCAAUC	?GAUUGCU?U?UCGGAAG
			????2099	????GCUUCCG?CUGAUGAG?X?CGAA?AAGCAAU	?AUUGCUU?U?CGGAAGC
????2100	????UGCUUCC?CUGAUGAG?X?CGAA?AAAGCAA	?UUGCUUU?C?GGAAGCA
			????2157	????AUACACC?CUGAUGAG?X?CGAA?AGGUGUU	?AACACCU?A?GGUGUAU
????2163	????UCAACUA?CUGAUGAG?X?CGAA?ACACCUA	?UAGGUGU?A?UAGUUGA
			????2165	????AGUCAAC?CUGAUGAG?X?CGAA?AUACACC	?GGUGUAU?A?GUUGACU
????2168	????GGUAGUC?CUGAUGAG?X?CGAA?ACUAUAC	?GUGUAGU?U?GACUACC
			????2173	????GUAUGGG?CUGAUGAG?X?CGAA?AGUCAAC	?GUUGACU?A?CCCAUAC
????2179	????GAGCCUG?CUGAUGAG?X?CGAA?AUGGGUA	?UACCCAU?A?CAGGCUC
			????2186	????AGUGCCA?CUGAUGAG?C?CGAA?AGCCUGU	?ACAGGCU?C?UGGCACU
????2194	????GCAGGGG?CUGAUGAG?X?CGAA?AGUGCCA	?UGGCACU?A?CCCCUGC
			????2207	????UAAAGUU?CUGAUGAG?X?CGAA?ACAGUGC	?GCACUGU?C?AACUUUA
????2212	????GAUGGUA?CUGAUGAG?X?CGAA?AGUUGAC	?GUCAACU?U?UACCAUC
			????2213	????AGAUGGU?CUGAUGAG?X?CGAA?AAGUUGA	?UCAACUU?U?ACCAUCU
????2214	????AAGAUGG?CUGAUGAG?X?CGAA?AAAGUUG	?CAACUUU?A?CCAUCUU
			????2222	????UAACCUU?CUGAUGAG?X?CGAA?AAGAUGG	?CCAUCUU?U?AAGGUUA
????2223	????CUAACCU?CUGAUGAG?X?CGAA?AAAGAUG	?CAUCUUU?A?AGGUUAG
			????2228	????ACAUCCU?CUGAUGAG?X?CGAA?ACCUUAA	?UUAAGGU?U?AGGAUGU
????2229	????UACAUCC?CUGAUGAG?X?CGAA?AACCUUA	?UAAGGUU?A?GGAUGUA
			????2236	????CCCCACA?CUGAUGAG?X?CGAA?ACAUCCU	?AGGAUGU?A?UGUGGGG
????2283	????UCUCCUC?CUGAUGAG?X?CGAA?AGUCCAG	?CUGGACU?C?GAGGAGA
			????2366	????AACAGGG?CUGAUGAG?X?CGAA?AGUGUCU	?AGACACU?U?CCCUGUU
????2367	????GAACAGG?CUGAUGAG?X?CGAA?AAGUGUC	?GACACUU?C?CCUGUUC
			????2373	????GUGAAGG?CUGAUGAG?X?CGAA?ACAGGGA	?UCCCUGU?U?CCUUCAC
????2374	????GGUGAAG?CUGAUGAG?X?CGAA?AACAGGG	?CCCUGUU?C?CUUCACC

The position	Ribozyme	Substrate
			????2377	????GGUGGUG?CUGAUGAG?X?CGAA?AGGAACA	?UGUUCCU?U?CACCACC
????2378	????GGGUGGU?CUGAUGAG?X?CGAA?AAGGAAC	?GUUCCUU?C?ACCACCC
			????2387	????GAGCCGG?CUGAUGAG?X?CGAA?AGGGUGG	?CCACCCU?A?CCGGCUC
????2394	????GUGGACA?CUGAUGAG?X?CGAA?AGCCGGU	?ACCGGCU?C?UGUCCAC
			????2398	????ACCAGUG?CUGAUGAG?X?CGAA?ACAGAGC	?GCUCUGU?C?CACUGGU
????2406	????UGGAUCA?CUGAUGAG?X?CGAA?ACCAGUG	?CACUGGU?U?UGAUCCA
			????2407	????GUGGAUC?CUGAUGAG?X?CGAA?AACCAGU	?ACUGGUU?U?GAUCCAC
????2411	????GGAGGUG?CUGAUGAG?X?CGAA?AUCAAAC	?GUUUGAU?C?CACCUCC
			????2443	????GUACAGG?CUGAUGAG?X?CGAA?ACUGCAC	?GUGCAGU?A?CCUGUAC
????2449	????UAUACCG?CUGAUGAG?X?CGAA?ACAGGUA	?UACCUGU?A?CGGUAUA
			????2454	????GACCCUA?CUGAUGAG?X?CGAA?ACCGUAC	?GUUCGGU?A?UAGGGUC
????2456	????CUGACCC?CUGAUGAG?X?CGAA?AUACCGU	?ACGGUAU?A?GGGUCAG
			????2461	????AACCGCU?CUGAUGAG?X?CGAA?ACCCUAU	?AUAGGGU?C?AGCGGUU
????2468	????AGGAGAC?CUGAUGAG?X?CGAA?ACCGCUG	?CAGCGGU?U?GUCUCCU
			????2471	????CAAAGGA?CUGAUGAG?X?CGAA?ACAACCG	?CGGUUGU?C?UCCUUUG
????2473	????CACAAAG?CUGAUGAG?X?CGAA?AGACAAC	?GUUGUCU?C?CUUUGUG
			????2476	????GAUCACA?CUGAUGAG?X?CGAA?AGGAGAC	?GUCUCCU?U?UGUGAUC
????2477	????UGAUCAC?CUGAUGAG?X?CGAA?AAGGAGA	?CUCCUUU?U?GUGAUCA
			????2483	????CCCAUUU?CUGAUGAG?X?CGAA?AUCACAA	?UUGUGAU?C?AAAUGGG
????2494	????CACGAUA?CUGAUGAG?X?CGAA?ACUCCCA	?UGGGAGU?A?UAUCGUG
			????2496	????AACACGA?CUGAUGAG?X?CGAA?AUACUCC	?GGAGUAU?A?UCGUGUU
????2498	????GCAACAC?CUGAUGAG?X?CGAA?AUAUACU	?AGUAUAU?C?GUGUUGC
			????2503	????GAAAACG?CUGAUGAG?X?CGAA?ACACGAU	?AUCGUGU?U?GCUUUUC
????2507	????GAAGGAA?CUGAUGAG?X?CGAA?AGCAACA	?UGUUGCU?U?UUCCUUC
			????2508	????AGAAGGA?CUGAUGAG?X?CGAA?AAGCAAC	?GUUGCUU?U?UCCUUCU
????2509	????GAGAAGG?CUGAUGAG?X?CGAA?AAAGCAA	?UUGCUUU?U?CCUUCUC
			????2510	????GGAGAAG?CUGAUGAG?X?CGAA?AAAAGCA	?UGCUUUU?C?CUUCUCC
????2513	????CCAGGAG?CUGAUGAG?X?CGAA?AGGAAAA	?UUUUCCU?U?CUCCUGG
			????2514	????GCCAGGA?CUGAUGAG?X?CGAA?AAGGAAA	?UUUCCUU?C?UCCUGGC
????2516	????CCGCCAG?CUGAUGAG?X?CGAA?AGAAGGA	?UCCUUCU?C?CUGGCGG

The position	Ribozyme	Substrate
			????2545	????CAUCCAC?CUGAUGAG?X?CGAA?AGCAGGC	?GCCUGCU?U?GUGGAUG
????2564	????CCUGGGC?CUGAUGAG?X?CGAA?AUCAGCA	?UGCUGAU?A?GCCCAGG
			????2614	????GGCCAGG?CUGAUGAG?X?CGAA?ACGCCGC	?GCGGCGU?C?CCUGGCC
????2636	????AGGAGAG?CUGAUGAG?X?CGAA?AUGCCAU	?AUGGCAU?U?CUCUCCU
			????2637	????AAGGAGA?CUGAUGAG?X?CGAA?AAUGCCA	?UGGCAUU?C?UCUCCUU
????2639	????GGAAGGA?CUGAUGAG?X?CGAA?AGAAUGC	?GCAUUCU?C?UCCUUCC
			????2641	????AAGGAAG?CUGAUGAG?X?CGAA?AGAGAAU	?AUUCUCU?C?CUUCCUU
????2644	????CACAAGG?CUGAUGAG?X?CGAA?AGGAGAG	?CUCUCCU?U?CCUUGUG
			????2645	????ACACAAG?CUGAUGAG?X?CGAA?AAGGAGA	?UCUCCUU?C?CUUGUGU
????2648	????AAAACAC?CUGAUGAG?X?CGAA?AGGAAGG	?CCUUCCU?U?GUGUUUU
			????2653	????ACAGAAA?CUGAUGAG?X?CGAA?ACACAAG	?CUUGUGU?U?UUUCUGU
????2654	????CACAGAA?CUGAUGAG?X?CGAA?AACACAA	?UUGUGUU?U?UUCUGUG
			????2655	????GCACAGA?CUGAUGAG?X?CGAA?AAACACA	?UGUGUUU?U?UCUGUGC
????2656	????GGCACAG?CUGAUGAG?X?CGAA?AAAACAC	?GUGUUUU?U?CUGUGCC
			????2657	????CGGCACA?CUGAUGAG?X?CGAA?AAAAACA	?UGUUUUU?C?UGUGCCG
????2732	????GGAGCAG?CUGAUGAG?X?CGAA?AGCAGCG	?CGCUGCU?C?CUGCUCC
			????2749	????UGGUGGU?CUGAUGAG?X?CGAA?ACGCCAG	?CUGGCGU?U?ACCACCA
????2750	????GUGGUGG?CUGAUGAG?X?CGAA?AACGCCA	?UGGCGUU?A?CCACCAC
			????2791	????UCCACAC?CUGAUGAG?X?CGAA?AUGCAGC	?GCUGCAU?C?GUGUGGA
????2807	????CUACAAA?CUGAUGAG?X?CGAA?ACCACCC	?GGGUGGU?U?UUUGUAG
			????2808	????CCUACAA?CUGAUGAG?X?CGAA?AACCACC	?GGUGGUU?U?UUGUAGG
????2809	????ACCUACA?CUGAUGAG?X?CGAA?AAACCAC	?CUGGUUU?U?UGUAGGU
			????2810	????GACCUAC?CUGAUGAG?X?CGAA?AAAACCA	?UGGUUUU?U?GUAGGUC
????2813	????UUAGACC?CUGAUGAG?X?CGAA?ACAAAAA	?UUUUUGU?A?GGUCUAA
			????2817	????AGUAUUA?CUGAUGAG?X?CGAA?ACCUACA	?UGUAGGU?C?UAAUACU
????2919	????AGAGUAU?CUGAUGAG?X?CGAA?AGACCUA	?UAGGUCU?A?AUACUCU
			????2822	????UCAAGAG?CUGAUGAG?X?CGAA?AUUAGAC	?GUCUAAU?A?CUCUUGA
????2825	????AGGUCAA?CUGAUGAG?X?CGAA?AGUAUUA	?UAAUACU?C?UUGACCU
			????2827	????CAAGGUC?CUGAUGAG?X?CGAA?AGAGUAU	?AUACUCU?U?GACCUUG
????2833	????UGGUGAC?CUGAUGAG?X?CGAA?AGGUCAA	?UUGACCU?U?GUCACCA

The position	Ribozyme	Substrate
			????2836	????GUGUGGU?CUGAUGAG?X?CGAA?ACAAGGU	?ACCUUGU?C?ACCACAC
????2845	????CACUUUG?CUGAUGAG?X?CGAA?AGUGUGG	?CCACACU?A?CAAAGUG
			????2854	????GGCGAGG?CUGAUGAG?X?CGAA?ACACUUU	?AAAGUGU?U?CCUCGCC
????2855	????UGGCGAG?CUGAUGAG?X?CGAA?AACACUU	?AAGUGUU?C?CUCGCCA
			????2858	????GCCUGGC?CUGAUGAG?X?CGAA?AGGAACA	?UGUUCCU?C?GCCAGGC
????2867	????ACCAUAU?CUGAUGAG?X?CGAA?AGCCUGG	?CCAGGCU?C?AUAUGGU
			????2870	????ACCACCA?CUGAUGAG?X?CGAA?AUGAGCC	?GGCUCAU?A?UGGUGGU
????2889	????CUGGUGA?CUGAUGAG?X?CGAA?AAAGUAU	?AUACUUU?A?UCACCAG
			????2891	????CCCUGGU?CUGAUGAG?X?CGAA?AUAAAGU	?ACUUUAU?C?ACCAGGG
????2993	????CAAAGAU?CUGAUGAG?X?CGAA?AGCUCUG	?CAGAGCU?A?AUCUUUG
			????2996	????UGUCAAA?CUGAUGAG?X?CGAA?AUUAGCU	?AGCUAAU?C?UUUGACA
????2998	????AAUGUCA?CUGAUGAG?X?CGAA?AGAUUAG	?CUAAUCU?U?UGACAUU
			????2999	????UAAUGUC?CUGAUGAG?X?CGAA?AAGAUUA	?UAAUCUU?U?GACAUUA
????3005	????GUUUGGU?CUGAUGAG?X?CGAA?AUGUCAA	?UUGACAU?U?ACCAAAC
			????3006	????AGUUUGG?CUGAUGAG?X?CGAA?AAUGUCA	?UGACAUU?A?CCAAACU
????3014	????CGAGCAG?CUGAUGAG?X?CGAA?AGUUUGG	?CCAAACU?C?CUGCUCG
			????3020	????GAAUGGC?CUGAUGAG?X?CGAA?AGCAGGA	?UCCUGCU?C?GCCAUUC
????3026	????GACCGAG?CUGAUGAG?X?CGAA?AUGGCGA	?UCGCCAU?U?CUCGGUC
			????3027	????GGACCGA?CUGAUGAG?X?CGAA?AAUGGCG	?CGCCAUU?C?UCGGUCC
????3029	????GCGGACC?CUGAUGAG?X?CGAA?AGAAUGG	?CCAUUCU?C?GGUCCGC
			????3033	????AUGAGCG?CUGAUGAG?X?CGAA?ACCGAGA	?UCUCGGU?C?CGCUCAU
????3038	????GCACCAU?CUGAUGAG?X?CGAA?AGCGGAC	?GUCCGCU?C?AUGGUGC
			????3047	????CAGCCUG?CUGAUGAG?X?CGAA?AGCACCA	?UGGUGCU?C?CAGGCUG
????3073	????UACAAAG?CUGAUGAG?X?CGAA?ACGGCAU	?AUGCCGU?A?CUUUGUA
			????3076	????GCGUACA?CUGAUGAG?X?CGAA?AGUACGG	?CCGUACU?U?UGUACGC
????3077	????CGCGUAC?CUGAUGAG?X?CGAA?AAGUACG	?CGUACUU?U?GUACGCG
			????3080	????GAGCGCG?CUGAUGAG?X?CGAA?ACAAAGU	?ACUUUGU?A?CGCGCUC
????3087	????AGCCCCU?CUGAUGAG?X?CGAA?AGCGCGU	?ACGCGCU?C?AGGGGCU
			????3095	????CACGAAU?CUGAUGAG?X?CGAA?AGCCCCU	?AGGGGCU?U?AUUCGUG
????3096	????GCACGAA?CUGAUGAG?X?CGAA?AAGCCCC	?GGGGCUU?A?UUCGUGC

