CA2326695A1 - Enzymatic nucleic acid treatment of diseases or conditions related to hepatitis c virus infection - Google Patents

Abstract

Enzymatic nucleic acid molecules which modulate the expression and/or replication of hepatitis C.

Description

DESCRIPTION
Enzymatic Nucleic Acid Treatment Of Diseases Or Conditions Related To Hepatitis C Virus Infection This patent application claims priority to Blatt et al., USSN (Not Yet Assigned), filed February 24, 1999, Blatt et al., USSN 60/100,842, filed September 18, 1998, and McSwiggen et al., USSN 60/083,217 filed April 27, 1998, all of these earlier applications are entitled "ENZYMATIC NUCLEIC ACID TREATMENT OF DISEASES OR
CONDITIONS RELATED TO HEPATITIS C VIRUS INFECTION". Each of these applications are hereby incorporated by reference herein in their entirety including the drawings.
Backa~round Of The Invention This invention relates to methods and reagents for the treatment of diseases or conditions relating to the hepatitic C virus infection.
The following is a discussion of relevant art, none of which is admitted to be prior art to the present invention.
In 1989, the HCV was determined to be an RNA virus and was identified as the causative agent of most non-A non-B viral Hepatitis (Choo et al., Science.
1989; 244:359-362). Unlike retroviruses such as HIV, HCV does not go though a DNA
replication phase and no integrated forms of the viral genome into the host chromosome have been detected 2 0 (Houghton et al., Hepatology 1991;14:381-388). Rather, replication of the coding (plus) strand is mediated by the production of a replicative (minus) strand leading to the generation of several copies of plus strand HCV RNA. The genome consists of a single, large, open-reading frame that is translated into a polyprotein (Kato et al., FEBS Letters.
1991; 280: 325-328). This polyprotein subsequently undergoes post-translational cleavage, 2 5 producing several viral proteins (Leinbach et al., Virology. 1994: 204:163-169).
Examination of the 9.5-kilobase genome of HCV has demonstrated that the viral nucleic acid can mutate at a high rate (Smith et al.,Mol. Evol. 1997 45:238-246). This rate of mutation has led to the evolution of several distinct genotypes of HCV that share approximately 70% sequence identity (Simmonds et al., J. Gen. Virol. 1994;75 :1053-1061}.

3 0 It is important to note that these sequences are evolutionarily quite distant. For example, the genetic identity between humans and primates such as the chimpanzee is approximately 98%. In addition, it has been demonstrated that an HCV infection in an individual patient is composed of several distinct and evolving quasispecies that have 98%

identity at the RNA level. Thus, the HCV genome is hypervariable and continuously changing. Although the HCV genome is hypervariable, there are 3 regions of the genome that are highly conserved. These conserved sequences occur in the 5' and 3' non-coding regions as well as the 5'-end of the core protein coding region and are thought to be vital for HCV RNA replication as well as translation of the HCV polyprotein. Thus, therapeutic agents that target these conserved HCV genomic regions may have a significant impact over a wide range of HCV genotypes. Moreover, it is unlikely that drug resistance will occur with ribozymes specific to conserved regions of the HCV
genome.
In contrast, therapeutic modalities that target inhibition of enzymes such as the viral proteases or helicase are likely to result in the selection for drug resistant strains since the RNA for these viral encoded enzymes is located in the hypervariable portion of the HCV
genome.
After initial exposure to HCV, the patient will experience a transient rise in liver enzymes, which indicates that inflammatory processes are occurring (Alter et al., IN:
Seeff LB, Lewis JH, eds. Current Perspectives in Hepatology. New York: Plenum Medical Book Co; 1989:83-89). This elevation in liver enzymes will occur at least 4 weeks after the initial exposure and may last for up to two months (Farci et al., New England Journal of Medicine. 1991:325:98-104). Prior to the rise in liver enzymes, it is possible to detect HCV
RNA in the patient's serum using RT-PCR analysis (Takahashi et al., American Journal of 2 0 Gastroenterology. 1993:88:2:240-243). This stage of the disease is called the acute stage and usually goes undetected since 75% of patients with acute viral hepatitis from HCV
infection are asymptomatic. The remaining 25% of these patients develop jaundice or other symptoms of hepatitis.
Acute HCV infection is a benign disease, however, and as many as 80% of acute 2 5 HCV patients progress to chronic liver disease as evidenced by persistent elevation of serum alanine aminotransferase (ALT) levels and by continual presence of circulating HCV RNA (Sherlock, Lancet 1992; 339:802). The natural progression of chronic HCV
infection over a 10 to 20 year period leads to cirrhosis in 20to50% of patients (Davis et al., Infectious Agents and Disease 1993;2:150:154) and progression of HCV infection to 3 0 hepatocellular carcinoma has been well documented (Liang et al., Hepatology. 1993;
18:1326-1333; Tong et al., Western Journal of Medicine, 1994; Vol. I60, No. 2:
133-138).
There have been no studies that have determined sub-populations that are most likely to progress to cirrhosis and/or hepatocellular carcinoma, thus all patients have equal risk of progression.
3 5 It is important to note that the survival fox patients diagnosed with hepatocellular carcinoma is only 0.9 to 12.8 months from initial diagnosis (Takahashi et al., American Journal of Gastroenterology. 1993:88:2:240-243). Treatment of hepatocellular carcinoma with chemotherapeutic agents has not proven effective and only 10% of patients will benefit from surgery due to extensive tumor invasion of the liver (Trinchet et al., Presse Medicine. 1994:23:831-833). Given the aggressive nature of primary hepatocellular carcinoma, the only viable treatment alternative to surgery is liver transplantation (Pichlmayr et al., Hepatology. 1994:20:33S-40S).
Upon progression to cirrhosis, patients with chronic HCV infection present with clinical features, which are common to clinical cirrhosis regardless of the initial cause (D'Amico et al., Digestive Diseases and Sciences. 1986;31:5: 468-475). These clinical features may include: bleeding esophageal varices, ascites, jaundice, and encephalopathy (Zakim D, Boyer TD. Hepatology a textbook of liver disease. Second Edition Volume I. 1990 W.B. Saunders Company. Philadelphia). In the early stages of cirrhosis, patients are classified as compensated meaning that although liver tissue damage has occurred, the patient's liver is still able to detoxify metabolites in the blood-stream. In addition, most patients with compensated liver disease are asymptomatic and the minority with symptoms report only minor symptoms such as dyspepsia and weakness. In the later stages of cirrhosis, patients are classified as decompensated meaning that their ability to detoxify metabolites in the bloodstream is diminished and it is at this stage that the clinical features described above will present.
2 0 In 1986, D'Amico et al. described the clinical manifestations and survival rates in 1155 patients with both alcoholic and viral associated cirrhosis (D'Amico supra). Of the 1155 patients, 435 (37%) had compensated disease although 70% were asymptomatic at the beginning of the study. The remaining 720 patients (63%) had decompensated liver disease with 78% presenting with a history of ascites, 31% with jaundice, 17%
had 2 5 bleeding and 16% had encephalopathy. Hepatocellular carcinoma was observed in six (.5%) patients with compensated disease and in 30 (2.6%) patients with decompensated disease.
Over the course of six years, the patients with compensated cirrhosis developed clinical features of decompensated disease at a rate of 10% per year. In most cases, ascites 3 0 was the first presentation of decompensation. In addition, hepatocellular carcinoma developed in 59 patients who initially presented with compensated disease by the end of the six-year study.
With respect to survival, the D'Amico study indicated that the five-year survival rate for all patients on the study was only 40%. The six-year survival rate for the patients 35 who initially had compensated cirrhosis was 54% while the six-year survival rate for patients who initially presented with decompensated disease was only 21%.
There were no significant differences in the survival rates between the patients who had.
alcoholic cirrhosis and the patients with viral related cirrhosis. The major causes of death for the patients in the D'Amico study were liver failure in 49%; hepatocellular carcinoma in 22%;
and, bleeding in 13% (D'Amico supra).
Chronic Hepatitis C is a slowly progressing inflammatory disease of the liver, mediated by a virus (HCV) that can lead to cirrhosis, liver failure andlor hepatocellular carcinoma over a period of 10 to 20 years. In the US, it is estimated that infection with HCV accounts for 50,000 new cases of acute hepatitis in the United States each year (NIH
Consensus Development Conference Statement on Management of Hepatitis C March 1997). The prevalence of HCV in the United States is estimated at 1.8% and the CDC
places the number of chronically infected Americans at approximately 4.5 million people.
The CDC also estimates that up to 10,000 deaths per year are caused by chronic HCV
infection. The prevalence of HCV in the United States is estimated at 1.8% and the CDC
places the number of chronically infected Americans at approximately 4.5 million people.
The CDC also estimates that up to 10,000 deaths per year are caused by chronic HCV
infection.
Numerous well controlled clinical trials using interferon (IFN-alpha) in the treatment of chronic HCV infection have demonstrated that treatment three times a week results in lowering of serum ALT values in approximately SO% (range 40% to 70%) of 2 0 patients by the end of 6 months of therapy (Davis et al., New England Journal of Medicine 1989; 321:1501-1506; Marcellin et al., Hepatology. 1991; 13:393-397; Tong et al., Hepatology 1997:26:747-754; Tong et al., Hepatology 1997 26(6): 1640-1645). However, following cessation of interferon treatment, approximately SO% of the responding patients relapsed, resulting in a "durable" response rate as assessed by normalization of serum ALT
2 5 concentrations of approximately 20 to 25%.
In recent years, direct measurement of the HCV RNA has become possible through use of either the branched-DNA or Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) analysis. In general, the RT-PCR methodology is more sensitive and leads to more accurate assessment of the clinical course (Tong et al., supra). Studies that have 30 examined six months of type 1 interferon therapy using changes in HCV RNA
values as a clinical endpoint have demonstrated that up to 35% of patients will have a loss of HCV
RNA by the end of therapy (Marcellin et al., supra). However, as with the ALT
endpoint, about SO% of the patients relapse six months following cessation of therapy resulting in a durable virologic response of only 12% (Marcellin er al., supra). Studies that have 3 5 examined 48 weeks of therapy have demonstrated that the sustained virological response is up to 25% (1~1IH consensus statement: 1997). Thus, standard of care for treatment of chronic HCV infection with type 1 interferon is now 48 weeks of therapy using changes in HCV RNA concentrations as the primary assessment of efficacy (Hoofnagle et al., New England Journal of Medicine 1997; 336(5) 347-356).
Side effects resulting from treatment with type 1 interferons can be divided into 5 four general categories, which include 1. Influenza-like symptoms; 2.
Neuropsychiatric; 3.
Laboratory abnormalities; and, 4. Miscellaneous (Dusheiko et al., Journal of Viral Hepatitis.
1994:1:3-5}. Examples of influenza-like symptoms include; fatigue, fever;
myalgia;
malaise; appetite loss; tachycardia; rigors; headache and arthralgias. The influenza-like symptoms are usually short-lived and tend to abate after the first four weeks of dosing (Dushieko et al., supra). Neuropsychiatric side effects include: irritability, apathy; mood changes; insomnia; cognitive changes and depression. The most important of these neuropsychiatric side effects is depression and patients who have a history of depression should not be given type 1 interferon. Laboratory abnormalities include;
reduction in myeloid cells including granulocytes, platelets and to a lesser extent red blood cells.
These changes in blood cell counts rarely lead to any significant clinical sequellae (Dushieko et al., supra). In addition, increases in triglyceride concentrations and elevations in serum alanine and aspartate aminotransferase concentration have been observed. Finally, thyroid abnormalities have been reported. These thyroid abnormalities are usually reversible after cessation of interferon therapy and can be controlled with 2 0 appropriate medication while on therapy. Miscellaneous side effects include nausea;
diarrhea; abdominal and back pain; pruritus; alopecia; and rhinorrhea. In general, most side effects will abate after 4 to 8 weeks of therapy (Dushieko et al., supra).
Welch et al., Gene Therapy 1996 3(11): 994-1001 describe in vitro an in vivo studies with two vector expressed hairpin ribozymes targeted against hepatitis C virus.
Sakamoto et al., J. Clinical Investigation 1996 98(12):2720-2728 describe intracellular cleavage of hepatitis C virus RNA and inhibition of viral protein translation by certain vector expressed hammerhead ribozymes.
Lieber et al., J. Virology 1996 70{12):8782-8791 describe elimination of hepatitis C virus RNA in infected human hepatocytes by adenovirus-mediated expression of certain 3 0 hammerhead ribozymes.
Ohkawa et al., 1997, J. Hepatology, 27; 78-84, describe in vitro cleavage of HCV
RNA and inhibition of viral protein translation using certain in vitro transcribed hammerhead ribozymes.
Barber et al., International PCT Publication No. WO 97/32018, describe the use of 3 5 an adenovirus vector to express certain anti-hepatitis C virus hairpin ribozymes.

Kay et al., International PCT Publication No. WD 96/18419, describe certain recombinant adenovirus vectors to express anti-HCV hammerhead ribozyme.
Yamada et al., Japanese Patent Application No. JP 07231784 describe a specific poly-(L)-lysine conjugated hammerhead ribozyme targeted against HCV.
Draper, U.S. Patent No. 5,610,054, descibes enzymatic nucleic acid molecule capable of inhibiting replication of HCV.
Alt et al., Hepatology 1995 22(3): 707-717, describe specific inhibition of hepatitis C viral gene expression by certain antisense phosphorothioate oligodeoxynucleotides.
Summary Of The Invention This invention relates to ribozymes, or enzymatic nucleic acid molecules, directed to cleave RNA species of hepatitis C virus (HCV) and/or encoded by the HCV. In particular, applicant describes the selection and function of ribozymes capable of specifically cleaving HCV RNA. Such ribozymes may be used to treat diseases associated with HCV infection.
Due to the high sequence variability of the HCV genome, selection of ribozymes for broad therapeutic applications would likely involve the conserved regions of the HCV genome. Specifically, the present invention describes hammerhead ribozymes that would cleave in the conserved regions of the HCV genome. A list of the thirty hammerhead ribozymes derived from the conserved regions (5'- Non Coding Region 2 0 (NCR), 5'- end of core protein coding region, and 3'- NCR) of the HCV
genome is shown in Table IV . In general, Applicant has found that enzymatic nucleic acid molecules that cleave sites located in the 5' end of the HCV genome would block translation while ribozymes that cleave sites located in the 3' end of the genome would block RNA replication. Approximately 50 HCV isolates have been identified and a sequence alignment of these isolates from genotypes la, lb, , 2a, 2b, 2c, 3a, 3b, 4a, 5a, and 6 was performed. These alignments were used by the Applicant to identify hammerhead ribozymes sites within regions highly conserved between genotypes.
Twenty three ribozyme sites were identified in regions of greatest homology within the conserved region.. Therefore, one ribozyme can be designed to cleave all the different isolates of HCV. According to the Applicant, ribozymes designed against conserved regions of various HCV isolates will enable efficient inhibition of HCV
replication in diverse patient populations and may ensure the effectiveness of the ribozymes against HCV quasispecies which evolve due to mutations in the non-conserved regions of the HCV genome.

By "inhibit" is meant that the activity of HCV or level of RNAs encoded by HCV
genome is reduced below that observed in the absence of the nucleic acid, particularly, inhibition with ribozymes preferably is below that level observed in the presence of an inactive RNA molecule able to bind to the same site on the mRNA, but unable to cleave that RNA.
By "enzymatic nucleic acid" it is meant a nucleic acid molecule capable of catalyzing reactions including, but not limited to, site-specific cleavage and/or ligation of other nucleic acid molecules, cleavage of peptide and amide bonds, and traps-splicing.
Such a molecule with endonuclease activity may have complementarity in a substrate binding region to a specified gene target, and also has an enzymatic activity that specifically cleaves RNA or DNA in that target. That is, the nucleic acid molecule with endonuclease activity is able to intramolecularly or intermolecularly cleave RNA or DNA
and thereby inactivate a target RNA or DNA molecule. This complementarity functions to allow suffcient hybridization of the enzymatic RNA molecule to the target RNA
or DNA
to allow the cleavage to occur. 100% complementarity is preferred, but complementarity as low as 50-75% may also be useful in this invention. The nucleic acids may be modified at the base, sugar, and/or phosphate groups. The term enzymatic nucleic acid is used interchangeably with phrases such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, catalytic oligonucleotides, nucleozyme, DNAzyme, RNA enzyme, 2 0 endoribonuclease, endonuclease, minizyme, leadzyme, oligozyme or DNA
enzyme. All of these terminologies describe nucleic acid molecules with enzymatic activity.
The specific enzymatic nucleic acid molecules described in the instant application are not limiting in the invention and those skilled in the art will recognize that all that is important in an enzymatic nucleic acid molecule of this invention is that it has a specific substrate binding 2 5 site which is complementary to one or more of the target nucleic acid regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart a nucleic acid cleaving activity to the molecule.
By "enzymatic portion" or "catalytic domain" is meant that portion/region of the ribozyme essential for cleavage of a nucleic acid substrate (for example see Figure 1 ).
3 0 By "substrate binding arm" or "substrate binding domain" is meant that portion/region of a ribozyme which is complementary to (i.e., able to base-pair with) a portion of its substrate. Generally, such complementarity is I00%, but can be less if desired. For example, as few as 10 bases out of 14 may be base-paired. Such arms are shown generally in Figure 1 and 3. That is, these arms contain sequences within a 3 5 ribozyme which are intended to bring ribozyme and target RNA together through complementary base-pairing interactions. The ribozyme of the invention may have binding arms that are contiguous or non-contiguous and may be of varying lengths. The length of the binding arms) are preferably greater than or equal to four nucleotides;
specifically 12-100 nucleotides; more specifically 14-24 nucleotides long. If two binding arms are chosen, the design is such that the length of the binding arms are symmetrical (i. e., each of the binding arms is of the same length; e.g., five and five nucleotides, six and six nucleotides or seven and seven nucleotides long) or asymmetrical (i. e., the binding arms are of different length; e.g., six and three nucleotides; three and six nucleotides long; four and five nucleotides long; four and six nucleotides long; four and seven nucleotides long;
and the like).
In one of the preferred embodiments of the inventions herein, the enzymatic nucleic acid molecule is formed in a hammerhead or hairpin motif, but may also be formed in the motif of a hepatitis d virus, group I intron, group II intron or RNaseP RNA
(in association with an RNA guide sequence) or Neurospora VS RNA. Examples of such hammerhead motifs are described by Dreyfus, supra, Rossi et al. , 1992, AIDS
Research and Human Retroviruses 8, 183; of hairpin motifs by Hampel et al., EP0360257, Hampel and Tritz, 1989 Biochemistry 28, 4929, Feldstein et al., 1989, Gene 82, 53, Haseloff and Gerlach, 1989, Gene, 82, 43, and Hampel et al., 1990 Nucleic Acids Res. 18, 299; of the hepatitis d virus motif is described by Perrotta and Been, 1992 Biochemistry 31, 16; of the RNaseP motif by Guerrier-Takada et al., 1983 Cell 35, 849; Forster and Altman, 1990, 2 0 Science 249, 783; Li and Altman, 1996, Nucleic Acids Res. 24, 835;
Neurospora VS RNA
ribozyme motif is described by Collies (Saville and Collies, 1990 Cell 61, 685-696;
Saville and Collies, 1991 Proc. Natl. Acad. Sci. USA 88, 8826-8830; Collies and Olive, 1993 Biochemistry 32, 2795-2799; Guo and Collies, 1995, EMBO. J. 14, 363);
Group II
introns are described by Griffin et al., 1995, Chem. Biol. 2, 761; Michels and Pyle, 1995, 2 5 Biochemistry 34, 2965; Pyle et al., International PCT Publication No. WO
96/22689; of the Group I intron by Cech et al., U.S. Patent 4,987,071; and of DNAzyme motif by Chartrand et al., 1995, Nucleic Acids Research 23, 4092; Santoro et al., 1997, PNAS 94, 4262. These specific motifs are not limiting in the invention and those skilled in the art will recognize that all that is important in an enzymatic nucleic acid molecule of this 3 0 invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.
By "equivalent" RNA to HCV is meant to include those naturally occurring RNA
35 molecules associated with HCV infection in various animals, including human, rodent, primate, rabbit and pig. The equivalent RNA sequence also includes in addition to the coding region, regions such as 5'-untranslated region, 3'-untranslated region, introns, intron-exon junction and the like.
By "complementarity" is meant a nucleic acid that can form hydrogen bonds) with another RNA sequence by either traditional Watson-Crick or other non-traditional types (for example, Hoogsteen type) of base-paired interactions.
In a preferred embodiment the invention provides a method for producing a class of enzymatic cleaving agents which exhibit a high degree of specificity for the RNA of a desired target. The enzymatic nucleic acid molecule is preferably targeted to a highly conserved sequence region of a target mRNAs encoding HCV proteins such that specific treatment of a disease or condition can be provided with either one or several enzymatic nucleic acids. Such enzymatic nucleic acid molecules can be delivered exogenously to specific cells as required. Alternatively, the ribozymes can be expressed from DNA/RNA
vectors that are delivered to specific cells.
Such ribozymes are useful for the prevention of the diseases and conditions discussed above, and any other diseases or conditions that are related to the levels of HCV
activity in a cell or tissue.
By "related" is meant that the inhibition of HCV RNAs and thus reduction in the level respective viral activity will relieve to some extent the symptoms of the disease or condition.
2 0 In preferred embodiments, the ribozymes have binding arms which are complementary to the target sequences in Tables IV-IX. Examples of such ribozymes are also shown in Tables IV-IX. Examples of such ribozymes consist essentially of sequences defined in these Tables. Other sequences may be present which do not interfere with such cleavage.
2 5 By "consists essentially of is meant that the active ribozyme contains an enzymatic center or core equivalent to those in the examples, and binding arms able to bind mRNA such that cleavage at the target site occurs. Other sequences may be present which do not interfere with such cleavage.
Thus, in a first aspect, the invention features ribozymes that inhibit gene 3 0 expression and/or viral replication. These chemically or enzymatically synthesized RNA
molecules contain substrate binding domains that bind to accessible regions of their target mRNAs. The RNA molecules also contain domains that catalyze the cleavage of RNA.
The RNA molecules are preferably ribozymes of the hammerhead or hairpin motif.
Upon binding, the ribozymes cleave the target mRNAs, preventing translation and protein 3 5 accumulation. In the absence of the expression of the target gene, HCV
gene expression and/or replication is inhibited.

In a preferred embodiment, ribozymes are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells. The nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their 5 incorporation in biopolymers. In another preferred embodiment, the ribozyme is administered to the site of HCV activity (e.g., hepatocytes) in an appropriate liposomal vehicle.
In another aspect of the invention, ribozymes that cleave target molecules and inhibit HCV activity are expressed from transcription units inserted into DNA
or RNA

10 vectors. The recombinant vectors are preferably DNA plasmids or viral vectors. Ribozyme expressing viral vectors could be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. Preferably, the recombinant vectors capable of expressing the ribozymes are delivered as described above, and persist in target cells. Alternatively, viral vectors may be used that provide for transient expression of ribozymes. Such vectors might be repeatedly administered as necessary. Once expressed, the ribozymes cleave the target mRNA. Delivery of ribozyme expressing vectors could be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that would allow for introduction into the desired target cell (for a review 2 0 see Couture and Stinchcomb, 1996, TIG., 12, 510). In another aspect of the invention, ribozymes that cleave target molecules and inhibit viral replication are expressed from transcription units inserted into DNA, RNA, or viral vectors. Preferably, the recombinant vectors capable of expressing the ribozymes are locally delivered as described above, and transiently persist in smooth muscle cells. However, other mammalian cell vectors that 2 5 direct the expression of RNA may be used for this purpose.
By "patient" is meant an organism which is a donor or recipient of explanted cells or the cells themselves. "Patient" also refers to an organism to which enzymatic nucleic acid molecules can be administered. Preferably, a patient is a mammal or mammalian cells. More preferably, a patient is a human or human cells.
3 0 By "vectors" is meant any nucleic acid- and/or viral-based technique used to deliver a desired nucleic acid.
These ribozymes, individually, or in combination or in conjunction with other drugs, can be used to treat diseases or conditions discussed above. For example, to treat a disease or condition associated with HCV levels, the patient may be treated, or other 3 5 appropriate cells may be treated, as is evident to those skilled in the art.

Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
Description Of The Preferred Embodiments The drawings will first briefly be described.
Drawings:
Figure 1 shows the secondary structure model for seven different classes of enzymatic nucleic acid molecules. Arrow indicates the site of cleavage. --------- indicate the target sequence. Lines interspersed with dots are meant to indicate tertiary interactions.
- is meant to indicate base-paired interaction. Group I Intron: P1-P9.0 represent various stem-loop structures (Cech et aL, 1994, Nature Struc. Bio., 1, 273). RNase P
(M1RNA):
EGS represents external guide sequence (Forster et al., 1990, Science, 249, 783; Pace et al., 1990, J. Biol. Chem., 265, 3587). Group II Intron: 5'SS means 5' splice site; 3'SS
means 3'-splice site; IBS means intron binding site; EBS means exon binding site (Pyle et al., 1994, Biochemistry, 33, 2716). VS RNA: I-VI are meant to indicate six stem-loop structures; shaded regions are meant to indicate tertiary interaction (Collies, International PCT Publication No. WO 96/19577). HDV Ribozyme: : I-IV are meant to indicate four stem-loop structures (Been et al., US Patent No. 5,625,047). Hammerhead Ribozyme:
I-III are meant to indicate three stem-loop structures; stems I-III can be of any length and may be symmetrical or asymmetrical (IJsman et al., 1996, Curr. Op. Struct.
Bio., 1, 527).
Hairpin Ribozyme: Helix 1, 4 and 5 can be of any length; Helix 2 is between 3 and 8 base-pairs long; Y is a pyrimidine; Helix 2 (H2) is provided with a least 4 base pairs (i.e., n is 1, 2, 3 or 4) and helix 5 can be optionally provided of length 2 or more bases (preferably 3 - 20 bases, i. e., m is from 1 - 20 or more). Helix 2 and helix S may be covalently linked by one or more bases (i.e., r is 1 base). Helix 1, 4 or 5 may also be extended by 2 or more base pairs (e.g., 4 - 20 base pairs) to stabilize the ribozyme structure, and preferably is a protein binding site. In each instance, each N
and N' independently is any normal or modified base and each dash represents a potential base-pairing interaction. These nucleotides may be modified at the sugar, base or phosphate.
Complete base-pairing is not required in the helices, but is preferred. Helix 1 and 4 can be 3 0 of any size (i. e., o and p is each independently from 0 to any number, e.g., 20) as long as some base-pairing is maintained. Essential bases are shown as specific bases in the structure, but those in the art will recognize that one or more may be modified chemically (abasic, base, sugar and/or phosphate modifications) or replaced with another base without significant effect. Helix 4 can be fonmed from two separate molecules, i.e., without a connecting loop. The connecting loop when present may be a ribonucleotide with or without modifications to its base, sugar or phosphate. "q" is 2 bases. The connecting loop can also be replaced with a non-nucleotide linker molecule. H refers to bases A, U, or C. Y refers to pyrimidine bases. " " refers to a covalent bond. (Burke et al., 1996, Nucleic Acids & Mol. Biol., 10, 129; Chowrira et al., US Patent No.
5,631,359).
Figure 2 is a graph displaying the ability of ribozymes targeting various sites within the conserved S' HCV UTR region to cleave the transcripts made from several genotypes.
Figure 3 is a schematic representation of the Dual Reporter System utilized to demonstrate ribozyme mediated reduction of luciferase activity in cell culture.
Figure 4 is a graph demonstrating the ability of ribozymes to reduce luciferase activity in OST-7 cells.
Figure 5 is a graph demonstrating the ability of ribozymes targeting sites HCV.S-313 and HCV.S-318, to reduce luciferase activity in OST-7 cells compared to their inactive controls.
Figure 6A is a bar graph demonstrating the effect of ribozyme treatment on HCV-Polio virus (PV) replication. HeLa cells in 96-well plates were infected with HCV-PV at a multiplicity of infection (MOI) of 0.1. Virus inoculum was then replaced with media containing 5% serum and ribozyme or control (200nM), as indicated, complexed to a 2 0 cationic lipid. After 24 hour cells were lysed 3 times by freeze/thaw and virus was quantified by plaque assay. Scrambled control (SAC), binding control (BAC), 3 P=S
ribozymes, and 4 P=S ribozymes are indicated. Plaque forming units (pfu)/ml are shown as the mean of triplicate samples + standard deviation (S.D.).
Figure 6B is a bar graph demonstrating the effect of ribozyme treatment on wild 2 5 type PV replication. HeLa cells in 96-well plates were infected with wild type PV at an MOI = 0.05 for 30 minutes. All ribozymes contained 4P=S in (B). Plaque forming units (pfu)/ml are shown as the mean of triplicate samples + standard deviation (S.D.).
Figure 7 is a schematic representation of various hammerhead ribozyme constructs targeted against HCV RNA.
3 0 Figure 8 is a graph demonstrating the effect of site 183 ribozyme treatment on a single round of HCV-PV infection. HeLa cells were infected with HCV-PV at an MOI = 5 for 30 minutes prior to treatment with ribozymes or control. Cells were lysed after 6, 7, or 8 hours and virus was quantified by plaque assay. Ribozyme binding arm/stem II
formats (7/4, 7/3, 6/4, 6/3) and scrambled control (SAC, 7/4 format) are indicated.
All contasned 3 5 4P=S stabilization. Results in pfulml are shown as the median of duplicate samples +
range.