The position	Ribozyme	Substrate
			????3098	????AUGCACG?CUGAUGAG?X?CGAA?AUAAGCC	?GGCUUAU?U?CGUGCAU
????3099	????CAUGCAC?CUGAUGAG?X?CGAA?AAUAAGC	?GCUUAUU?C?GUGCAUG
			????3112	????CCGCACC?CUGAUGAG?X?CGAA?ACAUGCA	?UGCAUGU?U?GGUGCGG
????3125	????CUCCGGC?CUGAUGAG?X?CGAA?ACUUUCC	?GGAAAGU?A?GCCGGAG
			????3180	????ACGUACG?CUGAUGAG?X?CGAA?ACCUGUC	?GACAGGU?A?CGUACGU
????3184	????AUAGACG?CUGAUGAG?X?CGAA?ACGUACC	?GGUACGU?A?CGUCUAU
			????3188	????GGUCAUA?CUGAUGAG?X?CGAA?ACGUACG	?CGUACGU?C?UAUGACC
????3190	????AUGGUCA?CUGAUGAG?X?CGAA?AGACGUA	?UACGUCU?A?UGACCAU
			????3198	????GGGGUAA?CUGAUGAG?X?CGAA?AUGGUCA	?UGACCAU?C?UUACCCC
????3200	????GCGGGGU?CUGAUGAG?X?CGAA?AGAUGGU	?ACCAUCU?U?ACCCCGC
			????3201	????AGCGGGG?CUGAUGAG?X?CGAA?AAGAUGG	?CCAUCUU?A?CCCCGCU
????3254	????CGGGCUC?CUGAUGAG?X?CGAA?ACUGCCA	?UGGCAGU?A?GAGCCCG
			????3269	????UGUCAGA?CUGAUGAG?X?CGAA?AAGACGA	?UCGUCUU?C?UCUGACA
????3271	????CAUGUCA?CUGAUGAG?X?CGAA?AGAAGAC	?GUCUUCU?C?UGACAUG
			????3374	????GUCCCAG?CUGAUGAG?X?CGAA?AGUAUCU	?AGAUACU?U?CUGGGAC
????3375	????GGUCCCA?CUGAUGAG?X?CGAA?AAGUAUC	?GAUACUU?C?UGGGACC
			????3390	????UCAAUGC?CUGAUGAG?X?CGAA?AUCGGCC	?GGCCGAU?A?GCAUUGA
????3395	????GCCCUUC?CUGAUGAG?X?CGAA?AUGCUAU	?AUAGCAU?U?GAAGGGC
			????3436	????UUGGGCG?CUGAUGAG?X?CGAA?AGGCCGU	?ACGGCCU?A?CGCCCAA
????3458	????AACCAAG?CUGAUGAG?X?CGAA?AGGCCCC	?GGGGCCU?A?CUUGGUU
			????3461	????UGCAACC?CUGAUGAG?X?CGAA?AGUAGGC	?GCCUACU?U?GGUUGCA
????3465	????ACAAUGC?CUGAUGAG?X?CGAA?ACCAAGU	?ACUUGGU?U?GCAUUGU
			????3470	????UAGUAAC?CUGAUGAG?X?CGAA?AUGCAAC	?GUUGCAU?U?GUUACUA
????3473	????GGCUAGU?CUGAUGAG?X?CGAA?ACAAUGC	?GCAUUGU?U?ACUAGCC
			????3474	????AGGCUAG?CUGAUGAG?X?CGAA?AACAAUG	?CAUUGUU?A?CUAGCCU
????3477	????GUGAGGC?CUGAUGAG?X?CGAA?AGUAACA	?UGUUACU?A?GCCUCAC
			????3506	????CCCCUUC?CUGAUGAG?X?CGAA?ACCUGGU	?ACCAGGU?C?GAAGGGG
????3544	????CAGGAAA?CUGAUGAG?X?CGAA?AUUGUGU	?ACACAAU?C?UUUCCUG
			????3546	????GCCAGGA?CUGAUGAG?X?CGAA?AGAUUGU	?ACAAUCU?U?UCCUGGC
????3547	????CGCCAGG?CUGAUGAG?X?CGAA?AAGAUUG	?CAAUCUU?U?CCUGGCG

The position	Ribozyme	Substrate
			????3548	????UCGCCAG?CUGAUGAG?X?CGAA?AAAGAUU	?AAUCUUU?C?CUGGCGA
????3563	????CACCAUU?CUGAUGAG?X?CGAA?ACGCAGG	?CCUGCGU?U?AAUGGUG
			????3564	????ACACCAU?CUGAUGAG?X?CGAA?AACGCAG	?CUGCGUU?A?AUGGUGU
????3584	????CGUGGAA?CUGAUGAG?X?CGAA?ACGGUCC	?GGACCGU?C?UUCCACG
			????3586	????GCCGUGG?CUGAUGAG?X?CGAA?AGACGGU	?ACCGUCU?U?CCACGGC
????3587	????CGCCGUG?CUGAUGAG?X?CGAA?AAGACGG	?CCGUCUU?C?CACGGCG
			????3632	????UUUGGGU?CUGAUGAG?X?CGAA?AUUGGGC	?GCCCAAU?C?ACCCAAA
????3643	????AUUAGUG?CUGAUGAG?X?CGAA?ACAUUUG	?CAAAUGU?A?CACUAAU
			????3648	????UCUACAU?CUGAUGAG?X?CGAA?AGUGUAC	?GUACACU?A?AUGUAGA
????3653	????CUUGGUC?CUGAUGAG?X?CGAA?ACAUUAG	?CUAAUGU?A?GACCAAG
			????3665	????AGCCGAC?CUGAUGAG?X?CGAA?AGGUCUU	?AAGACCU?C?GUCGGCU
????3668	????GCCAGCC?CUGAUGAG?X?CGAA?ACGAGGU	?ACCUCGU?C?GGCUGGC
			????3720	????UCCGAGC?CUGAUGAG?X?CGAA?ACCGCAG	?CUGCGGU?A?GCUCGGA
????3758	????CCGGAAU?CUGAUGAG?X?CGAA?ACGUCAG	?CUGACGU?C?AUUCCGG
			????3815	????AAUAGGA?CUGAUGAG?X?CGAA?ACGGGUC	?GACCCGU?C?UCCUAUU
????3817	????CAAAUAG?CUGAUGAG?X?CGAA?AGACGGG	?CCCGUCU?C?CUAUUUG
			????3820	????CUUCAAA?CUGAUGAG?X?CGAA?AGGAGAC	?GUCUCCU?A?UUUGAAG
????3822	????CCCUUCA?CUGAUGAG?X?CGAA?AUAGGAG	?CUCCUAU?U?UGAAGGG
			????3823	????GCCCUUC?CUGAUGAG?X?CGAA?AAUAGGA	?UCCUAUU?U?GAAGGGC
????3832	????ACCCGAA?CUGAUGAG?X?CGAA?AGCCCUU	?AAGGGCU?C?UUCGGGU
			????3834	????CCACCCG?CUGAUGAG?X?CGAA?AGAGCCC	?GGGCUCU?U?CGGGUGG
????3925	????GGGUAUG?CUGAUGAG?X?CGAA?AGUCCAC	?GUGGACU?U?CAUACCC
			????3926	????CGGGUAU?CUGAUGAG?X?CGAA?AACUCCA	?UGGACUU?C?AUACCCG
????3929	????CAACGGG?CUGAUGAG?X?CGAA?AUGAAGU	?ACUUCAU?A?CCCGUUG
			????3935	????UAGACUC?CUGAUGAG?X?CGAA?ACGGGUA	?UACCCGU?U?GAGUCUA
????3940	????UUCCAUA?CUGAUGAG?X?CGAA?ACUCAAC	?GUUGAGU?C?UAUGGAA
			????3942	????GUUUCCA?CUGAUGAG?X?CGAA?AGACUCA	?UGAGUCU?A?UGGAAAC
????3951	????CGCAUAG?CUGAUGAG?X?CGAA?AGUUUCC	?GGAAACU?A?CUAUGCG
			????3954	????GACCGCA?CUGAUGAG?X?CGAA?AGUAGUU	?AACUACU?A?UGCGGUC
????3961	????GACCGGG?CUGAUGAG?X?CGAA?ACCGCAU	?AUGCGGU?C?CCCGGUC

The position	Ribozyme	Substrate
			????3968	????CCGUGAA?CUGAUGAG?X?CGAA?ACCGGGG	?CCCCGGU?C?UUCACGG
????3970	????GUCCGUG?CUGAUGAG?X?CGAA?AGACAGG	?CCGGUCU?U?CACGGAC
			????3971	????UGUUCGU?CUGAUGAG?X?CGAA?AAGACCG	?CGGUCUU?C?ACGGAAA
????3982	????GGGAGAU?CUGAUGAG?X?CGAA?AGUUGUC	?GACAACU?C?AUCUCCC
			????3985	????CGGGGGA?CUGAUGAG?X?CGAA?AUGAGUU	?AACUCAU?C?CUUUUUG
????3987	????GCCGGGG?CUGAUGAG?X?CGAA?AGAUGAG	?CUCAUCU?C?CCCCGGC
			????3998	????UCUGCGG?CUGAUGAG?X?CGAA?ACGGCCG	?CGGCCGU?A?CCGCAGA
????4009	????CACUUGG?CUGAUGAG?X?CGAA?AUGUCUG	?CAGACAU?U?CCAAGUG
			????4010	????CCACUUG?CUGAUGAG?X?CGAA?AAUGUCU	?AGACAUU?C?CAAGUGG
????4023	????GCGUGUA?CUGAUGAG?X?CGAA?AUGGGCC	?GGCCCAU?C?UACACGC
			????4025	????GAGCGUG?CUGAUGAG?X?CGAA?AGAUGGG	?CCCAUCU?A?CACGCUC
????4032	????CCAGUGG?CUGAUGAG?X?CGAA?AGCGUGU	?ACACGCU?C?CCACUGG
			????4094	????GGACGAG?XUGAUGAG?X?CGAA?ACCUUGU	?ACAAGGU?A?CUCGUCC
????4097	????UCAGGAC?CUGAUGAG?X?CGAA?AGUACCU	?AGGUACU?C?GUCCUGA
			????4100	????GGUUCAG?CUGAUGAG?X?CGAA?ACGAGUA	?UACUCGU?C?CUGAACC
????4111	????GGCAACA?CUGAUGAG?X?CGAA?AUGGGUU	?AACCCAU?C?UGUUGCC
			????4126	????AAAACCC?CUGAUGAG?X?CGAA?AGGUGGC	?GCCACCU?U?GGGUUUU
????4131	????GCCCCAA?CUGAUGAG?X?CGAA?ACCCAAG	?CUUGGGU?U?UUGGGGC
			????4132	????CGCCCCA?CUGAUGAG?X?CGAA?AACCCAA	?UUGGGUU?U?UGGGGCG
????4133	????ACGCCCC?CUGAUGAG?X?CGAA?AAACCCA	?UGGGUUU?U?GGGGCGU
			????4141	????AGACAUA?CUGAUGAG?X?CGAA?ACGCCCC	?GGGGCGU?A?UAUGUCU
????4143	????UUAGACA?CUGAUGAG?X?CGAA?AUACGCC	?GGCGUAU?A?UGUCUAA
			????4147	????UGCCUUA?CUGAUGAG?X?CGAA?ACAUAUA	?UAUAUGU?C?UAAGGCA
????4149	????UGUGCCU?CUGAUGAG?X?CGAA?AGACAUA	?UAUGUCU?A?AGGCACA
			????4161	????GGGUCGG?CUGAUGAG?X?CGAA?ACCAUGU	?ACAUGGU?A?CCGACCC
????4196	????CCGUGGU?CUGAUGAG?X?CGAA?AUGGUCC	?GGACCAU?U?ACCACGG
			????4197	????CCCGUGG?CUGAUGAG?X?CGAA?AAUGGUC	?GACCAUU?A?CCACGGG
????4214	????AGUACGU?CUGAUGAG?X?CGAA?AUGGGGG	?CCCCCAU?C?ACGUACU
			????4219	????GGUGGAG?CUGAUGAG?X?CGAA?ACGUGAU	?AUCACGU?A?CUCCACC
????4222	????AUAGGUG?CUGAUGAG?X?CGAA?AGUACGU	?ACGUACU?C?CACCUAU

The position	Ribozyme	Substrate
			????4257	????CCCCCAG?CUGAUGAG?X?CGAA?ACAUCCA	?UGGAUGU?U?CUGGGGG
????4258	????GCCCCCA?CUGAUGAG?X?CGAA?AACAUCC	?GGAUGUU?C?UGGGGGC
			????4270	????GAUAUCA?CUGAUGAG?X?CGAA?AGGCGCC	?GGCGCCU?A?UGAUAUC
????4275	????AUUAUGA?CUGAUGAG?X?CGAA?AUCAUAG	?CUAUGAU?A?UCAUAAU
			????4277	????AUAUUAU?CUGAUGAG?X?CGAA?AUAUCAU	?AUGAUAU?C?AUAAUAU
????4300	????GUCAGUU?CUGAUAGG?X?CGAA?AGUGGCA	?UGCCACU?C?AACUGAC
			????4309	????GGUAGUC?CUGAUGAG?X?CGAA?AGUCAGU	?ACUGACU?C?GACUACC
????4314	????AGGAUGG?CUGAUGAG?X?CGAA?AGUCGAG	?CUCGACU?A?CCAUCCU
			????4319	????UGCCCAG?CUGAUGAG?X?CGAA?AUGGUAG	?CUACCAU?C?CUGGGCA
????4328	????CUGUGCC?CUGAUGAG?X?CGAA?AUGCCCA	?UGGGCAU?C?GGCACAG
			????4389	????GGAGGCG?CUGAUGAG?X?CGAA?AGCGGUG	?CACCGCU?A?CGCCUCC
????4395	????GAUCCCG?CUGAUGAG?X?CGAA?AGGCGUA	?UACGCCU?C?CGGGAUC
			????4402	????GGUAACC?CUGAUGAG?X?CGAA?AUCCCGG	?CCGGGAU?C?GGUUACC
????4406	????GCACGGU?CUGAUGAG?X?CGAA?ACCGAUC	?GAUCGGU?U?ACCGUGC
			????4407	????GGCACGG?CUGGAGAG?X?CGAA?AACCGAU	?AUCGGUU?A?CCGUGCC
????4427	????CCUCCUC?CUGAUGAG?X?CGAA?AUAUUUG	?CAAAUAU?U?GAGGAGG
			????4440	????UUGGACA?CUGAUGAG?X?CGAA?AGCCACC	?GGUGGCU?C?UGUCCAA
????4465	????GCCAUAG?CUGAUGAG?X?CGAA?AGGGGAU	?AUCCCCU?U?CUAUGGC
			????4466	????UGCCAUA?CUGAUGAG?X?CGAA?AAGGGGA	?UCCCCUU?C?UAUGGCA
????4468	????CUUGCCA?CUGAUGAG?X?CGAA?AGAAGGG	?CCCUUCU?A?UGGCAAG
			????4512	????AAAAUGA?CUGAUGAG?X?CGAA?AUGCCUU	?AAGGCAU?C?UCAUUUU
????4514	????AGAAAAU?CUGAUGAG?X?CGAA?AGAUGCC	?GGCAUCU?C?AUUUUCU
			????4517	????GGCAGAA?CUGAUGAG?X?CGAA?AUGAGAU	?AUCUCAU?U?UUCUGCC
????4518	????UGGCAGA?CUGAUGAG?X?CGAA?AAUGAGA	?UCUCAUU?U?UCUGCCA
			????4519	????GUGGCAG?CUGAUGAG?X?CGAA?AAAUGAG	?CUCAUUU?U?CUGCCAC
????4520	????AGUGGCA?CUGAUGAG?X?CGAA?AAAAUGA	?UCAUUUU?C?UGCCACU
			????4550	????UUGCGGC?CUGAUGAG?X?CGAA?AGCUCAU	?AUGAGCU?C?GCCGCAA
????4564	????GAGGCCU?CUGAUGAG?X?CGAA?ACAGCUU	?AAGCUGU?C?AGGCCUC
			????4571	????UGAUUCC?CUGAUGAG?X?CGAA?AGGCCUG	?CAGGCCU?C?GGAAUCA
????4602	????ACGUCAA?CUGAUGAG?X?CGAA?ACCCCGG	?CCGGGGU?C?UUGACGU

The position	Ribozyme	Substrate
			????4604	????ACACGUC?CUGAUGAG?X?CGAA?AGACCCC	?GGGGUCU?U?GACGUGU
????4512	????UAUGACG?CUGAUGAG?X?CGAA?ACACGUC	?GACGUGU?C?CGUCAUA
			????4637	????CGAUAAC?CUGAUGAG?X?CGAA?ACAUCUC	?GAGAUGU?C?GUUAUCG
????4640	????CCACGAU?CUGAUGAG?X?CGAA?ACGACAU	?AUGUCGU?U?AUCGUGG
			????4641	????GCCACGA?CUGAUGAG?X?CGAA?AACGACA	?UGUCGUU?A?UCGUGGC
????4643	????UUGCCAC?CUGAUGAG?X?CGAA?AUAACGA	?UCGUUAU?C?GUGGCAA
			????4659	????GUCAUUA?CUGAUGAG?X?CGAA?AGCGUCU	?AGACGCU?C?UAAUGAC
????4661	????CCGUCAU?CUGAUGAG?X?CGAA?AGAGCGU	?ACGCUCU?A?AUGACGG
			????4684	????CGAGUCA?CUGAUGAG?X?CGAA?AGUCACC	?GGUGACU?U?UGACUCG
????4685	????CCGAGUC?CUGAUGAG?X?CGAA?AAGUCAC	?GUGACUU?U?GACUCGG
			????4690	????GAUCACC?CUGAUGAG?X?CGAA?AGUCAAA	?UUUGACU?C?GGUGAUC
????4715	????UCUGGGU?CUGAUGAG?X?CGAA?ACACAUG	?CAUGUGU?C?ACCCAGA
			????4727	????UGAAAUC?CUGAUGAG?X?CGAA?ACUGUCU	?AGACAGU?C?GAUUUCA
????4731	????AAGCUGA?CUGAUGAG?X?CGAA?AUCGACU	?AGUCGAU?U?UCAGCUU
			????4732	????CAAGCUG?CUGAUGAG?X?CGAA?AAUCGAC	?GUCGAUU?U?CAGCUUG
????4733	????CCAAGCU?CUGAUGAG?X?CGAA?AAAUCGA	?UCGAUUU?C?AGCUUGG
			????4738	????GGGAUCC?CUGAUGAG?X?CGAA?AGCUGAA	?UUCAGCU?U?GGAUCCC
????4743	????AAGGUGG?CUGAUGAG?X?CGAA?AUCCAAG	?CUUGGAU?C?CCACCUU
			????4750	????AAUGGUA?CUGAUGAG?X?CGAA?AGGUGGG	?CCCACCU?U?UACCAUU
????4751	????CAAUGGU?CUGAUGAG?X?CGAA?AAGGUGG	?CCACCUU?U?ACCAUUG
			????4752	????UCAAUGG?CUGAUGAG?X?CGAA?AAAGGUG	?CACCUUU?A?CCAUUGA
????4757	????UCGUCUC?CUGAUGAG?X?CGAA?AUGGUAA	?UUACCAU?U?GAGACGA
			????4824	????CCUCCCC?CUGAUGAG?X?CGAA?ACCCCUG	?CAGGGGU?A?GGGGAGG
????4835	????ACCUGUA?CUGAUGAG?X?CGAA?AUGCCUC	?GAGGCAU?C?UACAGGU
			????4837	????AAACCUG?CUGAUGAG?X?CGAA?AGAUGCC	?GGCAUCU?A?CAGGUUU
????4843	????AGUCACA?CUGAUGAG?X?CGAA?ACCUGUA	?UACAGGU?U?UGUGACU
			????4844	????GAGUCAC?CUGAUGAG?X?CGAA?AACCUGU	?ACAGGUU?U?GUGACUC
????4851	????UCUUCCG?CUGAUGAG?X?CGAA?AGUCACA	?UGUGACU?C?CGGGAAG
			????4867	????CAUGCCC?CUGAUGAG?X?CGAA?AGGGCCG	?CGGCCCU?C?GGGCAUG
????4876	????AGAAUCG?CUGAUGAG?X?CGAA?ACAUGCC	?GGCAUGU?U?CGAUUCU

The position	Ribozyme	Substrate
			????4877	????AAGAAUC?CUGAUGAG?X?CGAA?AACAUGC	?GCAUGUU?C?GAUUCUU
????4881	????ACCGAAG?CUGAUGAG?X?CGAA?AUCGAAC	?GUUCGAU?U?CUUCGGU
			????4882	????GACCAGG?CUGAUGAG?X?CGAA?AAUCGAA	?UUCGAUU?C?UUCGGUC
????4884	????AGGACCG?CUGAUGAG?X?CGAA?AGAAUCG	?CGAUUCU?U?CGGUCCU
			????4885	????CAGGACC?CUGAUGAG?X?CGAA?AAGAAUC	?GAUUCUU?C?GGUCCUG
????4889	????CACACAG?CUGAUGAG?X?CGAA?ACCGAAG	?CUUCGGU?C?CUGUGUG
			????4903	????CGCGUCA?CUGAUGAG?X?CGAA?AGCACUC	?GAGUGCU?A?UGACGCG
????5011	????UUCCCAG?CUGAUGAG?X?CGAA?ACUCCAG	?CUGGAGU?U?CUGGGAA
			????5012	????UUUCCCA?CUGAUGAG?X?CGAA?AACUCCA	?UGGAGUU?C?UGGGAAA
????5024	????CUGUGAA?CUGAUGAG?X?CGAA?ACGCUUU	?AAAGCGU?C?UUCACAG
			????5026	????GCCUGUG?CUGAUGAG?X?CGAA?AGACGCU	?AGCGUCU?U?CACAGGC
????5027	????GGCCUGU?CUGAUGAG?X?CGAA?AAGACGC	?GCGUCUU?C?ACAGGCC
			????5036	????UGUGGGU?CUGAUGAG?X?CGAA?AGGCCUG	?CAGGCCU?C?ACCCACA
????5045	????GGGCAUC?CUGAUGAG?X?CGAA?AUGUGGG	?CCCACAU?A?GAUGCCC
			????5056	????GGACAGG?CUGAUGAG?X?CGAA?AGUGGGC	?GCCCACU?U?CCUGUCC
????5057	????GGGACAG?CUGAUGAG?X?CGAA?AAGUGGG	?CCCACUU?C?CUGUCCC
			????5062	????GGUUUGG?CUGAUGAG?X?CGAA?ACAGGAA	?UUCCUGU?C?CCAAACC
????5089	????GUAAGGG?CUGAUGAG?X?CGAA?AGUUGUC	?GACAACU?U?CCCUUAC
			????5090	????GGUAAGG?CUGAUGAG?X?CGAA?AAGUUGU	?ACAACUU?C?CCUUACC
????5094	????ACCAGGU?CUGAUGAG?X?CGAA?AGGGAAG	?CUUCCCU?U?ACCUGGU
			????5095	????UACCAGG?CUGAUGAG?X?CGAA?AAGGGAA	?UUCCCUU?A?CCUGGUA
????5139	????GGAGGUG?CUGAUGAG?X?CGAA?AGCCUGA	?UCAGGCU?C?CACCUCC
			????5145	????CACGAUG?CUGAUGAG?X?CGAA?AGGUGGA	?UCCACCU?C?CAUCGUG
????5149	????AUCCCAC?CUGAUGAG?X?CGAA?AUGGAGG	?CCUCCAU?C?GUGGGAU
			????5157	????CACAUUU?CUGAUGAG?X?CGAA?AUCCCAC	?GUGGGAU?C?AAAUGUG
????5172	????CGUAUGA?CUGAUGAG?X?CGAA?ACACUUC	?GAAGUGU?C?UCAUACG
			????5174	????GCCGUAU?CUGAUGAG?X?CGAA?AGACACU	?AGUGUCU?C?AUACGGC
????5177	????UAAGCCG?CUGAUGAG?X?CGAA?AUGAGAC	?GUCUCAU?A?CGGCUUA
			????5183	????UAGGUUU?CUGAUGAG?X?CGAA?AGCCGUA	?UACGGCU?U?AAACCUA
????5184	????GUAGGUU?CUGAUGAG?X?CGAA?AAGCCGU	?ACGGCUU?A?AACCUAC

The position	Ribozyme	Substrate
			????5190	????UGCAGCG?CUGAUGAG?X?CGAA?AGGUUUA	?UAAACCU?A?CGCUGCA
????5225	????CGGCUCC?CUGAUGAG?X?CGAA?AGCCUAU	?AUAGGCU?A?GGAGCCG
			????5234	????CAUUUUG?CUGAUGAG?X?CGAA?ACGGCUC	?GAGCCGU?U?CAAAAUG
????5235	????UCAUUUU?CUGAUGAG?X?CGAA?AACGGCU	?AGCCGUU?C?AAAAUGA
			????5246	????UGAGGGU?CUGAUGAG?X?CGAA?AUCUCAU	?AUGAGAU?C?ACCCUCA
????5252	????GAUGUGU?CUGAUGAG?X?CGAA?AGGGUGA	?UCACCCU?C?ACACAUC
			????5259	????GUUAUGG?CUGAUGAG?X?CGAA?AUGUGUG	?CACACAU?C?CCAUAAC
????5264	????AUUUGGU?CUGAUGAG?X?CGAA?AUGGGAU	?AUCCCAU?A?ACCAAAU
			????5272	????CAUGAUG?CUGAUGAG?X?CGAA?AUUUGGU	?ACCAAAU?U?CAUCAUG
????5273	????CCAUGAU?CUGAUGAG?X?CGAA?AAUUUGG	?CCAAAUU?C?AUCAUGG
			????5276	????AUGCCAU?CUGAUGAG?X?CGAA?AUGAAUU	?AAUUCAU?C?AUGGCAU
????5290	????GUCGGCC?CUGAUGAG?X?CGAA?ACAUGCA	?UGCAUGU?C?GGCCGAC
			????5349	????GCGGCCA?CUGAUGAG?X?CGAA?AGCUGCA	?UGCAGCU?C?UGGCCGC
????5384	????CCACAAU?CUGAUGAG?X?CGAA?ACCACAC	?GUGUGGU?C?AUUGUGG
			????5387	????UACCCAC?CUGAUGAG?X?CGAA?AUGACCA	?UGGUCAU?U?GUGGGUA
????5394	????AUGAUCC?CUGAUGAG?X?CGAA?ACCCACA	?UGUGGGU?A?GGAUCAU
			????5402	????CGGACAA?CUGAUGAG?X?CGAA?AUGAUCC	?GGAUCAU?U?UUGUCCG
????5403	????CCGGACA?CUGAUGAG?X?CGAA?AAUGAUC	?GAUCAUU?U?UGUCCGG
			????5404	????CCCGGAC?CUGAUGAG?X?CGAA?AAAUGAU	?AUCAUUU?U?GUCCGGG
????5407	????CCUCCCG?CUGAUGAG?X?CGAA?ACAAAAU	?AUUUUGU?C?CGGGAGG
			????5441	????GGUAGAG?CUGAUGAG?X?CGAA?ACUUCCC	?GGGAAGU?C?CUCUACC
????5444	????CCCGGUA?CUGAUGAG?X?CGAA?AGGACUU	?AAGUCCU?C?UACCGGG
			????5446	????CUCCCGG?CUGAUGAG?X?CGAA?AGAGGAC	?GUCCUCU?A?CCGGGAG
????5455	????UUCAUCG?CUGAUGAG?X?CGAA?ACUCCCG	?CGGGAGU?U?CGAUGAA
			????5456	????UUUCAUC?CUGAUGAG?X?CGAA?AACUCCC	?GGGAGUU?C?GAUGAAA
????5479	????GAGGUGU?CUGAUGAG?X?CGAA?AGGCGCA	?UGCGCCU?C?ACACCUC
			????5486	????UGUAAGG?CUGAUGAG?X?CGAA?AGGUGUG	?CACACCU?C?CCUUACA
????5490	????UCGAUGU?CUGAUGAG?X?CGAA?AGGGAGG	?CCUCCCU?U?ACAUCGA
			????5491	????UUCGAUG?CUGAUGAG?X?CGAA?AAGGGAG	?CUCCCUU?A?CAUCGAA
????5495	????CCUGUUC?CUGAUGAG?X?CGAA?AUGUAAG	?CUUACAU?C?GAACAGG