Figure 9 shows the secondary structure models of three ribozyme motifs described in this application.
Figure 10 shows the activity of anti-HCV ribozymes in combination with Interferon. Results in pfu/ml are shown as the median of duplicate samples ~
range. BAC, binding attenuated control molecule; IF, interferon; Rz, hammerhead ribozyme targeted to HCV site 183; pfu, plaque forming unit.
Ribozyes Seven basic varieties of naturally-occurring enzymatic RNAs are known presently.
In addition, several in vitro selection (evolution) strategies (Orgel, 1979, Proc. R. Soc.
London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing cleavage and ligation of phosphodiester linkages (Joyce, 1989, Gene, 82, 83-87;
Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97;
Breaker et al., 1994, TIBTECH 12, 268; Bartel et al.,1993, Science 261:1411-1418;
Szostak, 1993, TIBS 17, 89-93; Kumar et al., 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 7, 442; Santoro et al., 1997, Proc. Natl. Acad. Sci., 94, 4262; Tang et al., 1997, RNA 3, 914; Nakamaye & Eckstein, 1994, supra; Long &Uhlenbeck, 1994, supra; Ishizaka et al., 1995, supra; Vaish et al., 1997, Biochemistry 36, 6495; all of these are incorporated by reference herein). Each can catalyze a series of reactions including the hydrolysis of phosphodiester bonds in traps (and thus can cleave other RNA
molecules) 2 0 under physiological conditions. Table I summarizes some of the characteristics of some of these ribozymes. In general, enzymatic nucleic acids act by first binding to a target RNA.
Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target 2 5 RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA
will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
30 The enzymatic nature of a ribozyme is advantageous over other technologies, since the concentration of ribozyme necessary to affect a therapeutic treatment is lower. This advantage reflects the ability of the ribozyme to act enzymatically. Thus, a single ribozyme molecule is able to cleave many molecules of target RNA. In addition, the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not 3 5 only on the base-pairing mechanism of binding to the target RNA, but also on the mechanism of target RNA cleavage. Single mismatches, or base-substitutions, near the site of cleavage can be chosen to completely eliminate catalytic activity of a ribozyme.
Nucleic acid molecules having an endonuclease enzymatic activity are able to repeatedly cleave other separate RNA molecules in a nucleotide base sequence-specific manner. Such enzymatic nucleic acid molecules can be targeted to virtually any RNA
transcript, and efficient cleavage achieved in vitro (Zaug et al., 324, Nature 429 1986 ;
Uhlenbeck, 1987 Nature 328, 596; Kim et al., 84 Proc. Natl. Acad. Sci. USA
8788, 1987;
Dreyfus, 1988, Einstein Quart. J. Bio. Med., 6, 92; Haseloff and Gerlach, 334 Nature 585, 1988; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371, 1989; Chartrand et al., 1995, Nucleic Acids Research 23, 4092; Santoro et al., 1997, PNAS
94, 4262).
Because of their sequence-specificity, traps-cleaving ribozymes show promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med.
Chem.
30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037).
Ribozymes can be designed to cleave specific RNA targets within the background of cellular RNA.
Such a cleavage event renders the RNA non-functional and abrogates protein expression from that RNA. In this rnanner, synthesis of a protein associated with a disease state can be selectively inhibited.
Ribozymes that cleave the specified sites in HCV RNAs represent a novel 2 0 therapeutic approach to infection by the hepatitis C virus. Applicant indicates that ribozymes are able to inhibit the activity of HCV and that the catalytic activity of the ribozymes is required for their inhibitory effect. Those of ordinary skill in the art will find that it is clear from the examples described that other ribozymes that cleave HCV RNAs may be readily designed and are within the invention.
2 5 Tar eg t sites Targets for useful ribozymes can be determined as disclosed in Draper et al., WO
93/23569; Sullivan et al., WO 93/23057; Thompson et al., WO 94/02595; Draper et al., WO 95/04818; McSwiggen et al., US Patent No. 5,525,468 and hereby incorporated by reference herein in totality. Rather than repeat the guidance provided in those documents 3 0 here, below are provided specific examples of such methods, not limiting to those in the art. Ribozyrnes to such targets are designed as described in those applications and synthesized to be tested in vitro and in vivo, as also described. Such ribozymes can also be optimized and delivered as described therein.
The sequence of HCV RNAs were screened for optimal ribozyme target sites using 35 a computer folding algorithm. Hammerhead or hairpin ribozyme cleavage sites were identified. These sites are shown in Tables IV-VIII (All sequences are S' to 3' in the tables). The nucleotide base position is noted in the Tables as that site to be cleaved by the designated type of ribozyme. The nucleotide base position is noted in the Tables as that site to be cleaved by the designated type of ribozyme.
5 Because HCV RNAs are highly homologous in certain regions, some ribozyme target sites are also homologous (see Table IV and VIII). In this case, a single ribozyme will target different classes of HCV RNA. The advantage of one ribozyme that targets several classes of HCV RNA is clear, especially in cases where one or more of these RNAs may contribute to the disease state.
10 Hammerhead or hairpin ribozymes were designed that could bind and were individually analyzed by computer folding (Jaeger et al., 1989 Proc. Natl.
Acad. Sci. USA, 86, 7706) to assess whether the ribozyme sequences fold into the appropriate secondary structure. Those ribozymes with unfavorable intramolecular interactions between the binding arms and the catalytic core are eliminated from consideration. Varying binding 15 arm lengths can be chosen to optimize activity. Generally, at least 5 bases on each arm are able to bind to, or otherwise interact with, the target RNA. Ribozymes of the hammerhead or hairpin motif were designed to anneal to various sites in the mRNA message.
The binding arms are complementary to the target site sequences described above.
Riboz~rme Synthesis 2 0 Synthesis of nucleic acids greater than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive.
In this invention, small nucleic acid motifs (e.g., hammerhead or the hairpin ribozymes) are used for exogenous delivery. The simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of the mRNA structure. However, these 2 5 nucleic acid molecules can also be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, 1985 Science 229, 345; McGarry and Lindquist, 1986 Proc.
Natl.
Acad. Sci. USA 83, 399; SullengerScanlon et al., 1991, Proc. Natl. Acad. Sci.
USA, 88, 10591-5; Kashani-Sabet et al., 1992 Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992 J.
Virol, 66, 1432-41; Weerasinghe et al., 1991 J. Virol, 65, 5531-4; Ojwang et al., 1992 30 Proc. Natl. Acad. Sci. USA 89, 10802-6; Chen et al., 1992 Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990 Science 247, 1222-1225; Thompson et al., 1995 Nucleic Acids Res.
23, 2259). Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a ribozyme (Draper 3 5 et al., PCT W093/23569, and Sullivan et al., PCT W094/02595, both hereby incorporated in their totality by reference herein; Ohkawa et al., 1992 Nucleic Acids Symp.
Ser., 27, 15-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993 Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994 J. Biol. Chem. 269, 25856).
The ribozymes in the examples were chemically synthesized. The method of synthesis used follows the procedure for normal RNA synthesis as described in Usman et al., 1987 J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990 Nucleic Acids Res., 18, 5433; and Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684 and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the S
end, and phosphoramidites at the 3'-end. Small scale synthesis were conducted on a 394 Applied Biosystems, Inc. synthesizer using a modified 2.5 ~tmol scale protocol with a 5 min coupling step for alkylsilyl protected nucleotides and 2.5 min coupling step for 2'-O-methylated nucleotides. Table II outlines the amounts, and the contact times, of the reagents used in the synthesis cycle. A 6.5-fold excess (163 pL of 0.1 M =
16.3 ~,mol) of phosphoramidite and a 24-fold excess of S ethyl tetrazole (238 ~L of 0.25 M =
59.5 ~zmol) relative to polymer-bound 5'-hydroxyl was used in each coupling cycle. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, were 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer : detritylation solution was 2%
TCA in methylene chloride (ABI); capping was performed with 16% N methyl imidazole 2 0 in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI);
oxidation solution was 16.9 mM I2, 49 mM pyridine, 9% water in THF (Millipore). B & J
Synthesis Grade acetonitrile was used directly from the reagent bottle. S Ethyl tetrazole solution (0.25 M in acetonitrile) was made up from the solid obtained from American International Chemical, Inc.
2 5 Deprotection of the RNA was performed as follows. The polymer-bound oligoribonucleotide, trityl-off, was transferred from the synthesis column to a 4mL glass screw top vial and suspended in a solution of methylamine (MA) at 65 °C
for 10 min.
After cooling to -20 °C, the supernatant was removed from the polymer support. The support was washed three times with 1.0 mL of EtOH:MeCN:H20/3:1:1, vortexed and the 3 0 supernatant was then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, were dried to a white powder.
The base-deprotected oligoribonucleotide was resuspended in anhydrous TEA~HF/NMP solution (250 pL of a solution of I.SmL N methylpyrrolidinone, 750 ~L
TEA and 1.0 mL TEA~3HF to provide a 1.4M HF concentration) and heated to 65°C for 3 5 1.5 h. The resulting, fully deprotected, oligomer was quenched with 50 mM
TEAB (9 mL) prior to anion exchange desalting.

For anion exchange desalting of the deprotected oligomer, the TEAB solution was loaded onto a Qiagen 500~ anion exchange cartridge (Qiagen Inc.) that was prewashed with 50 mM TEAB (10 mL). After washing the loaded cartridge with SO mM TEAB
(10 mL), the RNA was eluted with 2 M TEAB (10 mL) and dried down to a white powder.
Inactive hammerhead ribozymes were synthesized by substituting switching the order of GSA6 and substituting a U for A14(numbering from Hertel, K. J., et al., 1992, Nucleic Acids Res., 20, 3252). Inactive ribozymes were may also by synthesized by substituting a U for GS and a U for A14. In some cases, the sequence of the substrate binding arms were randomized while the overall base composition was maintained.
The average stepwise coupling yields were >98% (Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684).
Hairpin ribozymes are synthesized in two parts and annealed to reconstruct the active ribozyme (Chowrira and Burke, 1992 Nucleic Acids Res., 20, 2835-2840).
Ribozymes are also synthesized from DNA templates using bacteriophage T7 RNA
polymerase (Milligan and Uhlenbeck, 1989, Methods Enzymol. 180, 51 ).
Ribozymes are modified to enhance stability and/or enhance catalytic activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-flouro, 2'-O-methyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992 TIBS 17, 34; Usman et al., 1994 Nucleic Acids Symp. Ser. 31, 163; Burgin et al., 2 0 1996 Biochemistry 6, 14090).
Ribozymes were purified by gel electrophoresis using general methods or are purified by high pressure liquid chromatography (HPLC; See Stinchcomb et al., International PCT Publication No. WO 95/23225, the totality of which is hereby incorporated herein by reference) and are resuspended in water.
2 5 The sequences of the ribozymes that are chemically synthesized, useful in this study, are shown in Tables IV-IX. Those in the art will recognize that these sequences are representative only of many more such sequences where the enzymatic portion of the ribozyme (all but the binding arms) is altered to affect activity. For example, stem-loop II
sequence of hammerhead ribozymes can be altered (substitution, deletion, and/or 3 0 insertion) to contain any sequences provided a minimum of two base-paired stem structure can form. Similarly, stem-loop IV sequence of hairpin ribozymes, can be altered (substitution, deletion, and/or insertion) to contain any sequence, provided a minimum of two base-paired stem structure can form. Preferably; no more than 200 bases are inserted at these locations. The sequences listed in Tables IV-IX may be formed of 3 5 ribonucleotides or other nucleotides or non-nucleotides. Such ribozymes (which have enzymatic activity) are equivalent to the ribozymes described specifically in the Tables.