The position	Ribozyme	Substrate
			????5513	????GCUCGGC?CUGAUGAG?X?CGAA?AGCUGCA	?UGCAGCU?C?GCCGAGC
????5540	????GCAACCC?CUGAUGAG?X?CGAA?AGUGCCU	?AGGCACU?C?GGGUUGC
			????5545	????UUGCAGC?CUGAUGAG?X?CGAA?ACCCGAG	?CUCGGGU?U?GCUGCAA
????5644	????GCUGAUG?CUGAUGAG?X?CGAA?AGUUCCA	?UGGAACU?U?CAUCAGC
			????5645	????CGCUGAU?CUGAUGAG?X?CGAA?AAGUUCC	?GGAACUU?C?AUCAGCG
????5648	????UCCCGCU?CUGAUGAG?X?CGAA?AUGAAGU	?ACUUCAU?C?AGCGGGA
			????5657	????AAUACUG?CUGAUGAG?X?CGAA?AUCCCGC	?GCGGGAU?A?CAGUAUU
????5662	????UGCUAAA?CUGAUGAG?X?CGAA?ACUGUAU	?AUACAGU?A?UUUAGCA
			????5664	????CCUGCUA?CUGAUGAG?X?CGAA?AUACUGU	?ACAGUAU?U?UAGCAGG
????5665	????GCCUGCU?CUGAUGAG?X?CGAA?AAUACUG	?CAGUAUU?U?AGCAGGC
			????5666	????AGCCUGC?CUGAUGAG?X?CGAA?AAAUACU	?AGUAUUU?A?GCAGGCU
????5677	????CAGAGUG?CUGAUGAG?X?CGAA?AUAAGCC	?GGCUUAU?C?CACUCUG
			????5682	????CCAGGCA?CUGAUGAG?X?CGAA?AGUGGAU	?AUCCACU?C?UGCCUGG
????5702	????GUGAUGC?CUGAUGAG?X?CGAA?AUCGCGG	?CCGCGAU?A?GCAUCAC
			????5707	????CAUCAGU?CUGAUGAG?X?CGAA?AUGCUAU	?AUAGCAU?C?ACUGAUG
????5719	????GGCUGUG?CUGAUGAG?X?CGAA?AUGCCAU	?AUGGCAU?U?CACAGCC
			????5720	????AGGCUGU?CUGAUGAG?X?CGAA?AAUGCCA	?UGGCAUU?C?ACAGCCU
????5728	????GGUGAUA?CUGAUGAG?X?CGAA?AGGCUGU	?ACAGCCU?C?UAUCACC
			????5730	????CUGGUGA?CUGAUGAG?X?CGAA?AGAGGCU	?AGCCUCU?A?UCACCAG
????5732	????GACUGGU?CUGAUGAG?X?CGAA?AUAGAGG	?CCUCUAU?C?ACCAGUC
			????5739	????GUGAGCG?CUGAUGAG?X?CGAA?ACUGGUG	?CACCAGU?C?CGCUCAC
????5744	????GGGUGGU?CUGAUGAG?X?CGAA?AGCGGAC	?GUCCGCU?C?ACCACCC
			????5757	????AGGAGGG?CUGAUGAG?X?CGAA?AUUCUGG	?CCAGAAU?A?CCCUCCU
????5762	????UGAACAG?CUGAUGAG?X?CGAA?AGGGUAU	?AUACCCU?C?CUGUUCA
			????5774	????CCCCUAA?CUGAUGAG?X?CGAA?AUGUUGA	?UCAACAU?C?UUAGGGG
????5776	????UCCCCCU?CUGAUGAG?X?CGAA?AGAUGUU	?AACAUCU?U?AGGGGGA
			????5777	????AUCCCCC?CUGAUGAG?X?CGAA?AAGAUGU	?ACAUCUU?A?GGGGGAU
????5796	????GCGAGUU?CUGAUGAG?X?CGAA?AGCAGCC	?GGCUGCU?C?AACUCGC
			????5808	????GCACUGG?CUGAUGAG?X?CGAA?AGGAGCG	?CGCUCCU?C?CCAGUGC
????5820	????AAGGCCG?CUGAUGAG?X?CGAA?AGCAGCA	?UGCUGCU?U?CGGCCUU

The position	Ribozyme	Substrate
			????5885	????UGUCCAC?CUGAUGAG?X?CGAA?AGCACCU	?AGGUGCU?U?GUGGACA
????5894	????CCGCCAG?CUGAUGAG?X?CGAA?AUGUCCA	?UGGACAU?U?CUGGCGG
			????5895	????CCCGCCA?CUGAUGAG?X?CGAA?AAUGUCC	?GGACAUU?C?UGGCGGG
????5986	????AGGGAGC?CUGAUGAG?X?CGAA?AGUUAAC	?GUUAACU?U?GCUCCCU
			????5999	????GGGAGAG?CUGAUGAG?X?CGAA?AUGGCAG	?CUGCCAU?C?CUCUCCC
????6002	????CGGGGGA?CUGAUGAG?X?CGAA?AGGAUGG	?CCAUCCU?C?UCCCCCG
			????6101	????CGAACGC?CUGAUGAG?X?CGAA?AUCAGCC	?GGCUGAU?A?GCGUUCG
????6112	????ACCCCGC?CUGAUGAG?X?CGAA?AAGCGAA	?UUCGCUU?C?GCGGGGU
			????6120	????ACGUGGU?CUGAUGAG?X?CGAA?ACCCCGC	?GCGGGGU?A?ACCACGU
????6128	????UGGGGGA?CUGAUGAG?X?CGAA?ACGUGGU	?ACCACGU?U?UCCCCCA
			????6129	????GUGGGGG?CUGAUGAG?X?CGAA?AACGUGG	?CCACGUU?U?CCCCCAC
????6130	????CGUGGGG?CUGAUGAG?X?CGAA?AAACGUG	?CACGUUU?C?CCCCACG
			????6142	????AGGCACG?CUGAUGAG?X?CGAA?AGUGCGU	?ACGCACU?A?CGUGCCU
????6173	????UCUGAGU?CUGAUGAG?X?CGAA?ACACCUG	?CACGUGU?A?ACUCAGA
			????6177	????AGGAUCU?CUGAUGAG?X?CGAA?AGUUACA	?UGUAACU?C?AGAUCCU
????6182	????UGGAGAG?CUGAUGAG?X?CGAA?AUCUGAG	?CUCAGAU?C?CUCUCCA
			????6185	????GGCUGGA?CUGAUGAG?X?CGAA?AGGAUCU	?AGAUCCU?C?UCCAGCC
????6187	????GAGGCUG?CUGAUGAG?X?CGAA?AGAGGAU	?AUCCUCU?C?CAGCCUC
			????6194	????UGAUGGU?CUGAUGAG?X?CGAA?AGGCUGG	?CCAGCCU?C?ACCAUCA
????6200	????GCUGAGU?CUGAUGAG?X?CGAA?AUGGUGA	?UCACCAU?C?ACUCAGC
			????6204	????AGCAGCU?CUGAUGAG?X?CGAA?AGUGAUG	?CAUCACU?C?AGCUGCU
????6221	????ACUGGUG?CUGAUGAG?X?CGAA?AGCCUCU	?AGAGGCU?U?CACCAGU
			????6222	????CACUGGU?CUGAUGAG?X?CGAA?AAGCCUC	?GAGGCUU?C?ACCAGUG
????6233	????CCUCAUU?CUGAUGAG?X?CGAA?AUCCACU	?AGUGGAU?U?AAUGAGG
			????6234	????UCCUCAU?CUGAUGAG?X?CGAA?AAUCCAC	?GUGGAUU?A?AUGAGGA
????6247	????UGGCGUG?CUGAUGAG?X?CGAA?AGCAGUC	?GACUGCU?C?CACGCCA
			????6259	????CGAGCCG?CUGAUGAG?X?CGAA?AGCAUGG	?CCAUGCU?C?CGGCUCG
????6265	????UAGCCAC?CUGAUGAG?X?CGAA?AGCCGGA	?UCCGGCU?C?GUGGCUA
			????6272	????CAUCCUU?CUGAUGAG?X?CGAA?AGCCACG	?CGUGGCU?A?AAGGAUG
????6282	????AGUCCCA?CUGAUGAG?X?CGAA?ACAUCCU	?AGGAUGU?U?UGGGACU

The position	Ribozyme	Substrate
			????6282	????CAGUCCC?CUGAUGAG?X?CGAA?AACAUCC	?GGAUGUU?U?GGGACUG
????6293	????CCGUGCA?CUGAUGAG?X?CGAA?AUCCAGU	?ACUGGAU?A?UGCACGG
			????6304	????GUCAGUC?CUGAUGAG?X?CGAA?ACACCGU	?ACGGUGU?U?GACUGAC
????6313	????GGUCUUG?CUGAUGAG?X?CGAA?AGUCAGU	?ACUGACU?U?CAAGACC
			????6314	????AGGUCUU?CUGAUGAG?X?CGAA?AAGUCAG	?CUGACUU?C?AAGACCU
????6326	????UGGACUG?CUGAUGAG?X?CGAA?AGCCAGG	?CCUGGCU?C?CAGUCCA
			????6331	????GAGCUUG?CUGAUGAG?X?CGAA?ACUGGAG	?CUCCAGU?C?CAAGCUC
????6338	????UCGGCAG?CUGAUGAG?X?CGAA?AGCUUGG	?CCAAGCU?C?CUGCCGA
			????6349	????UCCCGGC?CUGAUGAG?X?CGAA?AUUUCGG	?CCGAAAU?U?GCCGGGA
????6359	????CGAAAGG?CUGAUGAG?X?CGAA?ACUCCCG	?CGGGAGU?C?CCUUUCU
			????6363	????GAGAAGA?CUGAUGAG?X?CGAA?AGGGACU	?AGUCCCU?U?UCUUCUC
????6364	????UGAGAAG?CUGAUGAG?X?CGAA?AAGGGAC	?GUCCCUU?U?CUUCUCA
			????6365	????AUGAGAA?CUGAUGAG?X?CGAA?AAAGGGA	?UCCCUUU?C?UUCUCAU
????6367	????GCAIGAG?CUGAUGAG?X?CGAA?AGAAAGG	?CCUUUCU?U?CUCAUGC
			????6368	????GGCAUAG?CUGAUGAG?X?CGAA?AAGAAAG	?CUUUCUU?C?UCAUGCC
????6370	????UUGGCAU?CUGAUGAG?X?CGAA?AGAAGAA	?UUCUUCU?C?AUGCCAA
			????6385	????UCCCUUG?CUGAUGAG?X?CGAA?ACCCGCG	?CGCGGGU?A?CAAGGGA
????6395	????CCCGCCA?CUGAUGAG?X?CGAA?ACUCCCU	?AGGGAGU?C?UGGCGGG
			????6446	????GUCCGGU?CUGAUGAG?X?CGAA?AUUUGUG	?CACAAAU?U?ACCGGAC
????6447	????UGUCCGG?CUGAUGAG?X?CGAA?AAUUUGU	?ACAAAUU?A?CCGGACA
			????6458	????CGUUUUU?CIGAIGAG?X?CGAA?ACAIGUG	?GACAUGU?C?AAAAACG
????6468	????CUCAUGG?CUGAUGAG?X?CGAA?ACCGUUU	?AAACGGU?U?CCAUGAG
			????6469	????CCUCAUG?CUGAUGAG?X?CGAA?AACCGUU	?AACGGUU?C?CAUGAGG
????6479	????GCCCAAC?CUGAUGAG?X?CGAA?AUCCUCA	?UGAGGAU?C?GUUGGGC
			????6482	????UAGGCCC?CUGAUGAG?X?CGAA?ACGAUCC	?GGAUCGU?U?GGGCCUA
????6489	????CAGGUUU?CUGAUGAG?X?CGAA?AGGCCCA	?UGGGCCU?A?AAACCUG
			????6520	????GAUGGGG?CUGAUGAG?X?CGAA?ACGUUCC	?GGAACGU?U?CCCCAUC
????6521	????UGAUGGG?CUGAUGAG?X?CGAA?AACGUUC	?GAACGUU?C?CCCAUCA
			????6527	????ACGCGUU?CUGAUGAG?X?CGAA?AUGGGGA	?UCCCCAU?C?AACGCGU
????6535	????UGUGGUG?CUGAUGAG?X?CGAA?ACGCGUU	?AACGCGU?A?CACCACA

The position	Ribozyme	Substrate
			????6559	????CGCCGGG?CUGAUGAG?X?CGAA?AGGGUGU	?ACACCCU?C?CCCGGCG
????6610	????CUCCACG?CUGAUGAG?X?CGAA?ACUCUUC	?GAAGAGU?A?CGUGGAG
			????6620	????CCCGCGU?CUGAUGAG?X?CGAA?AUCUCCA	?UGGAGAU?U?ACGCGGG
????6621	????ACCCGCG?CUGAUGAG?X?CGAA?AAUCUCC	?GGAGAUU?A?CGCGGGU
			????6654	????GUGGUCA?CUGAUGAG?X?CGAA?ACCCGUC	?GACGGGU?A?UGACCAC
????6689	????GGGCCGG?CUGAUGAG?X?CGAA?ACCUGGC	?GCCAGGU?C?CCGGCCC
			????6781	????GACCUGG?CUGAUGAG?X?CGAA?AUGUGAC	?GUCACAU?U?CCAGGUC
????6854	????UGGAAGU?CUGAUGAG?X?CGAA?AGCACUG	?CAGUGCU?C?ACUUCCA
			????6858	????AGCAUGG?CUGAUGAG?X?CGAA?AGUGAGC	?GCUCACU?U?CCAUGCU
????6859	????GAGCAUG?CUGAUGAG?X?CGAA?AAGUGAG	?CUCACUU?C?CAUGCUC
			????6866	????GGUCGGU?CUGAUGAG?X?CGAA?AGCAUGG	?CCAUGCU?C?ACCGACC
????6877	????AAUGUGG?CUGAUGAG?X?CGAA?AGGGGUC	?GACCCCU?C?CCACAUU
			????6884	????CUGCUGU?CUGAUGAG?X?CGAA?AUGUGGG	?CCCACAU?U?ACAGCAG
????6885	????UCUGCUG?CUGAUGAG?X?CGAA?AAUGUGG	?CCACAUU?A?CAGCAGA
			????6900	????CUGCGUU?CUGAUGAG?X?CGAA?AGCCGUC	?GACGGCU?A?AACGUAG
????6945	????CUAGCUG?CUGAUGAG?X?CGAA?AGCGCUG	?CAGCUCU?U?CAGCUAG
			????6946	????GCUAGCU?CUGAUGAG?X?CGAA?AAGAGCU	?AGCUCUU?C?AGCUAGC
????6951	????AAUUGGC?CUGAUGAG?X?CGAA?AGCUGAA	?UUCAGCU?A?GCCAAUU
			????6969	????UUCAAGG?CUGAUGAG?X?CGAA?AGGCGCA	?UGCGCCU?U?CCUUGAA
????6970	????CUUCAAG?CUGAUGAG?X?CGAA?AAGGCGC	?GCGCCUU?C?CUUGAAG
			????6973	????UGCCUUC?CUGAUGAG?X?CGAA?AGGAAGG	?CCUUCCU?U?GAAGGCA
????6990	????UGGUGGG?CUGAUGAG?X?CGAA?AGUGCAU	?AUGCACU?A?CCCACCA
			????7003	????GUCCGGG?CUGAUGAG?X?CGAA?AGUCAUG	?CAUGACU?C?CCCGGAC
????7019	????CCUCGAU?CUGAUGAG?X?CGAA?AGGUCAG	?CUGACCU?C?AUCGAGG
			????7022	????UGGCCUC?CUGAUGAG?X?CGAA?AUGAGGU	?CAAUCAU?C?GAGGCCA
????7064	????CACGGGU?CUGAUGAG?X?CGAA?AUGUUUC	?GAAACAU?C?ACCCGUG
			????7078	????AUUCUCU?CUGAUGAG?X?CGAA?ACUCCAC	?GUGGAGU?C?AGAGAAU
????7086	????ACCACCU?CUGAUGAG?X?CGAA?AUUCUCU	?AGAGAAU?A?AGGUGGU
			????7094	????CCAAAAU?CUGAUGAG?X?CGAA?ACCACCU	?AGGUGGU?A?AUUUUGG
????7097	????AGUCCAA?CUGAUGAG?X?CGAA?AUUACCA	?UGGUAAU?U?UUGGACU

The position	Ribozyme	Substrate
			????7098	????GAGUCCA?CUGAUGAG?X?CGAA?AAUUACC	?GGUAAUU?U?UGGACUC
????7099	????AGAGUCC?CUGAUGAG?X?CGAA?AAAUUAC	?GUAAUUU?U?GGACUCU
			????7105	????GUCGAAA?CUGAUGAG?X?CGAA?AGUCCAA	?UUGGACU?C?UUUCGAC
????7107	????GGGUCGA?CUGAUGAG?X?CGAA?AGAGUCC	?GGACUCU?U?UCGACCC
			????7108	????CGGGUCG?CUGAUGAG?X?CGAA?AAGAGUC	?GACUCUU?U?CGACCCG
????7109	????GCGGGUC?CUGAUGAG?X?CGAA?AAAGAGU	?ACUCUUU?C?GACCCGC
			????7147	????UGCAACG?CUGAUGAG?X?CGAA?AUACUUC	?GAAGUAU?C?CGUUGCA
????7151	????CUGCUGC?CUGAUGAG?X?CGAA?ACGGAUA	?UAUCCGU?U?GCAGCAG
			????7163	????UUCGCAG?CUGAUGAG?X?CGAA?AUCUCUG	?CAGAGAU?C?CUGCGAA
????7174	????CUUCUUG?CUGAUGAG?X?CGAA?AUUUUCG	?CGAAAAU?C?CAAGAAG
			????7183	????GGGGGGG?CUGAUGAG?X?CGAA?ACUUCUU	?AAGAAGU?U?CCCCCCC
????7184	????CGGGGGG?CUGAUGAG?X?CGAA?AACUUCU	?AGAAGUU?C?CCCCCCG
			????7227	????AACAGUG?CUGAUGAG?X?CGAA?AGGGUUG	?CAACCCU?C?CACUGUU
????7240	????UUUCCAG?CUGAUGAG?X?CGAA?ACUCUAA	?UUAGAGU?C?CUGGAAA
			????7308	????GGUAUUG?CUGAUGAG?X?CGAA?AGGGCCC	?GGGCCCU?C?CAAUACC
????7313	????GAGGCGG?CUGAUGAG?X?CGAA?AUUGGAG	?CUCCAAU?A?CCGCCUC
			????7320	????UUCCGUG?CUGAUGAG?X?CGAA?AGGCGGU	?ACCGCCU?C?CACGGAA
????7340	????UCAGAAC?CUGAUGAG?X?CGAA?ACCGUCC	?GGACGGU?U?GUUCUGA
			????7343	????CUGUCAG?CUGAUGAG?X?CGAA?ACAACCG	?CGGUUGU?U?CUGACAG
????7344	????UCUGUCA?CUGAUGAG?X?CGAA?AACAACC	?GGUUGUU?C?UGACAGA
			????7363	????GGCAGAA?CUGAUGAG?X?CGAA?ACACGGU	?ACCGUGU?C?UUCUGCC
????7365	????AAGGCAG?CUGAUGAG?X?CGAA?AGACACG	?CGUGUCU?U?CUGCCUU
			????7366	????CAAGGCA?CUGAUGAG?X?CGAA?AAGACAC	?GUGUCUU?C?UGCCUUG
????7372	????CUCCGCC?CUGAUGAG?X?CGAA?AGGCAGA	?UCUGCCU?U?GGCGGAG
			????7405	????CGAUCCG?CUGAUGAG?X?CGAA?AGCUGCC	?GGCAGCU?C?CGGAUCG
????7446	????UGAUCGG?CUGAUGAG?X?CGAA?AGGGGCG	?CGCCCCU?C?CCGAUCA
			????7452	????GAGGUCU?CUGAUGAG?X?CGAA?AUCGGGA	?UCCCGAU?C?AGACCUC
????7459	????GUCGUCA?CUGAUGAG?X?CGAA?AGGUCUG	?CAGACCU?C?UGACGAC
			????7480	????AACGUCA?CUGAUGAG?X?CGAA?AUUCUUU	?AAAGAAU?C?UGACGUU
????7487	????ACGACUC?CUGAUGAG?X?CGAA?ACGUCAG	?CUGACGU?U?GAGUCGU

The position	Ribozyme	Substrate
			????7492	????GGAGUAC?CUGAUGAG?X?CGAA?ACUCAAC	??GUUGAGU?C?GUACUCC
????7495	????GGAGGAG?CUGAUGAG?X?CGAA?ACGACUC	??AGGUCGU?A?CUCCUCC
			????7609	????CCAUGUG?CUGAUGAG?X?CGAA?AGGACAU	??AUGUCCU?A?CACAUGG
????7631	????AUGGCGU?CUGAUGAG?X?CGAA?AUCAGGG	??CCCUGAU?C?ACGCCAU
			????7675	????GUUGCUC?CUGAUGAG?X?CGAA?ACGCGUU	??AACGCGU?U?GAGCAAC
????7684	????CAGCAGA?CUGAUGAG?X?CGAA?AGUUGCU	??AGCAACU?C?UCUGCUG
			????7686	????CGCAGCA?CUGAUGAG?X?CGAA?AGAGUUG	??CAACUCU?C?UGCUGCG
????7695	????UUGUGGU?CUGAUGAG?X?CGAA?ACGCAGC	??GCUGCGU?C?ACCACAA
			????7709	????UGGCAUA?CUGAUGAG?X?CGAA?ACCAUGU	??ACAUGGU?C?UAUGCCA
????7711	????UGUGGCA?CUGAUGAG?X?CGAA?AGACCAU	??AUGGUCU?A?UGCCACA
			????7754	????CAAAGGU?CUGAUGAG?X?CGAA?ACCUUCU	??AGAAGGU?C?ACCUUUG
????7759	????UCUGUCA?CUGAUGAG?X?CGAA?AGGUGAC	??GUCACCU?U?UGACAGA
			????7760	????GUCUGUC?CUGAUGAG?X?CGAA?AAGGUGA	??UCACCUU?U?GACAGAC
????7802	????UCUCCUU?CUGAUGAG?X?CGAA?AGCACGU	??ACGUGCU?C?AAGGAGA
			????7825	????AACUGUG?CUGAUGAG?X?CGAA?ACGCCUU	??AAGGCGU?C?CACAGUU
????7832	????UAGCCUU?CUGAUGAG?X?CGAA?ACUGUGG	??CCACAGU?U?AAGGCUA
			????7833	????UUAGCCU?CUGAUGAG?X?CGAA?AACUGUG	??CACAGUU?A?AGGCUAA
????7844	????CGGAUAG?CUGAUGAG?X?CGAA?AGUUUAG	??CUAAACU?U?CUAUCCG
			????7845	????ACGGAUA?CUGAUGAG?X?CGGA?AAGUUUA	??UAAACUU?C?UAUCCGU
????7884	????UUGGCCG?CUGAUGAG?X?CGAA?AUGUGGG	??CCCACAU?U?CGGCCAA
			????7885	????UUUGGCC?CUGAUGAG?X?CGAA?AAUGUGG	??CCACAUU?C?GGCCAAA
????7922	????GGUUCCG?CUGAUGAG?X?CGAA?ACGUCCU	??AGGACGU?C?CGGAACC
			????7931	????UGCUGGA?CUGAUGAG?X?CGAA?AGGUUCC	??GGAACCU?A?UCCAGCA
????7933	????CUUGCUG?CUGAUGAG?X?CGAA?AUAGGUU	??AACCUAU?C?CAGCAAG
			????7946	????UGUGGUU?CUGAUGAG?X?CGAA?AUGGCCU	??AGGCCAU?U?AACCACA
????7947	????AUGUGGU?CUGAUGAG?X?CGAA?AAUGGCC	??GGCCAUU?A?ACCACAU
			????8000	????UGGUGUC?CUGAUGAG?X?CGAA?AUUGGUG	??CACCAAU?U?GACACCA
????8012	????UUGCCAU?CUGAUGAG?X?CGAA?AUGGUGG	??CCACCAU?C?AUGGCAA
			????8030	????CGCAGAA?CUGAUGAG?X?CGAA?ACUUCAC	??GUGAAGU?U?UUCUGCG
????8031	????ACGCAGA?CUGAUGAG?X?CGAA?AACUUCA	??UGAAGUU?U?UCUGGGU

The position	Ribozyme	Substrate
			????8032	??????GACGCAG?CUGAUGAG?X?CGAA?AAACUUC	????GAAGUUU?U?CUGCGUC
????8033	??????GGACGCA?CUGAUGAG?X?CGAA?AAAACUU	????AAGUUUU?C?UGCGUCC
			????8039	??????CCGGUUG?CUGAUGAG?X?CGAA?ACGCAGA	????UCUGCGU?C?CAACCGG
????8070	??????AUAAGGC?CUGAUGAG?X?CGAA?AGCUGGC	????GCCAGCU?C?GCCUUAU
			????8081	??????CUGGGAA?CUGAUGAG?X?CGAA?ACGAUAA	????UUAUCGU?A?UUCCCAG
????8083	??????GUCUGGG?CUGAUGAG?X?CGAA?AUACGAU	????AUCGUAU?U?CCCAGAC
			????8084	??????GGUCUGG?CUGAUGAG?X?CGAA?AAUACGA	????UCGUAUU?C?CCAGACC
????8099	??????AUACACG?CUGAUGAG?X?CGAA?ACUCCCA	????UGGGAGU?U?CGUGUAU
			????8100	??????CAUACAC?CUGAUGAG?X?CGAA?AACUCCC	????GGGAGUU?C?GUGUAUG
????8105	??????UCUCGCA?CUGAUGAG?X?CGAA?ACACGAA	????UUCGUGU?A?UGCGAGA
			????8121	??????UCGUAAA?CUGAUGAG?X?CGAA?AGCCAUU	????AAUGGCU?C?UUUACGA
????8123	??????CGUCGUA?CUGAUGAG?X?CGAA?AGAGCCA	????UGGCUCU?U?UACGACG
			????8124	??????ACGUCGU?CUGAUGAG?X?CGAA?AAGAGCC	????GGCUCUU?U?ACGACGU
????8125	??????CACGUCG?CUGAUGAG?X?CGAA?AAAGAGC	????GCUCUUU?A?CGACGUG
			????8135	??????GGGUGGA?CUGAUGAG?X?CGAA?ACCACGU	????ACGUGGU?C?UCCACCC
????8137	??????AAGGGUG?CUGAUGAG?X?CGAA?AGACCAC	????GUGGUCU?C?CACCCUU
			????8144	??????CCUGAGG?CUGAUGAG?X?CGAA?AGGGUGG	????CCACCCU?U?CCUCAGG
????8145	??????GCCUGAG?CUGAUGAG?X?CGAA?AAGGGUG	????CACCCUU?C?CUCAGGC
			????8148	??????ACGGCCU?CUGAUGAG?X?CGAA?AGGAAGG	????CCUUCCU?C?AGGCCGU
????8164	??????GUACGAG?CUGAUGAG?X?CGAA?AGCCCAU	????AUGGGCU?C?CUCGUAC
			????8167	??????UCCGUAC?CUGAUGAG?X?CGAA?AGGAGCC	????GGCUCCU?C?GUACGGA
????8177	??????AGUACUG?CUGAUGAG?X?CGAA?AAUCCGU	????ACGGAUU?C?CAGUACU
			????8185	??????CCCAGGA?CUGAUGAG?X?CGAA?AGUACUG	????CAGUACU?C?UCCUGGG
????8241	??????AAGCCCA?CUGAUGAG?X?CGAA?AGGGCUU	????AAGCCCU?A?UGGGCUU
			????8248	??????AUACGAG?CUGAUGAG?X?CGAA?AGCCCAU	????AUGGGCU?U?CUCGUAU
????8249	??????CAUACGA?CUGAUGAG?X?CGAA?AAGCCCA	????UGGGCUU?C?UCGUAUG
			????8251	??????GUCAUAC?CUGAUGAG?X?CGAA?AGAAGCC	????GGCUUCU?C?GUAUGAC
????8254	??????GGUGUCA?CUGAUGAG?X?CGAA?ACGAGAA	????UUCUCGU?A?UGACACC
			????8269	??????UGAGUCA?CUGAUGAG?X?CGAA?AGCAGCG	????CGCUGCU?U?UGACUCA
????8270	??????UUGAGUC?CUGAUGAG?X?CGAA?AAGCAGC	????GCUGCUU?U?GACUCAA

The position	Ribozyme	Substrate
			????8275	?????GACUGUU?CUGAUGAG?X?CGAA?AGUCAAA	????UUUGACU?C?AACAGUC
????8282	?????UCUCAGU?CUGAUGAG?X?CGAA?ACUGUUG	????CAACAGU?C?ACUGAGA
			????8297	?????CAACACG?CUGAUGAG?X?CGAA?AUGUCGC	????GCGACAU?C?CGUGUUG
????8303	?????ACUCCUC?CUGAUGAG?X?CGAA?ACACGGA	????UCCGUGU?U?GAGGAGU
			????8311	?????GUAGAUU?CUGAUGAG?X?CGAA?ACUCCUC	????GAGGAGU?C?AAUCUAC
????8315	?????AUUGGUA?CUGAUGAG?X?CGAA?AUUGACU	????AGUCAAU?C?UACCAAU
			????8317	?????ACAUUGG?CUGAUGAG?X?CGAA?AGAUUGA	????UCAAUCU?A?CCAAUGU
????8325	?????AAGUCAC?CUGAUGAG?X?CGAA?ACAUUGG	????CCAAUGU?U?GUGACUU
			????8332	?????GGGGGCC?CUGAUGAG?X?CGAA?AGUCACA	????UGUGACU?U?GGCCCCC
????8400	?????UUUGAAU?CUGAUGAG?X?CGAA?AGUCAGG	????CCUGACU?A?AUUCAAA
			????8403	?????CCUUUUG?CUGAUGAG?X?CGAA?AUUAGUC	????GACUAAU?U?CAAAAGG
????8404	?????CCCUUUU?CUGAUGAG?X?CGAA?AAUUAGU	????ACUAAUU?C?AAAAGGG
			????8472	?????AUGAGGG?CUGAUGAG?X?CGAA?AUUGCCG	????CGGCAAU?A?CCCUCAC
????8477	?????AGCAUGU?CUGAUGAG?X?CGAA?AGGGUAU	????AUACCCU?C?ACAUGCU
			????8485	?????UUUCAAG?CUGAUGAG?X?CGAA?AGCAUGU	????ACAUGCU?A?CUUGAAA
????8488	?????GGCUUUC?CUGAUGAG?X?CGAA?AGUAGCA	????UGCUACU?U?GAAAGCC
			????8565	?????UCACAGA?CUGAUGAG?X?CGAA?AACGACA	????UGUCGUU?A?UCUGUGA
????8567	?????UUUCACA?CUGAUGAG?X?CGAA?AUAACGA	????UCGUUAU?C?UGUGAAA
			????8606	?????AGACUCG?CUGAUGAG?X?CGAA?AGGCUCG	????CGAGCCU?A?CGAGUCU
????8612	?????CCGUGAA?CUGAUGAG?X?CGAA?ACUCGUA	????UACGAGU?C?UUCACGG
			????8614	?????CUCCGUG?CUGAUGAG?X?CGAA?AGACUCG	????CGAGUCU?U?CACGGAG
????8615	?????CCUCCGU?CUGAUGAG?X?CGAA?AAGACUC	????GAGUCUU?C?ACGGAGG
			????8625	?????CUAGUCA?CUGAUGAG?X?CGAA?AGCCUCC	????GGAGGCU?A?UGACUAG
????8631	?????GAGUACC?CUGAUGAG?X?CGAA?AGUCAUA	????UAUGACU?A?GGUACUC
			????8635	?????GGCAGAG?CUGAUGAG?X?CGAA?ACCUAGU	????ACUAGGU?A?CUCUGCC
????8677	?????CAACUCC?CUGAUGAG?X?CGAA?AGUCGUA	????UACGACU?U?GGAGUUG
			????8683	?????UGUUAUC?CUGAUGAG?X?CGAA?ACUCCAA	????UUGGAGU?U?GAUAACA
????8687	?????AUGAUGU?CUGAUGAG?X?CGAA?AUCAACU	????AGUUAAU?A?ACAUCAU
			????8692	?????GGAGCAU?CUGAUGAG?X?CGAA?AUGUUAU	????AUAACAU?C?AUGCUCC
????8710	?????CGCGACC?CUGAUGAG?X?CGAA?ACACGUU	????AACGUGU?C?GGUCGCG