Optimizing Ribozvme A.ctivity Catalytic activity of the ribozymes described in the instant invention can be optimized as described by Draper et al., supra. 'The details will not be repeated here, but include altering the length of the ribozyme binding arms, or chemically synthesizing ribozymes with modifications (base, sugar and/or phosphate) that prevent their degradation by serum ribonucleases and/or enhance their enzymatic activity (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al., 1991 Science 253, 314; Usman aid Cedergren, 1992 Trends in Biochem. Sci. 17, 334; Usman et al., International Publication No. WO
93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, US Patent No.
5,334,711; and Burgin et al., supra; all of these describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of enzymatic RNA
molecules). Modifications which enhance their efficacy in cells, and removal of bases from stem loop structures to shorten RNA synthesis times and reduce chemical requirements are desired. (All these publications are hereby incorporated by reference herein).
There are several examples in the art describing sugar and phosphate modifications that can be introduced into enzymatic nucleic acid molecules without significantly effecting catalysis and with significant enhancement in their nuclease stability and 2 0 efficacy. Ribozymes are modified to enhance stability and/or enhance catalytic activity by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-flouro, 2'-O-methyl, 2'-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992 TIBS 17, 34; Usman et al., 1994 Nucleic Acids Symp. Ser. 31, 163; Burgin et al., 1996 Biochemistry 35, 14090). Sugar modification of enzymatic nucleic acid molecules 2 5 have been extensively described in the art (see Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al. Nature 1990, 344, 565-568; Pieken et al.
Science 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci. 1992, 17, 334-339;
Usman et al. International Publication PCT No. WO 93/15187; Sproat, US Patent No.
5,334,711 and Beigelman et al., 1995 J. Biol. Chem. 270, 25702; all of the references are 3 0 hereby incorporated in their totality by reference herein). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base and/or phosphate modifications and the like into ribozymes without inhibiting catalysis, and are incorporated by reference herein. In view of such teachings, similar modifications can be used as described herein to modify the nucleic acid catalysts of the instant 3 5 invention.

Nucleic acid catalysts having chemical modifications which maintain or enhance enzymatic activity are provided. Such nucleic acid is also generally more resistant to nucleases than unmodified nucleic acid. Thus, in a cell and/or in vivo the activity may not be significantly lowered. As exemplified herein such ribozymes are useful in a cell and/or in vivo even if activity over all is reduced 10 fold (Burgin et al., 1996, Biochemistry, 35, 14090). Such ribozymes herein are said to "maintain" the enzymatic activity on all RNA
ribozyme.
Therapeutic ribozymes delivered exogenously must optimally be stable within cells until translation of the target RNA has been inhibited long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Clearly, ribozymes must be resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of RNA
(Wincott et al., 1995 Nucleic Acids Res. 23, 2677; incorporated by reference herein) have expanded the ability to modify ribozymes by introducing nucleotide modifications to enhance their nuclease stability as described above.
By "nucleotide" as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1' position of a sugar moiety. Nucleotide generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate 2 0 and/or base moiety, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other ; see for example, Usman and McSwiggen, supra; Eckstein et al., International PCT Publication No.
WO
92/07065; Usman et al., International PCT Publication No. WO 93/15187; all hereby incorporated by reference herein). There are several examples of modified nucleic acid 2 5 bases known in the art and has recently been summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183. Some of the non-limiting examples of base modifications that can be introduced into enzymatic nucleic acids without significantly effecting their catalytic activity include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 30 5-alkylcytidines (e.g., S-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine) and others (Burgin et al., 1996, Biochemistry, 35, 14090). By "modified bases" in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1' position or their equivalents; such bases may be used within the catalytic core 3 5 of the enzyme and/or in the substrate-binding regions.

By "abasic" is meant sugar moieties lacking a base or having other chemical groups in place of base at the 1' position.
By "unmodified nucleoside" is meant one of the bases adenine, cytosine, guanine, uracil joined to the 1' carbon of beta-D-ribo-furanose.
5 By "modified nucleoside" is meant any nucleotide base which contains a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate.
Various modifications to ribozyme structure can be made to enhance the utility of ribozymes. Such modifications will enhance shelf life, half life in vitro, stability, and ease 10 of introduction of such ribozymes to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
Administration of Ribozvmes Sullivan et al., PCT WO 94/02595, describes the general methods for delivery of enzymatic RNA molecules . Ribozymes may be administered to cells by a variety of 15 methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. For some indications, ribozymes may be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles. Alternatively, the RNA/vehicle combination is locally 2 0 delivered by direct injection or by use of a catheter, infusion pump or stent. Other routes of delivery include, but are not limited to, intravascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of ribozyme delivery and administration are provided in Sullivan et al., supra. and Draper et al., PCT
W093/23569 which have been incorporated by reference herein.
The molecules of the instant invention can be used as pharmaceutical agents.
Pharmaceutical agents prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a patient.
The negatively charged polynucleotides of the invention can be administered (e.g., 3 0 RNA, DNA or protein) and introduced into a patient by any standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition. When it is desired to use a lipid or liposome delivery mechanism, standard protocols for formulation can be followed. The compositions of the present invention may also be formulated and used as tablets, capsules or elixirs for oral administration;
suppositories for rectal administration; sterile solutions; suspensions for injectable administration; and the like.
The present invention also includes pharmaceutically acceptable formulations of the compounds described. These formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
A pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or patient, preferably a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation to reach a target cell (i.e., a cell to which the negatively charged polymer is desired to be delivered to). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors a.re known in the art, and include considerations such as toxicity and forms which prevent the composition or formulation from exerting its effect.
By "systemic administration" is meant in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Administration routes which lead to systemic absorption include, without limitations: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary 2 0 and intramuscular. Each of these administration routes expose the desired negatively charged polymers, e.g., nucleic acids, to an accessible diseased tissue. The rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size.
The use of a liposome or other drug carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the 2 5 tissues of the reticular endothelial system (RES). A liposome formulation which can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach may provide enhanced delivery of the drug to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as the HCV infected liver cells.
30 The invention also features the use of a composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer an method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES}, thereby enabling 3 5 longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwataet al., Chem. Pharm.
Bull. 1995, 43, 1005-1011). Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al.,1995, Biochim. Biophys. Acta, 1238, 86-90).
The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International PCT Publication No. WO 96/10391; Ansell et al., International PCT Publication No. WO 96/10390; Holland et al., International PCT
Publication No. WO 96/10392; all of these are incorporated by reference herein). All of these references are incorporated by reference herein.
In addition other cationic molecules may also be utilized to deliver the molecules of the present invention. For example, ribozymes may be conjugated to glycosylated poly(L-lysine) which has been shown to enhance localization of antisense oligonucleotides into the liver (Nakazono et al., 1996, Hepatology 23, 1297-1303; Nahato et al., 1997, Biochem Pharm. 53, 887-895). Glycosylated poly(L-lysine) may be covently attached to the enzymatic nucleic acid or be bound to enzymatic nucleic acid through electrostatic interaction.
The present invention also includes compositions prepared for storage or administration which include a pharmaceutically effective amount of the desired 2 0 ~ compounds in a pharmaceutically acceptable carrier or diluent.
Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R.
Gennaro edit. 1985) hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents may be provided. Id. at 1449. These include sodium 2 5 benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents may be used.
A pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) a disease state. The pharmaceutically effective dose depends on the type of disease, the 3 0 composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors which those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
3 5 Alternatively, the enzymatic nucleic acid molecules of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, 1985 Science 229, 345; McGarry and Lindquist, 1986 Proc. Natl. Acad. Sci. USA 83, 399;
Scanlon et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992 Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992 J. Virol, 66, 1432-41; Weerasinghe et al., 1991 J. Virol, 65, 5531-4; Ojwang et al., 1992 Proc. Natl. Acad. Sci. USA 89, 10802-6; Chen et al., 1992 Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990 Science 247, 1222-1225;
Thompson et al., 1995 Nucleic Acids Res. 23, 2259; Good et al., 1997, Gene Therapy, 4, 45; all of the references are hereby incorporated in their totality by reference herein).
Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a ribozyme (Draper et al., PCT
WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., 1992 Nucleic Acids Symp. Ser., 27, IS-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30;
Ventura et al., 1993 Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994 J. Biol. Chem.
269, 25856; all of the references are hereby incorporated in their totality by reference herein).
In another aspect of the invention, enzymatic nucleic acid molecules that cleave target molecules are expressed from transcription units (see for example Couture et al., 1996, TIG., 12, 510) inserted into DNA or RNA vectors. The recombinant vectors are preferably DNA plasmids or viral vectors. Ribozyme expressing viral vectors could be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or 2 0 alphavirus. Preferably, the recombinant vectors capable of expressing the ribozymes are delivered as described above, and persist in target cells. Alternatively, viral vectors may be used that provide for transient expression of ribozymes. Such vectors might be repeatedly administered as necessary. Once expressed, the ribozymes cleave the target mRNA. The active ribozyme contains an enzymatic center or core equivalent to those in the examples, 2 5 and binding arms able to bind target nucleic acid molecules such that cleavage at the target site occurs. Other sequences may be present which do not interfere with such cleavage.
Delivery of ribozyme expressing vectors could be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that would allow for 3 0 introduction into the desired target cell (for a review see Couture et al., 1996, TIG., 12, 510).
In one aspect the invention features, an expression vector comprising nucleic acid sequence encoding at least one of the nucleic acid catalyst of the instant invention is disclosed. The nucleic acid sequence encoding the nucleic acid catalyst of the instant 3 5 invention is operable linked in a manner which allows expression of that nucleic acid molecule.

In another aspect the invention features, the expression vector comprises: a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a transcription termination region (e.g., eukaryotic pol I, II or III
termination region); c) a gene encoding at least one of the nucleic acid catalyst of the instant invention; and wherein said gene is operably linked to said initiation region and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.
The vector may optionally include an open reading frame (ORF) for a protein operably linked on the 5' side or the 3'-side of the gene encoding the nucleic acid catalyst of the invention; and/or an intron (intervening sequences).
Transcription of the ribozyme sequences are driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III
(pol III).
Transcripts from pol II or pol III promoters will be expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type will depend on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby. Prokaryotic RNA
polymerase promoters are also used, providing that the prokaryotic RNA
polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990 Proc.
Natl.
Acad. Sci. U S A, 87, 6743-7; Gao and Huang 1993 Nucleic Acids Res., 21, 2867-72;
Lieber et al., 1993 Methods Enzymol., 217, 47-66; Zhou et al., 1990 Mol. Cell.
Biol., 10, 4529-37). Several investigators have demonstrated that ribozymes expressed from such 2 0 promoters can function in mammalian cells (e.g. Kashani-Sabet et al., 1992 Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992 Proc. Natl. Acad. Sci. U S A, 89, 10802-6; Chen et al., 1992 Nucleic Acids Res., 20, 4581-9; Yu et al., 1993 Proc. Natl. Acad.
Sci. U S A, 90, 6340-4; L'Huillier et al., 1992 EMBO J. 11, 4411-8; Lisziewicz et al., 1993 Proc.
Natl. Acad. Sci. U. S A., 90, 8000-4; Thompson et al., 1995 Nucleic Acids Res.
23, 2259;
2 5 Sullenger & Cech, 1993, Science, 262, 1566). More specifically, transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA
{tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as ribozymes in cells (Thompson et al., supra; Couture and Stinchcomb, 1996, supra; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830;
Noonberg et 30 al., US Patent No. 5,624,803; Good et al., 1997, Gene Ther. 4, 45;
Beigelman et al., International PCT Publication No. WO 96/18736; all of these publications are incorporated by reference herein. The above ribozyme transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus 3 5 vectors), or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Couture and Stinchcomb, 1996, supra).