The position	Ribozyme	Substrate
			????8714	?????CGUGCGC?CUGAUGAG?X?CGAA?ACCGACA	????UGUCGGU?C?GCGCACG
????8743	?????GAGGUAG?CUGAUGAG?X?CGAA?ACACUCU	????AGAGUGU?A?CUACCUC
			????8746	?????AGUGAGG?CUGAUGAG?X?CGAA?AGUACAC	????GUGUACU?A?CCUCACU
????8750	?????CACGAGU?CUGAUGAG?X?CGAA?AGGUAGU	????ACUACCU?C?ACUCGUG
			????8754	?????GGAUCAC?CUGAUGAG?X?CGAA?AGUGAGG	????CCUCACU?C?GUGAUCC
????8760	?????GUGGUGG?CUGAUGAG?X?CGAA?AUCACGA	????UCGUGAU?C?CCACCAC
			????8799	?????GUGUGUC?CUGAUGAG?X?CGAA?AGCUGUC	????GACAGCU?A?GACACAC
????8808	?????UUGACUG?CUGAUGAG?X?CGAA?AGUGCGU	????ACACACU?C?CAGUCAA
			????8813	?????AGGAGUU?CUGAUGAG?X?CGAA?ACUGGAG	????CUCCAGU?C?AACUCCU
????8818	?????UAGCCAG?CUGAUGAG?X?CGAA?AGUUGAC	????GUCAACU?C?CUGGCUA
			????8825	?????UGUUGCC?CUGAUGAG?X?CGAA?AGCCAGG	????CCUGGCU?A?GGCAACA
????8834	?????ACAUGAU?CUGAUGAG?X?CGAA?AUGUUGC	????GCAACAU?C?AUCAUGU
			????8837	?????CAUACAU?CUGAUGAG?X?CGAA?AUGAUGU	????ACAUCAU?C?AUGUAUG
????8870	?????UCAUCAA?CUGAUGAG?X?CGAA?AUCAUCC	????GGAUGAU?U?UUGAUGA
			????8872	?????AGUCAUC?CUGAUGAG?X?CGAA?AAAUCAU	????AUGAUUU?U?GAUGACU
????8884	?????GGAGAAG?CUGAUGAG?X?CGAA?AGUGAGU	????ACUCACU?U?CUUCUCC
			????8885	?????UGGAGAA?CUGAGUAG?X?CGAA?AAGUGAG	????CUCACUU?C?UUCUCCA
????8887	?????GAUGGAG?CUGAUGAG?X?CGAA?AGAAGUG	????CACUUCU?U?CUCCAUC
			????8888	?????GGAUGGA?CUGAUGAG?X?CGAA?AAGAAGU	????ACUUCUU?C?UCCAUCC
????8890	?????AAGGAUG?CUGAUGAG?X?CGAA?AGAAGAA	????UUCUUCU?C?CAUCCUU
			????8894	?????CUAGAAG?CUGAUGAG?X?CGAA?AUGGAGA	????UCUCCAU?C?CUUCUAG
????8897	?????GGGCUAG?CUGAUGAG?X?CGAA?AGGAUGG	????CCAUCCU?U?CUAGCCC
			????8898	?????UGGGCUA?CUGAUGAG?X?CGAA?AAGGAUG	????CAUCCUU?C?UAGCCCA
????8900	?????CCUGGGC?CUGAUGAG?X?CGAA?AGAAGAA	????UCCUUCU?A?GCCCAGG
			????8915	?????CCUUUUC?CUGAUGAG?X?CGAA?AGCUGUU	????AACAGCU?U?GAAAAGG
????8952	?????AUGGAGU?CUGAUGAG?X?CGAA?ACAGGCC	????GGCCUGU?U?ACUCCAU
			????8953	?????AAUGGAG?CUGAUGAG?X?CGAA?AACAGGC	????GCCUGUU?A?CUCCAUU
????8956	?????CUCAAUG?CUGAUGAG?X?CGAA?AGUAACA	????UGUUACU?C?CAUUGAG
			????8960	?????GUGGCUC?CUGAUGAG?X?CGAA?AUGGAGU	????ACUCCAU?U?GAGCCAC
????8969	?????GUAGGUC?CUGAUGAG?X?CGAA?AGUGGCU	????AGCCACU?U?GACCUAC

The position	Ribozyme	Substrate
			????8975	??????UCUGAGG?CUGAUGAG?X?CGAA?AGGUCAA	????UUGACCU?A?CCUCAGA
????8979	??????AUGAUCU?CUGAUGAG?X?CGAA?AGGUAGG	????CCUACCU?C?AGAUCAU
			????8984	??????GUUGAAU?CUGAUGAG?X?CGAA?AUCUGAG	????CUCAGAU?C?AUUCAAC
????8987	??????GUCGUUG?CUGAUGAG?X?CGAA?AUGAUCU	????AGAUCAU?U?CAACGAC
			????8988	??????AGUCGUU?CUGAUGAG?X?CGAA?AAUGAUC	????GAUCAUU?C?AACGACU
????8996	??????GACCAUG?CUGAUGAG?X?CGAA?AGUCGUU	????AACGACU?C?CAUGGUC
			????9003	??????GCGCUAA?CUGAUGAG?X?CGAA?ACCAUGG	????CCAUGGU?C?UUAGCGC
????9005	??????AUGCGCU?CUGAUGAG?X?CGAA?AGACCAU	????AUGGUCU?U?AGCGCAU
			????9006	??????AAUGCGC?CUGAUGAG?X?CGAA?AAGACCA	????UGGUCUU?A?GCGCAUU
????9013	??????GAGUGAG?UUGAUGAG?X?CGAA?AUGCGCU	????AGCGCAU?U?CUCACUC
			????9014	??????GGAGUGA?CUGAUGAG?X?CGAA?AAUGCGC	????GCGCAUU?C?UCACUCC
????9016	??????AUGGAGU?CUGAUGAG?X?CGAA?AGAAUGC	????GCAUUCU?C?ACUCCAU
			????9020	??????AACUAUG?CUGAUGAG?X?CGAA?AGUGAGA	????UCUCACU?C?CAUAGUU
????9024	??????GAGUAAC?CUGAUGAG?X?CGAA?AUGGAGU	????ACUCCAU?A?GUUACUC
			????9027	??????GGAGAGU?CUGAUGAG?X?CGAA?ACUAUGG	????CCAUAGU?U?ACUCUCC
????9028	??????UGGAGAG?CUGAUGAG?X?CGAA?AACUAUG	????CAUAGUU?A?CUCUCCA
			????9031	??????ACCUGGA?CUGAUGAG?X?CGAA?AGUAACU	????AGUUACU?C?UCCAGGU
????9033	??????UCACCUG?CUGAUGAG?X?CGAA?AGAGUAA	????UUACUCU?C?CAGGUGA
			????9044	??????CCCUAUU?CUGAUGAG?X?CGAA?AUCUCAC	????GUGAGAU?C?AAUAGGG
????9048	??????GCCACCC?CUGAUGAG?X?CGAA?AUUGAUC	????GAUCAAU?A?GGGUGGC
			????9057	??????AGGCAUG?CUGAUGAG?X?CGAA?AGCCACC	????GGUGGCU?U?CAUGCCU
????9058	??????GAGGCAU?CUGAUGAG?X?CGAA?AAGCCAC	????GUGGCUU?C?AUGCCUC
			????9105	??????CUGGCCC?CUGAUGAG?X?CGAA?AUGUCUC	????GAGACAU?C?GGGCCAG
????9169	??????GAAGAGG?CUGAUGAG?X?CGAA?ACUUGCC	????GGCAAGU?A?CCUCUUC
			????9173	??????AGUUGAA?CUGAUGAG?X?CGAA?AGGUACU	????AGUACCU?C?UUCAACU
????9175	??????CCAGUUG?CUGAUGAG?X?CGAA?AGAGGUA	????UACCUCU?U?CAACUGG
			????9176	??????CCCAGUU?CUGAUGAG?X?CGAA?AAGAGGU	????ACCUCUU?C?AACUGGG
????9188	??????UGGUCCU?CUGAUGAG?X?CGAA?ACUGCCC	????GGGCAGU?A?AGGACCA
			????9200	??????UGAGUUU?CUGAUGAG?X?CGAA?AGCUUGG	????CCAAGCU?C?AAACUCA
????9206	??????UUGGAGU?CUGAUGAG?X?CGAA?AGUUUGA	????UCAAACU?C?ACUCCAA

The position	Ribozyme	Substrate
			????9210	????GGGAUUG?CUGAUGAG?X?CGAA?AGUGAGU	????ACUCACU?C?CAAUCCC
????9215	????CGGCCGG?CUGAUGAG?X?CGAA?AUUGGAG	????CUCCAAU?C?CCGGCCG
			????9261	????CCGCUGU?CUGAUGAG?X?CGAA?ACCAGCA	????UGCUGGU?U?ACAGCGG
????9262	????CCCACUG?CUGAUGAG?X?CGAA?AACCAGC	????GCUGGUU?A?CAGCGGG
			????9294	????CGGGCAC?CUGAUGAG?X?CGAA?AGACAGG	????CCUGUCU?C?GUGCCCG
????9313	????CCACAUA?CUGAUGAG?X?CGAA?ACCAGCG	????CGCUGGU?U?UAUGUGG
			????9314	????ACCACAU?CUGAUGAG?X?CGAA?AACCAGC	????GCUGGUU?U?AUGUGGU
????9315	????CACCACA?CUGAUGAG?X?CGAA?AAACCAG	????CUGGUUU?A?UGUGGUG
			????9409	????AAAAGGG?CUGAUGAG?X?CGAA?AIGGCCU	????AGGCCAU?C?CCCUUUU
????9414	????AAAAAAA?CUGAUGAG?X?CGAA?AGGGGAU	????AUCCCCU?U?UUUUUUU

Wherein the length of the stem II district of " X " expression HH ribozyme (Hertel etc., 1992, ribozyme research, 20: 3252) stem II can be 2 base pairs.

Table VII HCV sends out pod type (HP) ribozyme and target sequence

The position	Ribozyme sequence	Substrate
??10	???????CCCCCA?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?CGAU?UGGGGG
			??59	???????CGUGAA?AGAA?GUAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUAC?UGUC?UUCACG
??109	???????CCUGGA?AGCC?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUGC?AGCC?UCCAGG
			??209	???????GCAUUG?AGAA?GGUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AACC?CGCU?CAAUGC
??290	???????CUAUCA?AGAA?GUAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUAC?UGCC?UGAUAG
			??390	???????GUGGGC?AGAA?GUAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUAC?CGCC?GCCCAC
??393	???????CCUGUG?AGAA?GCGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCGC?CGCC?CACAGG
			??427	???????CCAACG?AGAA?GACC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGUC?AGAU?CGUUGG
??505	???????GGUUGC?AGAA?GUUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GAAC?GGUC?GCAACC
			??549	???????CCUCGG?AGAA?GCGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCGC?CGAC?CCGAGG
??574	???????UACCCA?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCUC?AGCC?UGGGUA
			??645	???????GCCGGG?AGAA?GCGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCGC?GGCU?CCCGGC
??652	???????CAACUA?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCCC?GGCC?UAGUUG
			??671	???????CCGGGG?AGAA?GUGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCAC?GGAC?CCCCGG
??726	???????CGGCGA?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUGC?GGCU?UCGCCG
			??734	???????CAUGAG?AGAA?GCGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCGC?CGAC?CUCAUG
??754	???????CCGACG?AGAA?GAAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUUC?CGCU?CGUCGG
			??852	???????AAGAGC?AGAA?GGGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCCC?GGUU?GCUCUU
??883	???????CAGGAC?AGAA?GGGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCCC?UGCU?GUCCUG
			??886	???????AAACAG?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUGC?UGUC?CUGUUU
??891	???????UGGUCA?AGAA?GGAC?ACCAGAGAAACA?X?GUACUUACCUGGUA	???GUCC?UGUU?UGACCA
			??905	???????AGCGGA?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCCC?AGCU?UCCGCU
??911	???????CUGAUA?AGAA?GAAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUUC?CGCU?UAUCAG
			??960	???????AGUUGG?AGAA?GUCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGAC?UGCU?CCAACU
??1050	???????CCCAAC?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?CGUU?GUUGGG
			??1145	???????GAAAGC?AGAA?GCCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGGC?GGCC?GCUUUC
??1148	???????ACAGAA?AGAA?GCCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGGC?CGCU?UUCUGU

The position	Ribozyme sequence	Substrate
			?1155	???????UGGCGG?AGAA?GAAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UUUC?UGUU?CCGCCA
?1185	???????AAACGG?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?GGAU?CCGUUU
			?1190	???????GAGGAA?AGAA?GAUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAUC?CGUU?UUCCUC
?1207	???????GUGAAC?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCCC?AGUU?GUUCAC
			?1331	???????CACUAG?AGAA?GUUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CAAC?AGCC?CUAGUG
?1357	???????UGUGGG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUCC?GGAU?CCCACA
			?1370	???????AUCCAC?AGAA?GCUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AAGC?UGUC?GUGGAU
?1562	???????UCUCUG?AGAA?GGCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGCC?GGCC?CAGAGA
			?1576	???????UUUAUG?AGAA?GGAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AUCC?AGCU?CAUAAA
?1596	???????UGUGCC?AGAA?GCCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGGC?AGCU?GGCACA
			?1616	???????GUUCAG?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGAC?UGCC?CUGAAC
?1663	???????GCGUAG?AGAA?GUGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GCAC?UGUU?CUACGC
			?1692	???????CUGGGC?AGAA?GGAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUCC?GGAU?GCCCAG
?1713	???????AGCUGC?AGAA?GGCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGCC?AGCU?GCAGCU
			?1719	???????CGAUGG?AGAA?CGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?AGCU?CCAUCG
?1797	???????AAUGCC?AGAA?GUAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UUAC?UGCU?GGCAUU
			?1863	???????GGGUGA?AGAA?GUAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUAC?UGUU?UCACCC
?1880	???????CACUAC?AGAA?GGGC?ACCAGAGAAAXA?X?GUACAUUACCUGGUA	????GCCC?UGUU?GUAGUG
			?1898	???????GGACCG?AGAA?GUCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CGAC?CGAU?CGGUCC
?1903	???????GCACCG?AGAA?GAUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAUC?GGUC?CGGUGC
			?1943	???????CAGCAC?AGAA?GUCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGAC?AGAU?GUGCUG
?1951	???????UUGAGA?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUGC?UGCU?UCUCAA
			?1969	???????UGUGGC?AGAA?GCGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????ACGC?GGCC?GCCACA
?2082	???????CCGUGG?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GACC?UGCC?CCACGG
			?2090	???????AAAGCA?AGAA?GUGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCAC?GGAU?UGCUUU
?2316	???????GCUCCG?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGAC?AGAU?CGGAGC
			?2328	???????GCAGCG?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GCUC?AGCC?CGCUGC
?2332	???????AGCAGC?AGAA?GGCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGCC?CGCU?GCUGCU
			?2335	???????GACAGC?AGAA?GCGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCGC?UGCU?GCUGUC
?2338	???????GUGGAC?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?UGCU?GUCCAC