In yet another aspect the invention features an expression vector comprising nucleic acid sequence encoding at least one of the catalytic nucleic acid molecule of the invention, in a manner which allows expression of that nucleic acid molecule.
The expression vector comprises in one embodiment; a) a transcription initiation region; b) a 5 transcription termination region; c) a gene encoding at least one said nucleic acid molecule; and wherein said gene is operably linked to said initiation region and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule. In another preferred embodiment the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an open reading 10 frame; d) a gene encoding at least one said nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame; and wherein said gene is operably linked to said initiation region, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.
In yet another embodiment the expression vector comprises: a) a transcription initiation 15 region; b) a transcription termination region; c) an intron; d) a gene encoding at least one said nucleic acid molecule; and wherein said gene is operably linked to said initiation region, said intron and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule. In another embodiment, the expression vector comprises: a) a transcription initiation region; b) a transcription termination region;
2 0 c) an intron; d) an open reading frame; e) a gene encoding at least one said nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame;
and wherein said gene is operably linked to said initiation region, said intron, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.
2 5 Interferons Type I interferons (IFN) are a class of natural cytokines that includes a family of greater than 25 IFN-a (Pests, 1986, Methods Enzymol. 119, 3-14) as well as IFN-(3, and IFN-w. Although evolutionarily derived from the same gene (Diaz et al., 1994, Genomics 22, 540-552), there are many differences in the primary sequence of these molecules, 3 0 implying an evolutionary divergence in biologic activity. All type I IFN
share a common pattern of biologic effects that begin with binding of the IFN to the cell surface receptor (Pfeffer & Strulovici, 1992, Transmembrane secondary messengers for IFN-a/(3.
In:
Interferon. Principles and Medical Applications., S. Baron, D.H. Coopenhaver, F.
Dianzani, W.R. Fleischmann Jr., T.K. Hughes Jr., G.R. Kimpel, D.W. Niesel, G.J.
Stanton, and S.K. Tyring, eds. 151-160). Binding is followed by activation of tyrosine kinases, including the Janus tyrosine kinases and the STAT proteins, which leads to the production of several IFN-stimulated gene products (Johnson et al., 1994, Sci.
Am. 270, 68-75). The IFN-stimulated gene products are responsible for the pleotropic biologic effects of type I IFN, including antiviral, antiproliferative, and immunomodulatory effects, cytokine induction, and HLA class I and class II regulation (Pestka et al., 1987, Annu. Rev.
Biochem 56, 727). Examples of IFN-stimulated gene products include 2-5-oligoadenylate synthetase (2-5 OAS), ~i2-microglobulin, neopterin, p68 kinases, and the Mx protein (Chebath & Revel, 1992, The 2-5 A system: 2-5 A synthetase, isospecies and functions.
In: Interferon. Principles and Medical Applications. S. Baron, D.H.
Coopenhaver, F.
Dianzan, W.R. Jr. Fleischmann, T.K. Jr Hughes, G.R. Kimpel, D.W. Niesel, G.J.
Stanton, and S.K. Tyring, eds., pp. 225-236; Samuel, 1992, The RNA-dependent P1/eIF-2a protein kinase. In: Interferon. Principles and Medical Applications. S. Baron, D.H.
Coopenhaver, F. Dianzani, W.R. Fleischmann Jr., T.K. Hughes Jr., G.R. Kimpel, D.W.
Niesel, G.H. Stanton, and S.K. Tyring, eds. 237-250; Horisberger, 1992, MX
protein:
function and Mechanism of Action. In: Interferon. Principles and Medical Applications.
S. Baron, D.H. Coopenhaver, F. Dianzani, W.R. Fleischmann Jr., T.K. Hughes Jr., G.R.
Kimpel, D.W. Niesel, G.H. Stanton, and S.K. Tyring, eds. 215-224). Although all type I
IFN have similar biologic effects, not all the activities are shared by each type I IFN, and, in many cases, the extent of activity varies quite substantially for each IFN
subtype (Fish 2 0 et al, 1989, J. Interferon Res. 9, 97-114; Ozes et al., 1992, J.
Interferon Res. 12, 55-59).
More specifically, investigations into the properties of different subtypes of IFN-a and molecular hybrids of IFN-a have shown differences in pharmacologic properties (Rubinstein, 1987, J. Interferon Res. 7, 545-551). These pharmacologic differences may arise from as few as three amino acid residue changes (Lee et al., 1982, Cancer Res. 42, 1312-1316).
Eighty-five to 166 amino acids are conserved in the known IFN-a subtypes.
Excluding the IFN-a pseudogenes, there are approximately 25 known distinct IFN-a subtypes. Pairwise comparisons of these nonallelic subtypes show primary sequence differences ranging from 2% to 23%. In addition to the naturally occurring IFNs, a non-3 0 natural recombinant type I interferon known as consensus interferon (CIFN) has been synthesized as a therapeutic compound (Tong et al., 1997, Hepatology 26, 747-754).
Interferon is currently in use for at least 12 different indications including infectious and autoimmune diseases and cancer (Borden, 1992, N. Engl. J. Med.
326, 1491-1492). For autoimmune diseases IFN has been utilized for treatment of rheumatoid 3 5 arthritis, multiple sclerosis, and Crohn's disease. For treatment of cancer IFN has been used alone or in combination with a number of different compounds. Specific types of cancers for which IFN has been used include squamous cell carcinomas, melanomas, hypemephromas, hemangiomas, hairy cell leukemia, and Kaposi's sarcoma. In the treatment of infectious diseases, IFNs increase the phagocytic activity of macrophages and cytotoxicity of lymphocytes and inhibits the propagation of cellular pathogens. Specific indications for which IFN has been used as treatment include: hepatitis B, human papillomavirus types 6 and 11 (i.e. genital warts) (Leventhal et al., 1991, N
Engl J Med 325, 613-617), chronic granulomatous disease, and hepatitis C virus.
Numerous well controlled clinical trials using IFN-alpha in the treatment of chronic HCV infection have demonstrated that treatment three times a week results in lowering of serum ALT values in approximately 50% (range 40% to 70%) of patients by the end of 6 months of therapy (Davis et al., 1989, The new England Journal of Medicine 321, 1501-1506; Marcellin et al., 1991, Hepatology 13, 393-397; Tong et al., 1997, Hepatology 26, 747-754; Tong et al., Hepatology 26, 1640-1645). However, following cessation of interferon treatment, approximately 50% of the responding patients relapsed, resulting in a "durable" response rate as assessed by normalization of serum ALT
concentrations of approximately 20 to 25%. In addition, studies that have examined six months of type 1 interferon therapy using changes in HCV RNA values as a clinical endpoint have demonstrated that up to 35% of patients will have a loss of HCV
RNA by the end of therapy (Tong et al., 1997, supra). However, as with the ALT
endpoint, about 2 0 50% of the patients relapse six months following cessation of therapy resulting in a durable virologic response of only 12% (23). Studies that have examined 48 weeks of therapy have demonstrated that the sustained virological response is up to 25%.
Ribozymes in combination with IFN have the potential to improve the effectiveness of treatment of HCV or any of the other indications discussed above.
2 5 Ribozymes targeting RNAs associated with diseases such as infectious diseases, autoimmune disases, and cancer, can be used individually or in combination with other therapies such as IFN to achieve enhanced efficacy.
Examples The following are non-limiting examples showing the selection, isolation, 3 0 synthesis and activity of enzymatic nucleic acids of the instant invention.
The following examples demonstrate the selection of ribozymes that cleave HCV
RNA. The methods described herein represent a scheme by which ribozymes may be derived that cleave other RNA targets required for HCV replication.

Example 1: Identification of Potential Ribozyme Cleavage Sites in HCV RNA
The sequence of HCV RNA was screened for accessible sites using a computer folding algorithm. Regions of the mRNA that did not form secondary folding structures and contained potential hammerhead and/or hairpin ribozyme cleavage sites were identified. The sequences of these cleavage sites are shown in tables IV-VIII.
Example 2: Selection of Ribozyme Cleava»e Sites in HCV RNA
To test whether the sites predicted by the computer-based RNA folding algorithm corresponded to accessible sites in HCV RNA, 20 hammerhead sites were selected for analysis. Ribozyme target sites were chosen by analyzing genornic sequences of HCV
(Input Sequence = HPCJTA (Acc#D11168 & DO1I71)) and prioritizing the sites on the basis of folding. Hammerhead ribozymes were designed that could bind each target (see Figure 1 ) and were individually analyzed by computer folding (Christoffersen et al., 1994 J. Mol.
Struc. Theochem, 311, 273; Jaeger et al., 1989, Proc. Natl. Acad. Sci. USA, 86, 7706) to assess whether the ribozyme sequences fold into the appropriate secondary structure.
Those ribozymes with unfavorable intramolecular interactions between the binding arms and the catalytic core were eliminated from consideration. As noted below, varying binding arm lengths can be chosen to optimize activity. Generally, at least S
bases on each arm are able to bind to, or otherwise interact with, the target RNA.
Selection of ribozyme candidates was initiated by scanning for all hammerhead cleavage sites in an HCV RNA sequence derived from a patient infected with HCV
genotype lb. The results of this sequence analysis are shown in Table III. As seen by Table III, 1300 hammerhead ribozyme sites were identified by this analysis.
Next, in order to identify hammerhead ribozyme candidates that would cleave in the conserved regions of the HCV genome, a sequence alignment of approximately 50 HCV
isolates from genotypes la, lb, 2a, 2b, 2c, 3a, 3b, 4a, Sa, and 6 was completed. Within genotype sites were identified that are in areas having the greatest sequence identity between all isolates examined. This analysis reduced the hammerhead ribozyme candidates to about 23 (Table III).
Due to the high sequence variability of the HCV genome, selection of ribozymes 3 0 for broad therapeutic applications should probably involve the conserved regions of the HCV genome. A list of the thirty-hammerhead ribozymes derived from the conserved regions (5'- Non-Coding Region (NCR), 5'- end of core protein coding region, and 3'-NCR) of the HCV genome is shown in Table IV. In general, ribozymes targeted to sites located in the 5' terminal region of the HCV genome should block translation while ribozymes cleavage sites located in the 3' terminal region of the genome should block RNA replication.
Example 3: Chemical Synthesis and Purification of Riboz~mes Ribozymes of the hammerhead or hairpin motif were designed to anneal to various sites in the RNA message. The binding arms are complementary to the target site sequences described above. The ribozymes were chemically synthesized. The method of synthesis used followed the procedure for normal RNA synthesis as described in Usman et al., (1987 J. Am. Chem. Soc., 109, 7845), Scaringe et al., (1990 Nucleic Acids Res., 18, 5433) and Wincott et al., supra, and made use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the S'-end, and phosphoramidites at the 3'-end.
The average stepwise coupling yields were >98%.
Inactive hammerhead ribozymes were synthesized by substituting switching the order of GSAb and substituting a U for A14 (numbering from Hertel et al., 1992 Nucleic Acids Res., 20, 3252). Hairpin ribozymes were synthesized in two parts and annealed to reconstruct the active ribozyme (Chowrira and Burke, 1992 Nucleic Acids Res., 20, 2835-2840). Ribozymes were also synthesized from DNA templates using bacteriophage RNA polymerise (Milligan and Uhlenbeck, 1989, Methods Enzymol. l 80, 51 ).
Ribozymes were modified to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-flouro, 2'-O-methyl, 2'-H (for a review see 2 0 Usman and Cedergren, 1992 TIBS 17, 34). Ribozymes were purified by gel electrophoresis using general methods or were purified by high pressure liquid chromatography (HPLC; See Wincott et al., supra; the totality of which is hereby incorporated herein by reference) and were resuspended in water. The sequences of the chemically synthesized ribozymes used in this study are shown below in Table IV -IX.
2 5 Example 4: Ribozyme Cleavage of HCV RNA Tar;~et in vitro Ribozymes targeted to the HCV are designed and synthesized as described above.
These ribozymes can be tested for cleavage activity in vitro, for example using the following procedure. The target sequences and the nucleotide location within the HCV
are given in Table IV.
30 Cleavage Reactions: Full-length or partially full-length, internally-labeled target RNA for ribozyme cleavage assay is prepared by in vitro transcription in the presence of [a-32p] CTP, passed over a G SO Sephadex column by spin chromatography and used as substrate RNA without fiurther purification. Alternately, substrates are 5'-32P-end labeled using T4 polynucleotide kinase enzyme. Assays are performed by pre-warming a concentration of purified ribozyme in ribozyme cleavage buffer (50 mM Tris-HC1, pH 7.5 at 37°C, 10 mM MgCl2) and the cleavage reaction was initiated by adding the 2X
ribozyme mix to an equal volume of substrate RNA (maximum of 1-5 nlV1) that was also pre-warmed in cleavage buffer. As an initial screen, assays are carried out for 1 hour at 5 37°C using a final concentration of either 40 nM or 1 mM ribozyme, i.e., ribozyme excess.
The reaction is quenched by the addition of an equal volume of 95% formamide, 20 mM
EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol after which the sample is heated to 95°C for 2 minutes, quick chilled and loaded onto a denaturing polyacrylamide gel. Substrate RNA and the specific RNA cleavage products generated by ribozyme 10 cleavage are visualized on an autoradiograph of the gel. The percentage of cleavage is determined by Phosphor Imager~ quantitation of bands representing the intact substrate and the cleavage products.
Example 5: Ability of HCV Ribozymes to Cleave HCV RNA in patient serum.
Ribozymes targeting sites in HCV RNA were synthesized using modifications that 15 confer nuclease resistance (Beigelman, 1995, J. Biol. Chem. 270, 25702). It has been well documented that serum from chronic hepatitis C patients contains on average 3 x 106 copies/ml of HCV RNA. To further select ribozyme product candidates, the 30 HCV
specific ribozymes are characterized for HCV RNA cleavage activity utilizing HCV
RNA isolated from the serum of genotype lb HCV patients. The best candidates from 2 0 the HCV genotype lb screen will be screened against isolates from the wide range of HCV genotypes including la, lb, 2a, 2b, 2c, 3a, 3b, 4a, Sa, and 6. Therefore, it is possible to select ribozyme candidates for further development based on their ability to broadly cleave HCV RNA from a diverse range of HCV genotypes and quasispecies.
Example 6: Ribozyme Cleavaee of Conserved HCV RNA Tar~Zet Sites in vitro 2 5 There are three regions of the genome that are highly conserved, both within a genotype and across different genotypes. These conserved sequences occur in the 5' and 3' non-coding regions (NCRs) as well as the 5'-end of the Core Protein coding region.
These regions are thought to be important for HCV RNA replication and translation.
Thus, therapeutic agents that target these conserved HCV genomic regions may have a 3 0 significant impact over a wide range of HCV genotypes. The presence of quasispecies, and the potential for infection with more than one genotype makes this a critical feature of an elective therapy. Moreover, it is unlikely that drug resistance will occur, since mutations that have been suggested to lead to drug resistance typically do not occur within these highly conserved regions. In order to target multiple genotypes and decrease the chance of developing drug resistance, Applicant has designed ribozymes that cleave in regions of identity within the conserved regions discussed above.
Sequence alignments were performed for the S' NCR, the 5' end of the Core Protein coding region, and the 3' NCR. For the 5' NCR, 34 different isolates representing genotypes la, lb, 2a, 2b, 2c, 3a, 3b, 4a, 4f, and Sa were aligned. The alignments included the sequences from nucleotide position 1 to nucleotide position 350 (1$
nucleotides downstream of the initiator ATG colon), using the reported sequence "HPCK1 S
1" as the reference for numbering. For the Core Protein coding region, 44 different isolates representing genotypes la, lb, 2a, 2b, 2c, 3a, 3b, 4a, 4c, 4f, Sa, and 6a were aligned.
These alignments included 600 nucleotides, beginning 8 nucleotides upstream of the initiator ATG colon. As the reference for numbering, the reported sequence "HPCCOPR"
was used, with the "C" eight nucleotides upstream of the initiator colon ATG
designated as "1". For the 3' NCR region, 20 different isolates representing genotypes lb, 2a, 2b, 3a, and 3b were aligned. These alignments included sequences in the 3' terminal nucleotides of the genome, with the reported sequence "D85516" used as the reference for numbering, and the 235' nucleotide from the 3' end designated as "1".
During analysis of the alignments of each region, each sequence was compared to the respective reference sequence (identified above), and regions of identity across all isolates were determined. All potential ribozyme sites were identified in the reference 2 0 sequence. The highest priority for choosing ribozyme sites was that the site should have 100% identity across all isolates aligned, at every position in both the cleavage site and binding arms. Ribozyme sites that met these criteria were chosen. In addition, two specific allowances were made as follows. 1) If a potential ribozyme site had 100%
sequence identity at all except one or two nucleotide positions, then the actual nucleotide 2 5 at that position was examined in the isolates) that differed. If that nucleotide was such that a ribozyme designed to allow "G:U wobble" base-paring could function on all the isolates, then that site was chosen. 2) If a potential ribozyme site had 100%
sequence identity at all except one or two nucleotide positions, then the genotype of the isolate which contained the differing nucleotides) was examined. If the genotype of the isolate 30 that differed was of extremely rare prevalence, then that site was also chosen.
Ribozyme sites identified and referred to below use the following nomenclature:
"region of the genome in which the site exists" followed by "nucleotide position 5' to the cleavage site" (according to the reference sequence and numbering described above). For example, a ribozyme cleavage site at nucleotide position 67 in the 5' NCR is designated 3 5 "5-67", and a ribozyme cleavage site at position 48 in the core coding region is designated "~$».