The position	Ribozyme sequence	Substrate
			?2341	???????GUCGUG?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?UGUC?ACCGAC
?2370	???????UGAAGG?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCCC?UGUU?CCUUCA
			?2390	???????GGACAG?AGAA?GGUA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UACC?GGCU?CUGUCC
?2395	???????CCAGUG?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GCUC?UGUC?CACUGG
			?2465	???????GGAGAC?AGAA?GCUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CAGC?GGUU?GUCUCC
?2522	???????GCGCGC?AGAA?GCCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGGC?GGAC?GCGCGC
			?2541	???????UCCACA?AGAA?GGCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGCC?UGCU?UGUGGA
?2557	???????GCUAUC?AGAA?GCAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AUGC?UGCU?GAUAGC
			?2579	???????CUCUAG?AGAA?GCCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGGC?CGCC?CUAGAG
?2627	???????AAUGCC?AGAA?GCUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAGC?GGAU?GGCAUU
			?2663	???????GUACCA?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUGC?CGCC?UGGUAC
?2725	???????AGGAGC?AGAA?GCCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGGC?CGCU?GCUCCU
			?2728	???????AGCAGG?AGAA?GCGG?ACCGAGAAAACA?X?GUACAUUACCUGGUA	????CCGC?UGCU?CCUGCU
?2734	???????AGCAGG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUCC?UGCU?CCUGCU
			?2740	???????AACGCC?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUCC?UGCU?GGCGUU
?2978	???????UGGGUG?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUGC?GGCC?CACCCA
			?3016	???????AUGGCG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUCC?UGCU?CGCCAU
?3030	???????UGAGCG?AGAA?GAGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCUC?GGUC?CGCUCA
			?3034	???????ACCAUG?AGAA?GACC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGUC?CGCU?CAUGGU
?3260	???????GAAGAC?AGAA?GGCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGCC?CGUC?GUCUUC
			?3340	???????GAGACG?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGAC?UGCC?CGUCUC
?3344	???????GGCGGA?AGAA?GGCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGCC?CGUC?UCCGCC
			?3350	???????CCUUCG?AGAA?GAGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCUC?CGCC?CGAAGG
?3383	???????GCUAUC?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GACC?GGCC?GAUAGC
			?3431	???????GGCGUA?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCAC?GGCC?UACGCC
?3581	???????GUGGAA?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGAC?CGUC?UUCCAC
			?3597	???????UCUUUG?AGAA?GGCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CGCC?GGCU?CAAAGA
?3615	???????CUUUUG?AGAA?GGCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGCC?GGCC?CAAAAG
			?3669	???????CAUGCC?AGAA?GACG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CGUC?GGCU?GGCAUG
?3725	???????AUAGAG?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GCUC?GGAC?CUCUAU

The position	Ribozyme sequence	Substrate
			??3752	??????AAUGAC?AGAA?GCAU?ACCAGAGAAACA?X?GUAGAUUACCUGGUA	???AUGC?UGAC?GUCAUU
??3771	??????CACCGC?AGAA?GCGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCGC?CGAC?GCGGUG
			??3783	??????UCCCCC?AGAA?GUCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGAC?GGUC?GGGGGA
??3799	??????CUGGGG?AGAA?GUAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUAC?UGUC?CCCCAG
			??3807	??????AGACGG?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?AGAC?CCGUCU
??3812	??????AUAGGA?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GACC?CGUC?UCCUAU
			??3847	??????GGGCAG?AGAA?GUGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCAC?UGCU?CUGCCC
??3852	??????CCGAAG?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCUC?UGCC?CUUCGG
			??3887	??????GCACAC?AGAA?GCCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGGC?UGCU?GUGUGC
??3932	??????AGACUC?AGAA?GGUA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UACC?CGUU?GAGUCU
			??3958	??????ACCGGG?AGAA?GCAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUGC?GGUC?CCCGGU
??3965	??????CGUGAA?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?GGUC?UUCACG
			??3992	??????CGGAUC?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?GGCC?GUACCG
??4064	??????GUACGC?AGAA?GGCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGCC?GGCU?GGGUAC
			??4076	??????CCCUUG?AGAA?GCGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???ACGC?AGCC?CAAGGG
??4112	??????GGCGGC?AGAA?GAUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CAUC?UGUU?GCCGCC
			??4163	??????GUUGGG?AGAA?GUAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUAC?CGAC?CCCAAC
??4244	??????UCCACC?AGAA?GCAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UUGC?CGAC?GGUGGA
			??4304	??????AGUCGA?AGAA?GUUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CAAC?UGAC?UCGACU
??4334	??????GUCCAG?AGAA?GUGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCAC?AGUC?CUGGAC
			??4355	??????CGCUCC?AGAA?GUCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AGAC?GGCU?GGAGCG
??4366	??????ACGACG?AGAA?GCGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCGC?GGCU?CGUCGU
			??4441	??????GUGUUG?AGAA?GAGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCUC?UGUC?CAACAC
??4621	??????CCGCUA?AGAA?GUAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUAC?CGAC?UAGCGG
			??4652	??????UAGAGC?AGAA?GUUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CAAC?AGAC?GCUCUA
??4724	??????GAAAUC?AGAA?GUCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AGAC?AGUC?GAUUUC
			??4734	??????GAUCCA?AGAA?GAAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UUUC?AGCU?UGGAUC
??4861	??????CCCGAG?AGAA?GUUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GAAC?GGCC?CUCGGG
			??4886	??????ACACAG?AGAA?GAAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUUC?GGCU?CUGUGU
??4937	??????AGUCUC?AGAA?GGCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGCC?CGCU?GAGACU

The position	Ribozyme sequence	Substrate
			??4988	???????CUGGCA?AGAA?GGCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGCC?CGUC?UGCCAG
??5059	???????GUUUGG?AGAA?GGAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UUCC?UGUC?CCAAAC
			??5179	???????GGUUUA?AGAA?GUAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUAC?GGCU?UAAACC
??5212	???????CUAUAC?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?UGCU?GUAUAG
			??5231	???????AUUUUG?AGAA?GCUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GAGC?CGUU?CAAAAU
??5291	???????CAGGUC?AGAA?GACA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGUC?GGCC?GACCUG
			??5294	???????CUCCAG?AGAA?GCCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGGC?CGAC?CUGGAG
??5345	???????GGCCAG?AGAA?GCAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UUGC?AGCU?CUGGCC
			??5417	???????AACAAC?AGAA?GGCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGCC?GGCU?GUUGUU
??5420	???????GGGAAC?AGAA?GCCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGGC?UGUU?GUUCCC
			??5509	???????UCGGCG?AGAA?GCAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUGC?AGCU?CGCCGA
??5521	???????UGCUUG?AGAA?GCUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GAGC?AGUU?CAAGCA
			??5576	???????GGGAGC?AGAA?GCCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AGGC?CGCU?GCUCCC
??5579	???????CACGGG?AGAA?GCGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCGC?UGCU?CCCGUG
			??5683	???????UUCCCA?AGAA?GAGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???ACUC?UGCC?UGGGAA
??5710	???????AAUGCC?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCAC?UGAU?GGCAUU
			??5723	???????GAUAGA?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCAC?AGCC?UCUAUC
??5736	???????UGAGCG?AGAA?GGUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CACC?AGUC?CGCUCA
			??5740	???????GUGGUG?AGAA?GACU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AGUC?CGCU?CACCAC
??5764	???????AUGUUG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?UGUU?CAACAU
			??5792	???????GAGUUG?AGAA?GCCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGGC?UGCU?CAACUC
??5816	???????GGCCGA?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUGC?UGCU?UCGGCC
			??5822	???????CACGAA?AGAA?GAAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUUC?GGCC?UUCGUG
??5966	???????GUCCUC?AGAA?GAGG?AGGAGAGAAACA?X?GUACAUUACCUGGUA	???CCUC?CGCC?GAGGAC
			??6094	???????GCUAUC?AGAA?GGUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AACC?GGCU?GAUAGC
??6178	???????GAGAGG?AGAA?GAGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???ACUC?AGAU?CCUCUC
			??6189	???????UGGUGA?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?AGCC?UCACCA
??6205	???????UUCAGC?AGAA?GAGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???ACUC?AGCU?GCUGAA
			??6208	???????CUCUUC?AGAA?GCUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CAGC?UGCU?GAAGAG
??6243	???????GCGUGG?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGAC?UGCU?CCACGC

The position	Ribozyme sequence	Substrate
			??6261	???????GCCACG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?GGCU?CGUGGC
??6308	???????CUUGAA?AGAA?GUCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGAC?UGAC?UUCAAG
			??6328	???????AGCUUG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?AGUC?CAAGCU
??6340	???????AAUUUC?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?UGCC?GAAAUU
			??6426	???????CACAUG?AGAA?GGUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CACC?UGCC?CAUGUG
??6465	???????UCAUGG?AGAA?GUUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AAAC?GGUU?CCAUGA
			??6599	???????CUCUUC?AGAA?GCCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UGGC?UGCU?GAAGAG
??6692	???????UUCGGG?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCCC?GGCC?CCCGAA
			??6727	???????CUGUGC?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUGC?GGUU?GCACAG
??6753	???????GGAGAG?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUGC?AGAC?CUCUCC
			??6817	???????CAUGGG?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCAC?AGCU?CCCAUG
??6839	???????UGCCAC?AGAA?GGUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AACC?GGAU?GUGGCA
			??6869	???????GGAGGG?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UCAC?CGAC?CCCUCC
??6939	???????CUGAAG?AGAA?GGCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGCC?AGCU?CUUCAG
			??7007	???????GUCAGC?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CCCC?GGAC?GCUGAC
??7013	???????GAUGAG?AGAA?GCGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???ACGC?UGAC?CUCAUC
			??7114	???????GCUCGA?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GACC?CGCU?UCGAGC
??7148	???????UGCUGC?AGAA?GAUA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UAUC?CGUU?GCAGCA
			??7214	???????GUUGUA?AGAA?GGGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GCCC?GGAU?UACAAC
??7253	???????GACGUA?AGAA?GGAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GUCC?GGAC?UACGUC
			??7291	???????GUGGUA?AGAA?GCAA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???UUGC?CGCC?UACCAC
??7315	???????CGUGGA?AGAA?GUAU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???AUAC?CGCC?UCCACG
			??7337	???????CAGAAC?AGAA?GUCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???GGAC?GGUU?GUUCUG
??7367	???????CGCCAA?AGAA?GAAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUUC?UGCC?UUGGCG
			??7401	???????AUCCGG?AGAA?GCCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGGC?AGCU?CCGGAU
??7407	???????CCGACG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?GGAU?CGUCGG
			??7415	???????GUCAAC?AGAA?GACG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGUC?GGCC?GUUGAC
??7418	???????GCUGUC?AGAA?GCCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGGC?CGUU?GACAGC
			??7439	???????GGGAGG?AGAA?GUCG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CGAC?CGCC?CCUCCC
??7448	???????GGUCUG?AGAA?GGAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	???CUCC?CGAU?CAGACC

The position	Ribozyme sequence	Substrate
			??7453	?????UCAGAG?AGAA?GAUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAUC?AGAC?CUCUGA
??7460	?????ACCGUC?AGAA?GAGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCUC?UGAC?GACGGU
			??7481	?????CUCAAC?AGAA?GAUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AAUC?UGAC?GUUGAG
??7535	?????GCUGAG?AGAA?GGGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????ACCC?UGAU?CUCAGC
			??7593	?????UUGAGC?AGAA?GACG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CGUC?UGCU?GCUCAA
??7596	?????ACAUUG?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?UGCU?CAAUGU
			??7627	?????GGCGUG?AGAA?GGGC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GCCC?UGAU?CACGCC
??7660	?????UUGAUG?AGAA?GCUU?GCCAGAGAAACA?X?GUACAUUACCUGGUA	????AAGC?UGCC?CAUCAA
			??7687	?????UGACGC?AGAA?GAGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCCU?UGCU?GCGUCA
??7764	?????CUUGCA?AGAA?GUCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGAC?AGAC?UGCAAG
			??7870	?????GGGGGC?AGAA?GCUU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AAGC?UGAC?GCCCCC
??7956	?????ACACGG?AGAA?GAUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CAUC?CGCU?CCGUGU
			??7975	?????UCUUCC?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GACC?UGCU?GGAAGA
??8066	?????AAGGCG?AGAA?GGCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????AGCC?AGCU?CGCCUU
			??8087	?????UCCCAG?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UCCC?AGAC?CUGGGA
??8172	?????ACUGGA?AGAA?GUAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUAC?GGAU?UCCAGU
			??8262	?????CAAAGC?AGAA?GGUG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CACC?CGCU?GCUUUG
??8265	?????AGUCAA?AGAA?GCGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCGC?UGCU?UUGACU
			??8374	?????AUGUAG?AGAA?GCUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAGC?GGCU?CUACAU
??8395	?????GAAUUA?AGAA?GGGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCCC?UGAC?UAAUUC
			??8452	?????CUAGUC?AGAA?GCAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUGC?UGAC?GACUAG
??8501	?????UCGACA?AGAA?GCAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CUGC?GGCC?UGUCGA
			??8505	?????CAGCUC?AGAA?GGCC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GGCC?UGUC?GAGCUG
??8639	?????GGGGGG?AGAA?GAGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????ACUC?UGCC?CCCCCC
			??8656	?????GGUUGG?AGAA?GGUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GACC?CGCC?CCAACC
??8711	?????GUGCGC?AGAA?GACA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGUC?GGUC?GCGCAC
			??8911	?????UUUUCA?AGAA?GUUC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GAAC?AGCU?UGAAAA
??8935	?????CCGUAG?AGAA?GACA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????UGUC?AGAU?CUACGG
			??8980	?????UGAAUG?AGAA?GAGG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????CCUC?AGAU?CAUUCA
??9082	?????CGCAAG?AGAA?GUAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	????GUAC?CGCC?CUUGCG

The position	Ribozyme sequence	Substrate
			?9133	??????CCUUGG?AGAA?GUAG?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??CUAC?UGUC?CCAAGG
?9218	??????GGACGC?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??UCCC?GGCC?GCGUCC
			?9229	??????AAGUCC?AGAA?GGGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??UCCC?AGCU?GGACUU
?9243	??????CGAACC?AGAA?GGAC?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??GUCC?AGCU?GGUUCG
			?9285	??????GAGACA?AGAA?GUGA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??UCAC?AGCC?UGUUUC
?9289	??????GCACGA?AGAA?GGCU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??AGCC?UGUC?UCGUGC
			?9300	??????AGCGGG?AGAA?GGCA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??UGCC?CGAC?CCCGCU
?9306	??????UAAACC?AGAA?GGGU?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??ACCC?CCCU?GGUUUA
			?9358	??????UUGGGG?AGAA?GGUA?ACCAGAGAAACA?X?GUACAUUACCUGGUA	??UACC?UGCU?CCCCAA

Wherein " X " represents the stem IV district (people such as Berzal-Herranx, 1993, EMBO's magazine 12,2567) of HP ribozyme.The length of stem IV can be 2 base pairs.