A number of these ribozymes were screened in an in vitro HCV cleavage assay to select appropriate ribozyme candidates for cell culture studies. The ribozymes selected for screening targeted the 5' UTR region that is necessary for HCV
translation. These sites are all conserved among the 8 major HCV genotypes and 18 subtypes, and have a high degree of homology in every HCV isolate that was used in the analysis described above. HCV RNA of four different genotypes (lb, 2a, 4, and 5) were isolated from human patients and the 5' HCV UTR and 5' core region were amplified using RT-PCR.
Run-off transcripts of the 5' HCV UTR region 0750 nt transcripts) were prepared from the RT-PCR products, which contained a T7 promoter, using the T7 Megascript transcription kit and the manufacturers protocol (Ambion, Inc.). Unincorporated nucleotides are removed by spin column filtration on Bio-Gel P-60 resin (Bio-Rad). The f ltered transcript was 5' end labeled with 32P using Polynucleotide Kinase (Boehringer/Mannheim) and 150~Ci/wl Gamma-32P-ATP (NEN) using the enzyme manufacturer's protocol. The kinased transcript is spin purified again to remove unincorporated Gamma-32P-ATP and gel purified on 5% polyacrylamide gel.
Ribozymes targeting various sites from table IV were selected and tested on the 5' HCV UTR transcript sequence to test the efficiency of RNA cleavage. 15 ribozymes were synthesized as previously described (Wincott et al., supra).
Assays were performed by pre-warming a 2X (2 p,M ) concentration of purified 2 0 ribozyme in ribozyme cleavage buffer (SOmM TRIS pH 7.5, l OmM MgCl2, 10 units RNase Inhibitor (BoehringerlMannheim), lOmM DTT, O.Spg tRNA) and the cleavage reaction was initiated by adding the 2X ribozyme mix to an equal volume of substrate RNA (17.46 pmole final concentration) that was also pre-warmed in cleavage buffer. The assay was carried out for 24 hours at 3'7 C using a final concentration of 1 ~M ribozyme, 2 5 i. e., ribozyme excess. The reaction was quenched by the addition of an equal volume of 95% formamide, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol after which the sample is heated to 95~C for 2 minutes, quick chilled and loaded onto a denaturing polyacrylamide gel. Substrate RNA and the specific RNA cleavage products generated by ribozyme cleavage are visualized on an autoradiograph of the gel.
The 3 0 percentage of cleavage is determined by Phosphor Imager~ quantitation of bands representing the intact substrate and the cleavage products.
Observed cleavage fragment sizes from the gels are correlated to predicted fragment sizes by comparison to the RNA marker. The optical density of expected cleavage fragments are determined from the phosphorimage plates and ranked from 3 5 highest density, indicating the most cleavage product, to lowest of each genotype of HCV
transcript tested. The top 3 cleaving ribozymes (out of 15 ribozymes tested) are given ranking values of 5, the next 3 highest densities are given ranking values of 4, etc for every genotype tested. The ranking values for each ribozyme are averaged between the genotypes tested. Individual and average ribozyme ranking values are graphed and compared. The results (figure 2) demonstrate that many of these tested ribozymes are able to to give high levels of cleavage regardless of genotype. In particular, ribozymes targeting site HCV.S-258, HCV.S-294, HCV.S-313 (Sakamoto et al., .J Clinical Investigation 1996 98(12):2720-2728), and HCV.S-318 (table IV) appear to demonstrate a consistent pattern of RNA cleavage Example 7:Inhibition of Luciferase Activity Using HCV Tar etin~~es in OST7 Cells The capability of ribozymes to inhibit HCV RNA intracellularly was tested using a dual reporter system that utilizes both firefly and Renilla luciferase (figure 3). The ribozymes targeted to the 5' HCV UTR region, which when cleaved, would prevent the translation of the transcript into luciferase. OST-7 cells were plated at 12,500 cells per well in black walled 96 well plates (Packard) in medium DMEM containing 10 %
fetal bovine serum, 1 % pen/strep, and 1 % L-glutamine and incubated at 37°C
overnight. A
plasmid containing T7 promoter expressing 5' HCV UTR and firefly luciferase (T7C1-341 (Wang et al., 1993, J. of Virol. 67, 3338-3344)) was mixed with a pRLSV40 Renilla control plasmid (Promega Corporation) followed by ribozyme, and cationic lipid to make a SX concentration of the reagents (T7C1-341 (4 p,g/ml), pRLSV40 renilla luciferase control (6 ~,g/ml), ribozyme (250 nM), transfection reagent (28.S~g/ml).
The complex mixture was incubated at 37~C for 20 minutes. The media was removed from the cells and 120 ~,1 of Opti-mem media was added to the well followed by p,l of the SX complex mixture. 150 ~l of Opti-mem was added to the wells holding the 2 5 untreated cells. The complex mixture was incubated on OST-7 cells for 4 hours, lysed with passive lysis buffer (Promega Corporation) and luminescent signals were quantified using the Dual Luciferase Assay Kit using the manufacturer's protocol (Promega Corporation). The ribozyme sequences used are given in table IV. The ribozymes used were of the hammerhead motif. The hammerhead ribozymes were chemically modified 3 0 such that the ribozyme consists of ribose residues at five positions (see for example Figure 7); position 4 has either 2'-C-allyl or 2'-amino modification; position 7 has either 2'-amino modification or 2-O-methyl modification; the remaining nucleotide positions contain 2'-O-methyl substitutions; four nucleotides at the 5' terminus contains phosphorothioate substitutions. Additionally, the 3' end of the ribozyme includes a 3'-3' linked inverted abasic moiety (abasic deoxyribose; iH). The data (figure 4) is given as a ratio between the firefly and Renilla luciferase fluorescence. All of the ribozymes targeting 5' HCV UTR
were able to reduce firefly luciferase signal relative to renilla luciferase.
Example 9: Ribozyme Mediated Inhibition of Luciferase Activity Compared to its Inactive Control in OST-7 Cells The dual reporter system described above was utilized to determine the level of reduction of luciferase activity mediated by a ribozyme compared to its inactive control.
Ribozymes, having the chemical composition described in the previous example, to sites HCV 313 and 318 (table IV) and their inactive controls were synthesized as above. The inactive control has the same nucleotide base composition as the active ribozyme but the nucleotide sequence has been scrambled. The protocols utilized for tissue culture and the luciferase assay was exactly as given in example 8 except the ribozyme concentration in the SX complex mixture was 1 mM (final concentration on the cells was 200 nM).
The results are given in figure 5. The ribozyme targeting HCV.S-318 was able to greatly reduce firefly luciferase activity compared to the untreated and inactive controls. The ribozyme targeting HCV.S-313 was able to slightly reduce firefly luciferase activity compared to the inactive control.
Example 10: RibozYme Inhibition of Viral Replication During HCV infection, viral RNA is present as a potential target for ribozyme cleavage at several processes: uncoating, translation, RNA replication and packaging.
2 0 Target RNA may be more or less accessible to ribozyme cleavage at any one of these steps. Although the association between the HCV initial ribosome entry site (IRES) and the translation apparatus is mimicked in the HCV 5'UTR/luciferase reporter system (example 9), these other viral processes are not represented in the OST7 system. The resulting RNA/protein complexes associated with the target viral RNA are also absent.
2 5 Moreover, these processes may be coupled in an HCV-infected cell which could further impact target RNA accessibility. Therefore, we tested whether ribozymes designed to cleave the HCV 5'UTR could effect a replicating viral system.
Recently, Lu and Wimmer characterized an HCV-poliovirus chimera in which the poliovirus IRES was replaced by the IRES from HCV (Lu & Wimmer, 1996, Proc.
Natl.
30 Acad. Sci. USA. 93, 1412-1417). Poliovirus (PV) is a positive strand RNA
virus like HCV, but unlike HCV is non-enveloped and replicates efficiently in cell culture. The HCV-PV chimera expresses a stable, small plaque phenotype relative to wild type PV.
The following ribozymes were synthesized for the experiment (table VIII):
ribozyme targeting site 183 (3 5'-end phosphorothioate linkages), scrambled control to site 183, ribozyme to site 318 (3 5'-end phosphorothioate linkages), ribozyme targeting site 183 (4 5'-end phosphorothioate linkages), inactive ribozyme targeting site 183 (4 5'-end phosphorothioate linkages). HeLa cells were infected with the HCV-PV chimera for 30 minutes and immediately treated with ribozyme. HeLa cells were seeded in U-bottom 96-5 well plates at a density of 9000-10,000 cells/well and incubated at 37°C under S% C02 for 24 h. Transfection of ribozyme (200 nM) was achieved by mixing of l OX
ribozyme (2000 nM) and l OX of a cationic lipid (80 pg/ml) in DMEM (Gibco BRL) with 5% fetal bovine serum (FBS). Ribozyme/lipid complexes were allowed to incubate for 15 minutes at 37°C
under 5% CO2. Medium was aspirated from cells and replaced with 80 ~ls of DMEM
10 (Gibco BRL) with 5% FBS serum, followed by the addition of 20 Pls of lOX
complexes.
Cells were incubated with complexes for 24 hours at 37°C under 5%
COz .
The yield of HCV-PV from treated cells (Fig. 6A) was quantified by plaque assay.
The plaque assays were performed by diluting virus samples in serum-free DMEM
(Gibco BRL) and applying 100 ~l to HeLa cell monolayers {~80% confluent) in 6-well plates for 15 30 minutes. Infected monolayers were overlayed with 3 ml 1.2% agar (Sigma) and incubated at 37°C under 5% C02. Two - three days later the overlay was removed, monolayers were stained with 1.2% crystal violet, and plaque forming units were counted.
The data is shown in figure 6A. Ribozymes to site 183 inhibited HCV-PV
replication by >80% (P < 0.05) compared to the scrambled control (Fig. 6A, first two bars).
In addition, 2 0 3 or 4 phosphorothioate stabilization was equally effective (P < 0.05 vs.
control for each) in inhibiting viral replication (compare 1 S~ and 4~' bar in Fig. 6A).
Ribozymes to the 318 site also had a statistically significant (P < 0.05), effect on viral replication (compare 2"d and Std bar in Fig. 6A).
To confirm that a ribozyme cleavage mechanism was responsible for the inhibition 2 5 of HCV-PV replication observed, HCV-PV infected cells were treated with ribozymes to site 183 that maintained binding arm sequences but contained a mutation in the catalytic core to attenuate cleavage activity (Table I). Viral replication in these cells was not inhibited compared to cells treated with the scrambled control ribozyme (Fig.
6A, 4~' and 5'" bar), indicating that ribozyme cleavage activity was required for the inhibition of HCV
30 PV replication observed. In addition, ribozymes targeting site 183 of the HCV 5'UTR had no effect on wild type PV replication (Fig. 6B). These data provide evidence that the ribozyme-mediated inhibition of HCV-PV replication was dependent upon the HCV
5' UTR and not a general inhibition of PV replication.
Ribozymes to site 183 were also tested for the ability to inhibit HCV-PV
3 5 replication during a single infectious cycle in HeLa cells (Fig. 8). Cells treated with ribozyme to site 183 (7/4 format) produced significantly less virus than cells treated with the scrambled control (>80% inhibition at 8h post infection, P < 0.001 ).
Example 11: Shorteni_n~~of Ribozyme lengths.
All the ribozymes described in example 10 above contained 7 nucleotides on each binding arms and contained a 4 base-paired stem II element (7/4 format). For pharmaceutical manufacture of a therapeutic ribozyme it is advantageous to minimize sequence length if possible. Thus ribozymes to site 183 were shortened by removing the outer most nucleotide from each binding arm such that the ribozyme has six nucleotides in each binding arm and the stem II region is four base-paired long (6/4 format);
removing one base-pair (2 nucleotides) in stem II resulting in a 3 base-paired stem II
(7/3 format); or removing one nucleotide from each binding arm and shortening the stem II by one base-pair (6/3 format). (See Figure 7 for a schematic representation of each of these ribozymes). Ribozymes in all tested formats gave significant inhibition of viral replication (Fig. 8) with the 7/4, 7/3 and 6/3 formats being almost identical at the 8h timepoint (P <
0.001 across time course for all formats). The shortest ribozyme tested (6/3 format) was slightly more efficacious (>90% inhibition, P < 0.001 ) than the 7/4 ribozyme (~80%
inhibition, P < 0.001 ). The 6/3 ribozyme may have a greater ability to access site 183 in the HCV-PV chimera.
Example 12' Combination Therapy of HCV Ribozvmes and Interferon HeLa cells (10,000 cells per well) were pre-treated with 12.5 Units/ml of Interferon alpha in complete media {DMEM + 5% FBS) or pre-treated with complete media alone for 4 hours and then infected with HCV-PV at an MOI = 0.1 for 30 minutes.
The viral inoculum was then removed and 200 nM ribozyme targeted to HCV site (Rz) or binding attenuated control, which has mutations in the catalytic core of the 2 5 ribozyme that severely attenuates the activity of the ribozyme, (BAC) was delivered using cationic lipid in complete media for 24 hours. After 24 hours, the cells were lysed three times by freeze/thaw to release virus and virus was quantified by plaque assay. Viral yield is shown as mean plaque forming units per ml (pfu/ml) + SEM. The data is shown in figure 10.
Pre-treatment with interferon (IFI~ reduces the viral yield by 10'1 in control treated cells (BAC+IFN versus BAC). Ribozyme treated cells produce 2 x 10'1 less virus than control-treated cells (Rz versus BAC). The combination of Rz and IFN
treatment results in a synergistic 4 x 10'2 reduction in viral yield (Rz+IFN versus BAC). An additive effect would result in only a 3 x 10'1 reduction (1 x 10'1 + 2 x 10'1).

Example 13: Inhibition of Hepatitis C virus Usin~other RibozYme Motifs A number of varying ribozyme motifs (RPI motifs 1-3; Figure 9), were tested for their ability to inhibit HCV propagation in tissue culture. An example of RPI
motif I is described in Kore et al., 1998, Nucleic Acids Research 26, 4116-4120, while an example of RPI motif II is described in Ludwig & Sproat, international PCT Publication No. WO
98/58058). RPI motif III. is a new ribozyme motif which applicant has recently developed and an example of this motif was tested herein.
OST7 cells were maintained in Dulbecco's modified Eagle's medium (GIBCO
BRL) supplemented with 10% fetal calf serum, L-glutamine (2mM) and penicillinlstreptomycin. For transfections, OST7 cells were seeded in black-walled 96-well plates (Packard Instruments) at a density of 12,500 cells/well and incubated at 37°C under S% C02 for 24 hours. Co-transfection of target reporter HCVT7C (0.8 ~g/ml), control reporter pRLSV40, (1.2 p,g/ml) and ribozyme, SO-200 nM was achieved by the following method: a SX mixture of HCVT7C (4 p,g/ml), pRLSV40 (6 p,g/ml), ribozyme (250-nM) and cationic lipid (28.5 ~,g/ml) was made in 150 pls of OPTI-MEM (GIBCO
BRL) minus serum. Reporter/ribozyme/lipid complexes were allowed to form for 20 minutes at 37°C under S% C02. Medium was aspirated from OST7 cells and replaced with 120 p.ls of OPTI-MEM (GIBCO BRL) minus serum, immediately followed by the addition of 30 p,ls of SX reporter/ribozyme/lipid complexes. Cells were incubated with complexes for 4 hours at 37°C under 5% C02 . Luciferase assay was performed as described in example 7.
The data is summarized in table IX, with each motif's results listed along with its control.
All of the ribozyme motifs were able to reduce the amount of HCV produced by the cells compared to the ribozymes not targeted to any HCV (irrelevant controls).
Cell Culture Assays 2 5 Although there have been reports of replication of HCV in cell culture (see below), these systems are difficult to replicate and have proven unreliable.
Therefore, as was the case for development of other anti-HCV therapeutics such as interferon and ribavirin, after demonstration of safety in animal studies applicant can proceed directly into a clinical feasibility study.
Several recent reports have documented in vitro growth of HCV in human cell lines (Mizutani et al., Biochem Biophys Res Commun 1996 227(3):822-826; Tagawa et al., Journal of Gasteroenterology and Hepatology 1995 10(5):523-527; Cribier et al., Journal of General Virology 76(10):2485-2491; Seipp et al., Journal of General Virology 1997 78(10)2467-2478; Iacovacci et al., Research Virology 1997 148(2):147-151;
Iocavacci et al., Hepatology 1997 26(5) 1328-1337; Ito et al., Journal of General Virology 1996 77(5):1043-1054; Nakajima et al., Journal of Virology 1996 70{5):3325-3329;
Mizutani et al., Journal of Virology 1996 70(10):7219-7223; Valli et al., Res Virol 1995 146(4): 285-288; Kato et al., Biochem Biophys Res Comm 1995 206(3):863-869).
Replication of HCV has been demonstrated in both T and B cell lines as well as cell lines derived from human hepatocytes. Demonstration of replication was documented using either RT-PCR based assays or the b-DNA assay. It is important to note that the most recent publications regarding HCV cell cultures document replication for up to 6-months.
In addition to cell lines that can be infected with HCV, several groups have reported the successful transformation of cell lines with cDNA clones of full-length or partial HCV genomes (Harada et al., Journal of General Virology 1995 76(5)1215-1221;
Haramatsu et al., Journal of Viral Hepatitis 1997 45(1):61-67; Dash et al., American Journal of Pathology 1997 151(2):363-373; Mizuno et al., Gasteroenterology 1995 109(6):1933-40; Yoo et al., Journal Of Virology 1995 69(1):32-38).
Animal Models The best characterized animal system for HCV infection is the chimpanzee.
Moreover, the chronic hepatitis that results from HCV infection in chimpanzees and humans is very similar. Although clinically relevant, the chimpanzee model suffers from several practical impediments that make use of this model difficult. These include; high cost, long incubation requirements and lack of sufficient quantities of animals. Due to 2 0 these factors, a number of groups have attempted to develop rodent models of chronic hepatitis C infection. While direct infection has not been possible several groups have reported on the stable transfection of either portions or entire HCV genomes into rodents (Yamamoto et al., Hepatology 1995 22(3): 847-855; Galun et al., Journal of Infectious Disease 1995 172(1):25-30; Koike et al., Journal of general Virology 1995 76(12)3031-3038;
2 5 Pasquinelli et al., Hepatology 1997 25(3): 719-727; Hayashi et al., Princess Talcamatsu Symp 1995 25:1430149; Mariya K, Yotsuyanagi H, Shintani Y, Fujie H, Ishibashi K, Matsuura Y, Miyamura T, Koike K. Hepatitis C virus core protein induces hepatic steatosis in transgenic mice. Journal of General Virology 1997 78(7) 1527-1531; Takehara et al., Hepatology 1995 21(3):746-751; Kawamura et al., Hepatology 1997 25(4): 1014-1021). In addition, 30 transplantation of HCV infected human liver into immunocompromised mice results in prolonged detection of HCV RNA in the animal's blood.
Dia~~nostic uses Ribozymes of this invention may be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of HCV RNA
in a cell.

The close relationship between ribozyme activity and the structure of the target RNA
allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA. By using multiple ribozymes described in this invention, one may map nucleotide changes, which are important to RNA
structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with ribozymes may be used to inhibit gene expression and define the role (essentially) of specified gene products in the progression of disease. In this manner, other genetic targets may be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple ribozymes targeted to different genes, ribozymes coupled with known small molecule inhibitors, or intermittent treatment with combinations of ribozymes andlor other chemical or biological molecules). Other in vitro uses of ribozymes of this invention are well known in the art, and include detection of the presence of mRNAs associated with HCV related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a ribozyme using standard methodology.
In a specific example, ribozymes which can cleave only wild-type or mutant forms of the target RNA are used for the assay. The first ribozyme is used to identify wild-type RNA present in the sample and the second ribozyme will be used to identify mutant RNA
2 0 in the sample. As reaction controls, synthetic substrates of both wild-type and mutant RNA will be cleaved by both ribozymes to demonstrate the relative ribozyme efficiencies in the reactions and the absence of cleavage of the "non-targeted" RNA
species. The cleavage products from the synthetic substrates will also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population. Thus each analysis 2 5 will require two ribozymes, two substrates and one unknown sample which will be combined into six reactions. The presence of cleavage products will be determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired 3 0 phenotypic changes in target cells. The expression of mRNA whose protein product is implicated in the development of the phenotype (i.e., HCV) is adequate to establish risk.
If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels will be adequate and will decrease the cost of the initial diagnosis. Higher mutant form to wild-type ratios will be correlated with higher risk 3 5 whether RNA levels are compared qualitatively or quantitatively.

Additional Uses Potential usefulness of sequence-specific enzymatic nucleic acid molecules of the instant invention might have many of the same applications for the study of RNA that DNA restriction endonucleases have for the study of DNA (Nathans et al.; 1975 Ann. Rev 5 Biochem. 44:273). For example, the pattern of restriction fragments could be used to establish sequence relationships between two related RNAs, and large RNAs could be specifically cleaved to fragments of a size more useful for study. The ability to engineer sequence specificity of the ribozyme is ideal for cleavage of RNAs of unknown sequence.
Other embodiments are within the following claims.

TABLEI
Characteristics of naturally occurring, riboz~mes Group I Introns ~ Size: 150 to >1000 nucleotides.
~ Requires a U in the target sequence immediately 5' of the cleavage site.
~ Binds 4-6 nucleotides at the 5'-side of the cleavage site.
~ Reaction mechanism: attack by the 3'-OH of guanosine to generate cleavage products with 3'-OH and 5'-guanosine.
~ Additional protein cofactors required in some cases to help folding and maintainance of the active structure.
~ Over 300 known members of this class. Found as an intervening sequence in Tetrahymena thermophila rRNA, fungal mitochondria, chloroplasts, phage T4, blue-green algae, and others.
~ Major structural features largely established through phylogenetic comparisons, mutagenesis, and biochemical studies [1,2].
Complete kinetic framework established for one ribozyme [3,4~5~6~.

~ Studies of ribozyme folding and substrate docking underway [ , , ].
' Michel, Francois; Westhof, Eric. Slippery substrates. Nat. Struct. Biol.
(1994), I(1), 5-7.
Lisacek, Frederique; Diaz, Yolande; Michel, Francois. Automatic identification of group I intron cores in genomic DNA sequences. J. Mol. Biol. (1994), 235(4), 1206-17.
Herschlag, Daniel; Cech, Thomas R.. Catalysis of RNA cleavage by the Tetrahymena thermophila ribozyme. 1. Kinetic description of the reaction of an RNA substrate complementary to the active site.
Biochemistry (1990), 29(44), 10159-71.
Herschlag, Daniel; Cech, Thomas R.. Catalysis of RNA cleavage by the Tetrahymena thermophila ribozyme. 2. Kinetic description of the reaction of an RNA substrate that forms a mismatch at the active site. Biochemistry (1990), 29(44), 10172-80.
Knitt, Deborah S.; Herschlag, Daniel. pH Dependencies of the Tetrahymena Ribozyme Reveal an Unconventional Origin of an Apparent pKa. Biochemistry (1996), 35(5), 1560-70.
Bevilacqua, Philip C.; Sugimoto, Naoki; Turner, Douglas H.. A mechanistic framework for the second step of splicing catalyzed by the Tetrahymena ribozyme. Biochemistry (1996), 35(2), 648-58.
Li, Yi; Bevilacqua, Philip C.; Mathews, David; Turner, Douglas H..
Thermodynamic and activation parameters for binding of a pyrene-labeled substrate by the Tetrahymena ribozyme: docking is not diffusion-controlled and is driven by a favorable entropy change. Biochemistry (1995), 34(44), 14394-9.
Banerjee, Aloke Raj; Turner, Douglas H.. The time dependence of chemical modification reveals slow steps in the folding of a group I ribozyme. Biochemistry (1995), 34(19), 6504-12.

Chemical modification investigation of important residues well established (lo,t tj.
~ The small (4-6 nt) binding site may make this ribozyme too non-specific for targeted RNA cleavage, however, the Tetrahymena group I intron has been used to repair a "defective" (3-galactosidase message by the ligation of new (i-galactosidase sequences onto the defective message (t2].
RNAse P RNA (M1 RNAI
~ Size: 290 to 400 nucleotides.
~ RNA portion of a ubiquitous ribonucleoprotein enzyme.
~ Cleaves tRNA precursors to form mature tRNA [t3].
~ Reaction mechanism: possible attack by M2+-OH to generate cleavage products with 3'-OH and 5'-phosphate.
~ RNAse P is found throughout the prokaryotes and eukaryotes. The RNA subunit has been sequenced from bacteria, yeast, rodents, and primates.
~ Recruitment of endogenous RNAse P for therapeutic applications is possible through hybridization of an External Guide Sequence (EGS) to the target RNA
(t4~ts~
~ Important phosphate and 2' OH contacts recently identified (t6,1']
Zarrinkar, Patrick P.; Williamson, James R.. The P9.1-P9.2 peripheral extension helps guide folding of the Tetrahymena ribozyme. Nucleic Acids Res. (1996), 24(5), 854-8.
'° Strobel, Scott A.; Cech, Thomas R.. Minor groove recognition of the conserved G.cntdot.U pair at the Tetrahymena ribozyme reaction site. Science (Washington, D. C.) (1995), 267(5198), 675-9.
1' Strobel, Scott A.; Cech, Thomas R.. Exocyclic Amine of the Conserved G.cntdot.U Pair at the Cleavage Site of the Tetrahymena Ribozyme Contributes to 5'-Splice Site Selection and Transition State Stabilization. Biochemistry (1996), 35(4), 1201-11.
12. Sullenger, Bruce A.; Cech, Thomas R.. Ribozyme-mediated repair of defective mRNA by targeted traps-splicing. Nature (London) (1994), 371(6498), 619-22.
". Robertson, H.D.; Altman, S.; Smith, J.D. J. Biol. Chem., 247, 5243-5251 (1972).
'". Forster, Anthony C.; Altman, Sidney. External guide sequences for an RNA
enzyme. Science (Washington, D. C., 1883-) (1990), 249(4970), 783-6.
'3. Yuan, Y.; Hwang, E. S.; Altman, S. Targeted cleavage of mRNA by human RNase P. Proc. Natl.
Acad. Sci. USA (1992) 89, 8006-10.
'6 Harris, Michael E.; Pace, Norman R.. Identification of phosphates involved in catalysis by the ribozyme RNase P RNA. RNA (1995), 1(2), 210-18.
Pan, Tao; Loria, Andrew; Zhong, Kun. Probing of tertiary interactions in RNA:
2'-hydroxyl-base contacts between the RNase P RNA and pre-tRNA. Proc. Natl. Acad. Sci. U. S. A.
(1995), 92(26), 12510-14.