Table VIII: hammerhead ribozyme and target sequence that other HCV is conservative

Numbering	Title *	The position +	Ribozyme	Substrate
					????1	??HCV.C-48	?278	?UUGGUGU?CUGAUGAG?X?CGAA?ACGUUUG	?CAAACGU?A?ACACCAA
????2	??HCV.C-60	?290	?UGUGGGC?CUGAUGAG?X?CGAA?ACGGUUG	?CAACCGU?C?GCCCACA
					????3	??HCV.C-175	?405	?AGGUUGU?CUGAUGAG?X?CGAA?ACCGCUC	?GAGCGGU?C?ACAACCU
????4	??HCV.3-118	?9418	?AAAAAAA?CUGAUGAG?X?CGAA?AAAAAAA	?UUUUUUU?U?UUUUUUU
					????5	??HCV.3-145	?9445	?UAAGAUG?CUGAUGAG?X?CGAA?AGCCACC	?GGUGGCU?C?CAUCUUA
????6	??HCV.3-149	?9449	?GGGCUAA?CUGAUGAG?X?CGAA?AUGGAGC	?GCUCCAU?C?UUAGCCC
					????7	??HCV.3-151	?9451	?UAGGGCU?CUGAUGAG?X?CGAA?AGAUGGA	?UCCAUCU?U?AGCCCUA
????8	??HCV.3-152	?9452	?CUAGGGC?CUGAUGAG?X?CGAA?AAGAUGG	?CCAUCUU?A?GCCCUAG
					????9	??HCV.3-158	?9458	?CCGUGAC?CUGAUGAG?X?CGAA?AGGGCUA	?UAGCCCU?A?GUCACGG
????10	??HCV.3-161	?9461	?UAGCCGU?CUGAUGAG?X?CGAA?ACUAGGG	?CCCUAGU?C?ACGGCUA
					????11	??HCV.3-168	?9468	?UCACAGC?CUGAUGAG?X?CGAA?AGCCGUG	?CACGGCU?A?GCUGUGA
????12	??HCV.3-181	?9481	?GCUCACG?CUGAUGAG?X?CGAA?ACCUUUC	?GAAAGGU?C?CGUGAGC

Wherein on behalf of the length of stem II district (Hertel etc., 1992 nucleic acids research 20: 3252) the stem II of HH ribozyme, " X " can be 2 base pairs.Core reference sequences=HPCCOPR (Acc#L38318) 1-600 bp of numbering 1-3 ^*-in order to give the numbering of the ribozyme site in the core protein coding region, 231 Nucleotide (8 Nucleotide of atg start codon ATG upstream) are appointed as " 1 ".3 of numbering 4-12 '-NCR reference sequences=D85516 (Acc#D85516) 9301-9535 bp ^*-for the ribozyme site among 3 ＇ NCR numbering, and 9301 Nucleotide is appointed as " 1 " ⁺-Position Number has reflected the reference sequences of HPCCOPR

The table IX is with the inhibition to HCV RNA in the OST7 cell of multiple ribozyme primitive

Primitive	The RPI numbering	??F luc/R luc	??SEM	Sequence
					RPI primitive I	Irrelevant contrast	????0.22	?0.03	auccuUGAU sGGCAUACACUAUGCGCGaugaucugcaB
RPI primitive I	????18738	????0.13	?0.03	acacuuGAU sggcauGcacuaugcgcgauacuaacgcB
					RPI primitive I	????18739	????0.15	?0.01	cacgauGAU sggcauGcacuaugcgcgacucauacuaB
RPI primitive I	????18740	????0.15	?0.01	ggcuguGAU sggcauGcacuaugcgcgacgaCacucaB
					RPI primitive I	????18746	????0.10	?0.02	cccaauGAU sggcauGcacuaugcgcgacuacucggcB
RPI primitive I	????18747	????0.16	?0.02	uuucguGAU sggcauGcacuaugcgcggacccaacacB
					RPI primitive I	????18750	????0.15	?0.03	ucagguGAU sggcauGcacuaugcgcgaguaccacaaB
RPI primitive I	????18754	????0.12	?0.01	gcacuuGAU sggcauGcacuaugcgcggcaagcacccB
					RPI primitive II	????SAC	????1.10	?0.32	a su su sc scacUAGuGaggcguuagccGau?AcgcgaB
RPI primitive II	????20339	????0.85	?0.01	u sc sc su scaccUGAuGaggccguuaggccGaaIgggaguB
					RPI primitive II	????20350	????1.04	?0.05	g su sc sc suggcUGAuGaggccguuaggccGaaIgcugcaB
RPI primitive III	Irrelevant contrast	????1.28	?0.07	ggaaaggugugcaaCCGgaggaaacucCCUUCAAGGACAUCGUCCGGGacggcB
					RPI primitive III	????18704	????0.37	?0.07	uuccgcagaCGgaggaaacucCCUUCAAGGACGAAAGUCCGGGacuauggB
RPI primitive III	????18705	????0.42	?0.10	ccgcagaCGgaggaaacucCCUUCAAGGACGAAAGUCCGGGacuauggB
					RPI primitive III	????18700	????0.61	?0.16	cagguaguaCGgaggaaacucCCUUCAAGGACAUCGUCCGGGacaaggB

Primitive	The RPI numbering	????F luc/R luc	?SEM	Sequence
					RPI primitive III	????18701	????0.54	?0.10	gcacggucUaGgaggaaacucCCUUCAAGGACAUCGUCCGGGgagaccB
RPI primitive III	????18835	????0.54	?0.04	guguacucacGgaggaaacucCCUUCAAGGACAUCGUCCGGGgguuCB

Chemically modified is explained as follows: small letter=2 '-O-methyl runic (non-italic): 2 '-NH ₂U=2 '-C-allyl group G, A=ribose G, the As=thiophosphatephosphorothioate connects the I=ribose Trophicardyl that B=does not oppositely have base

Claims (50)

1. enzyme nucleic acid molecule, its specificity cutting is derived from the RNA of hepatitis C virus (HCV), wherein said enzyme nucleic acid molecule is arranged in tup type primitive, and the brachium conjunctivum of wherein said enzyme nucleic acid molecule comprises and defined any substrate sequence complementary sequence in table IV-VI and VIII.

2. enzyme nucleic acid molecule, its specificity cutting is derived from the RNA of hepatitis C virus (HCV), wherein said enzyme nucleic acid molecule is arranged in the hair clip type primitive, and the brachium conjunctivum of wherein said enzyme nucleic acid molecule comprises and defined any substrate sequence complementary sequence in the table VII.

3. the described enzyme nucleic acid molecule of claim 1, wherein said enzyme nucleic acid molecule comprises the stem II district of a length more than or equal to 2 base pairs.

4. claim 1 or 2 described enzyme nucleic acid molecule, wherein said nucleic acid comprise 12 to 100 with described RNA complementary base.

5. claim 1 or 2 described enzyme nucleic acid molecule, wherein said nucleic acid comprise 14 to 24 with described mRNA complementary base.

6. the described enzyme nucleic acid molecule of claim 2, wherein said enzyme nucleic acid molecule comprises the stem II district of a length between 3 to 7 base pairs.

7. the described enzyme nucleic acid molecule of claim 2, wherein said enzyme nucleic acid molecule are made up of defined any ribozyme sequence in the table VII basically.

8. the described enzyme nucleic acid molecule of claim 1, wherein said enzyme nucleic acid molecule are made up of defined any ribozyme sequence in table IV-VI and VIII basically.

9. pharmaceutical composition, it comprises claim 1 or 2 described enzyme nucleic acid molecule.

10. mammalian cell, it comprises any one described enzyme nucleic acid molecule in claim 1 or 2.

11. the described mammalian cell of claim 10, the cell that wherein said mammalian cell is behaved.

12. expression vector, it comprises at least a nucleotide sequence of coding claim 1 or 2 described enzyme nucleic acid molecule, and described enzyme nucleic acid molecule can be by this vector expression.

13. mammalian cell, it comprises the described expression vector of claim 12.

14. the described cell of claim 13, the cell that wherein said mammalian cell is behaved.

15. be used for the treatment of the method for liver cirrhosis, liver failure or hepatocellular carcinoma, it comprises the steps: be suitable under the condition of described treatment, bestows claim 1 or 2 described enzyme nucleic acid molecule to the patient.

16. be used for the treatment of the method for liver cirrhosis, liver failure and/or hepatocellular carcinoma, it comprises the steps: be suitable under the condition of described treatment, bestows claim 1 or 2 described expression vectors to the patient.

17. infect the method that the patient of correlation behavior treats to having HCV, it comprises that the cell with described patient contacts with claim 1 or 2 described nucleic acid molecule, and further comprises and be suitable under the condition of described treatment using one or more pharmacological agenies.

18. the described enzyme nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least 5 ribose residues, and wherein said nucleic acid molecule at least 3 places in 5 ' terminal nucleotide comprise that thiophosphatephosphorothioate connects, and wherein said nucleic acid molecule comprises 2 '-C-allyl group modification on its No. 4 positions, and wherein said nucleic acid comprises that at least 10 2 '-O-methyl modifies, and wherein said nucleic acid comprise one 3 '-end modified.

19. the described enzyme nucleic acid molecule of claim 18, wherein said nucleic acid comprises one 3 '-3 ' reverse abasic moiety that connects at described 3 '-end.

20. the described enzyme nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least 5 ribose residues, and wherein said nucleic acid molecule at least 3 places in 5 ' terminal nucleotide comprise that thiophosphatephosphorothioate connects, and wherein said nucleic acid molecule on its No. 4 positions and/or No. 7 positions, comprise one 2 '-amido modified, and wherein said nucleic acid comprises that at least 10 2 '-O-methyl modifies, and wherein said nucleic acid comprise one 3 '-end modified.

21. the described enzyme nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least 5 ribose residues, and wherein said nucleic acid molecule at least 3 places in 5 ' terminal nucleotide comprise that thiophosphatephosphorothioate connects, and wherein said nucleic acid molecule comprises the displacement of a no base on its No. 4 positions and/or No. 7 positions, and wherein said nucleic acid comprises that at least 10 2 '-O-methyl modifies, and wherein said nucleic acid comprise one 3 '-end modified.

22. the described enzyme nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least 5 ribose residues, and wherein said nucleic acid molecule at least 3 places in 5 ' terminal nucleotide comprise that thiophosphatephosphorothioate connects, and wherein said nucleic acid molecule is comprising a 6-methyluridine displacement on its No. 4 positions and/or on No. 7 positions, and wherein said nucleic acid comprises that at least 10 2 '-O-methyl modifies, and wherein said nucleic acid comprise one 3 '-end modified.

23. suppress the method that HCV duplicates in mammalian cell, it comprises the steps: be suitable under the condition of described inhibition, bestows the enzyme nucleic acid molecule of claim 1 or 2 to described cell.

24. cut a kind of method of independently RNA molecule, it is included under the condition that is suitable for cutting described independent RNA molecule the enzyme nucleic acid molecule of claim 1 or 2 is contacted with RNA molecule independently.

25. the described method of claim 24 is wherein carried out described cutting in the presence of a kind of divalent cation.

26. the described method of claim 25, wherein said divalent cation are Mg ²⁺

27. claim 1 or 2 described nucleic acid molecule wherein carry out chemosynthesis to described nucleic acid.

28. the described expression vector of claim 12, wherein said carrier comprises:

A) transcribe Qi Shiqu for one;

B) transcription termination region;

C) gene of an at least a described nucleic acid molecule of coding; And

Wherein described gene be may be operably coupled to described begin district and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.

29. the described expression vector of claim 12, wherein said carrier comprises:

A) transcribe Qi Shiqu for one;

B) transcription termination region;

C) open reading frame;

D) gene of an at least a described nucleic acid molecule of coding wherein may be operably coupled to 3 ' of described open reading frame-end with described gene; And

Wherein described gene be may be operably coupled to described beginning district, described open reading frame and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.

30. the described expression vector of claim 12, wherein said carrier comprises:

A) transcribe Qi Shiqu for one;

B) transcription termination region;

C) intron;

D) gene of an at least a described nucleic acid molecule of coding; And

Wherein described gene be may be operably coupled to described beginning district, described intron and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.

31. the described expression vector of claim 12, wherein said carrier comprises:

A) transcribe Qi Shiqu for one;

B) transcription termination region;

C) intron;

D) open reading frame;

E) gene of an at least a described nucleic acid molecule of coding wherein may be operably coupled to 3 ' of described open reading frame-end with described gene; And

Wherein described gene be may be operably coupled to described beginning district, described intron, described open reading frame and the described terminator of opening in a kind of mode that makes described nucleic acid molecule to express and/or to transmit.

32. the enzyme nucleic acid molecule, it cuts the RNA that is derived from hepatitis C virus (HCV) specifically, and wherein said enzyme nucleic acid molecule is the DNA enzyme.

33. any one described enzyme nucleic acid molecule in the claim 1,2 or 32, wherein said enzyme nucleic acid molecule comprise at least one 2 '-glycosyl modified.

34. any one described enzyme nucleic acid molecule in the claim 1,2 or 32, wherein said enzyme nucleic acid molecule comprise at least one nucleic acid base modification.

35. any one described enzyme nucleic acid molecule in the claim 1,2 or 32, wherein said enzyme nucleic acid molecule comprise at least one thiophosphatephosphorothioate modification.

36. the described method of claim 17, wherein said pharmacological agent are I type Interferon, rabbit.

37. the described method of claim 36 is wherein bestowed described I type Interferon, rabbit and enzyme nucleic acid molecule simultaneously.

38. the described method of claim 36 is wherein separately bestowed described I type Interferon, rabbit and enzyme nucleic acid molecule.

39. the described method of claim 36, wherein said I type Interferon, rabbit is an interferon-alpha.

40. the described method of claim 36, wherein said I type Interferon, rabbit is an interferon-.

41. the described method of claim 36, wherein said I type Interferon, rabbit is an IFN-.

42. the described method of claim 36, wherein said I type Interferon, rabbit is the common interference element.

43. treatment has the method that HCV infects the patient of correlation behavior, it comprises that the cell with described patient contacts with the described nucleic acid molecule of claim 32, and further comprises and be suitable for one or more pharmacological agenies of use under the condition of described treatment.

44. the described method of claim 43, wherein said pharmacological agent are I type Interferon, rabbit.

45. the described method of claim 44 is wherein bestowed described I type Interferon, rabbit and enzyme nucleic acid molecule simultaneously.

46. the described method of claim 44 is wherein separately bestowed described I type Interferon, rabbit and enzyme nucleic acid molecule.

47. the described method of claim 44, wherein said I type Interferon, rabbit is an interferon-alpha.

48. the described method of claim 44, wherein said I type Interferon, rabbit is an interferon-.

49. the described method of claim 44, wherein said I type Interferon, rabbit is an IFN-.

50. the described method of claim 44, wherein said I type Interferon, rabbit is the common interference element.

Images