Group II Introns ~ Size: >1000 nucleotides.
Trans cleavage of target RNAs recently demonstrated (tg,t9].
~ Sequence requirements not fully determined.
~ Reaction mechanism: 2'-OH of an internal adenosine generates cleavage products with 3'-OH and a "lariat" RNA containing a 3'-5' and a 2'-5' branch point.
~ Only natural ribozyme with demonstrated participation in DNA cleavage (zo~zy ~
addition to RNA cleavage and ligation.
Major structural features largely established through phylogenetic comparisons Z 0 (22~.
Important 2' OH contacts beginning to be identified (z3~
Kinetic framework under development (24]
Neurospora VS RNA
Size: 144 nucleotides.
~ Trans cleavage of hairpin target RNAs recently demonstrated (2s].
~ Sequence requirements not fully determined.
'g Pyle, Anna Marie; Green, Justin B.. Building a Kinetic Framework for Group II Intron Ribozyme Activity: Quantitadon of Interdomain Binding and Reaction Rate. 'Biochemistry (1994), 33(9), 2716-25.
" Michels, William J. Jr.; Pyle, Anna Marie. Conversion of a Group II Intron into a New Multiple-Turnover Ribozyme that Selectively Cleaves Oligonucleotides: Elucidation of Reaction Mechanism and StructurelFunction Relationships. Biochemistry (1995), 34(9), 2965-77.
zo Z~erl Steven' Guo Huatao~ Eskes Robert Yan Jian; Penman Phili S.;
Lambowitz, Alan Y> > > > > > g> > P
M.. A group II intron RNA is a catalytic component of a DNA endonuclease involved in intron mobility.
Cell (Cambridge, Mass.) (1995), 83(4), 529-38.
z' Griffin, Edmund A., Jr.; Qin, Zhifeng; Michels, Williams J., Jr.; Pyle, Anna Mane. Group II intron nbozymes that cleave DNA and RNA linkages with similar effciency, and lack contacts with substrate 2'-hydroxyl groups. Chem. Biol. (1995), 2(11), 761-70.
Michel, Francois; Ferat, Jean Luc. Structure and activities of group II
introns. Annu. Rev. Biochem.
(1995), 64, 435-61.
Abramovitz, Dana L.; Fnedman, Richard A.; Pyle, Anna Mane. Catalytic role of 2'-hydroxyl groups within a group II intron active site. Science (Washington, D. C.) (1996), 271(5254), 1410-13.
24 D~iels, Danette L.; Michels, William J., Jr.; Pyle, Anna Marie. Two competing pathways for self splicing by group II introns: a quantitative analysis of in vitro reaction rates and products. J. Mol. Biol.
(1996), 256(1), 31-49.
'~ Guo, Hans C. T.; Collins, Richard A.. Effcient trans-cleavage of a stem-loop RNA substrate by a nbozyme derived from Neurospora VS RNA. EMBO J. (1995), 14(2), 368-76.

~ Reaction mechanism: attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosphate and 5'-OH ends.
~ Binding sites and structural requirements not fully determined.
~ Only 1 known member of this class. Found in Neurospora VS RNA.
Hammerhead Ribozyme (see text for references) ~ Size: ~13 to 40 nucleotides.
~ Requires the target sequence UH immediately 5' of the cleavage site.
~ Binds a variable number nucleotides on both sides of the cleavage site.
~ Reaction mechanism: attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosphate and 5'-OH ends.
~ 14 known members of this class. Found in a number of plant pathogens (virusoids) that use RNA as the infectious agent.
~
Essential structural features largely defined, including 2 crystal structures ~2b~27~
~ Minimal ligation activity demonstrated (for engineering through in vitro selection) ~xa~
Complete kinetic framework established for two or more ribozymes (29].
~ Chemical modification investigation of important residues well established (30]
Hairpin Ribozyme 2 0 ~ Size: ~50 nucleotides.
~ Requires the target sequence GUC immediately 3' of the cleavage site.
~ Binds 4-6 nucleotides at the 5'-side of the cleavage site and a variable number to the 3'-side of the cleavage site.
z6 Scott, W.G., Finch, J.T., Aaron,K. The crystal structure of an all RNA
hammerhead ribozyme:Aproposed mechanism for RNA catalytic cleavage. Cell, (1995), 81, 991-1002.
Z' McKay, Structure and function of the hammerhead ribozyme: an unfinished story. RNA, (1996), 2, 395-403.
Long, D., Uhlenbeck, O., Hertel, K. Ligation with hammerhead ribozymes. US
Patent No.
5,633,133.
29 Hertel, K.J., Herschlag, D., Uhlenbeck, O. A kinetic and thermodynamic framework for the hammerhead ribozyme reaction. Biochemistry, ( 1994) 33, 3374-3385.Beigehnan, L., et al., Chemical modifications of hammerhead ribozymes. J. Biol. Chem., (1995) 270, 25702-25708.
'° Beigelman, L., et al., Chemical modifications of hammerhead ribozymes. J. Biol. Chem., (1995) 270, 25702-25708.

~ Reaction mechanism: attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosphate and 5'-OH ends.
3 known members of this class. Found in three plant pathogen (satellite RNAs of the tobacco ringspot virus, arabis mosaic virus and chicory yellow mottle virus) which uses RNA
5 as the infectious agent.
~ Essential structural features largely defined [3132 33 34]
~ Ligation activity (in addition to cleavage activity) makes ribozyme amenable to engineering through in vitro selection [3s]
~ Complete kinetic framework established for one ribozyme [36].
10 ~ Chemical modification investigation of important residues begun [3~,~8].
Hepatitis Delta Virus (HDV~ Ribozyme Size: ~60 nucleotides.
Trans cleavage of target RNAs demonstrated [39].
3' Hampel, Arnold; Tritz, Richard; Hicks, Margaret; Cruz, Phillip. 'Hairpin' catalytic RNA model:
evidence for helixes and sequence requirement for substrate RNA. Nucleic Acids Res. (1990), 18(2), 299-304.
'x Chowrira, Bharat M.; Berzal-Herranz, Alfredo; Burke, John M.. Novel guanosine requirement for catalysis by the hairpin ribozyme. Nature (London) (1991), 354(6351), 320-2.
33 Beizal-Herranz, Alfredo; Joseph, Simpson; Chowrira, Bharat M.; Butcher, Samuel E.; Burke, John M.. Essential nucleotide sequences and secondary structure elements of the hairpin ribozyme. EMBO J.
(1993), 12(6), 2567-73.
Joseph, Simpson; Berzal-Herranz, Alfredo; Chowrira, Bharat M.; Butcher, Samuel E.. Substrate selection rules for the hairpin ribozyme determined by in vitro selection, mutation, and analysis of mismatched substrates. Genes Dev. (1993), 7(1), 130-8.
's Berzal-Herranz, Alfredo; Joseph, Simpson; Burke, John M.. In vitro selection of active hairpin ribozymes by sequential RNA-catalyzed cleavage and ligation reactions. Genes Dev. (1992), 6(I), 129-34.
'6 Hegg, Lisa A.; Fedor, Martha J.. Kinetics and Thermodynamics of Intermolecular Catalysis by Hairpin Ribozymes. Biochemistry (1995), 34(48), 15813-28.
3' Grasby, Jane A.; Mersmann, Karin; Singh, Mohinder; Gait, Michael 1.. Purine Functional Groups in Essential Residues of the Hairpin Ribozyme Required for Catalytic Cleavage of RNA. Biochemistry { 1995), 34(12), 4068-76.
'$ Schmidt, Sabine; Beigelman, Leonid; Karpeisky, Alexander; Usman, Nassim;
Sorensen, Ulrik S.;
Gait, Michael J.. Base and sugar requirements for RNA cleavage of essential nucleoside residues in internal loop B of the hairpin ribozyme: implications for secondary structure. Nucleic Acids Res. (1996), 24(4), 573-81.
39 penotta, Anne T.; Been, Michael D.. Cleavage of oligoribonucleotides by a ribozyme derived from the hepatitis .delta. virus RNA sequence. Biochemistry (1992), 31(1), 16-21.

~ Binding sites and structural requirements not fully determined, although no sequences 5' of cleavage site are required. Folded ribozyme contains a pseudoknot structure [~~].
~ Reaction mechanism: attack by 2'-OH 5' to the scissile bond to generate cleavage products with 2',3'-cyclic phosphate and 5'-OH ends.
~ Only 2 known members of this class. Found in human HDV.
~ Circular fore of HDV is active and shows increased nuclease stability [~1]
°° Perrotta, Anne T.; Been, Michael D.. A pseudoknot-like structure required for effcient self cleavage of hepatitis delta virus RNA. Nature (London) (1991), 350(6317), 434-6.
Puttaraju, M.; Perrotta, Anne T.; Been, Michael D.. A circular traps-acting hepatitis delta virus ribozyme. Nucleic Acids Res. (1993), 21(18), 4253-8.

WO 99/55847 PC'T/US99/09027 Table II: 2.5 ~.mol RNA Synthesis G~cle Reagent Equivalents Amount Wait Time*
Phosphoramidites 6.5 163 wL 2.
S

S Ethyl Tetrazole 23.8 238 p,L 2.5 Acetic Anhydride 100 233 ~,L S
sec N Methyl Imidazole 186 233 p.L S
sec TCA 83.2 1.73 mL 21 sec Iodine 8.0 1.18 mL 45 sec Acetonitrile NA 6.67 mL NA

2 0 * Wait time does not include contact time during delivery.

Table III: Ribozyme Selection Characteristics Characteristic Number HCV Genome Length 9436 kb All Hammerhead Cleavage Sites 1300 *

Conserved Region Hammerhead 23 Cleavage Sites **

HCV Genotype lb was the prototype strain ** Based on sequence alignments from HCV genotype la, lb, lc,2a,2b,2c3a,3b,4a,4c,4f,Sa,and6a Table IV: Hammerhead Ribozymes Derived from Conserved Regions of the HCV
Genome Name Substrate Ribozyme Sequence r NcR

HCV.S-50CUACUGU C UUCACGC GCGUGM CUGAUGAGGCCGUUAGGCCGM
ACAGUAG

HCV.S-67MAGCGU C UAGCCAU AUGGCUA CUGAUGAGGCCGUUAGGCCGAA
ACGCUUU

HCV.Sfi9AGCGUCU A GCCAUGG CCAUGGC CUGAUGAGGCCGUUAGGCCGAA
AGACGCU

HCV.S-92UGAGUGU C GUGCAGC GCUGCAC CUGAUGAGGCCGUUAGGCCGAA
ACACUCA

HCV.S-130GAGCCAU A GUGGUCU AGACCAC CUGAUGAGGCCGUUAGGCCGAA
AUGGCUC

HCV.S-136UAGUGGU C UGCGGAA UUCCGCA CUGAUGAGGCCGUUAGGCCGAA
ACCACUA

Z O HCV.S-153GGUGAGU A CACCGGA UCCGGUG CUGAUGAGGCCGUUAGGCCGAA
ACUCACC

HCV.S-180ACCGGGU C CUUUCUU AAGAAAG CUGAUGAGGCCGUUAGGCCGAA
ACCCGGU

HCV.S-183GCGUCCU U UCUUGGA UCCAAGA CUGAUGAGGCCGUUAGGCCGAA
AGGACCC

HCV.S-184GGUCCUU U CUUGGAU AUCCMG CUGAUGAGGCCGUUAGGCCGM
AAGGACC

HCV.S-258GUUGGGU C GCGAMG CUUUCGC CUGAUGAGGCCGUUAGGCCGAA
ACCCMC

HCV.S-270AAGGCCU U GUGGUAC GUACCAC CUGAUGAGGCCGUUAGGCCGAA
AGGCCUU

Z 5 HCV.S-294GGGUGCU U GCGAGUG CACUCGC CUGAUGAGGCCGUUAGGCCGM
AGCACCC

HCV.S-313GGGAGGU C UCGUAGA UCUACGA CUGAUGAGGCCGUUAGGCCGAA
ACCUCCC

HCV.S-31SGAGGUCU C GUAGACC GGUCUAC CUGAUGAGGCCGUUAGGCCGM
AGACCUC

HCV.S-318GUCUCGU A GACCGUG CACGGUC CUGAUGAGGCCGUUAGGCCGM
ACGAGAC

Con Rc~on HCV.C-30UAMCCU C AMGAM UUUCUUU CUGAUGAGGCCGUUAGGCCGM
AGGUUUA

2 O HCV.C-48CAMCGU A ACACCM UUGGUGU CUGAUGAGGCCGUUAGGCCGM
ACGUUUG

HCV.C-60CMCCGU C GCCCACA UGUGGGC CUGAUGAGGCCGUUAGGCCGM
ACGGUUG

HCV.C-175GAGCGGU C ACMCCU AGGUUGU CUGAUGAGGCCGUUAGGCCGM
ACCGCUC

HCV.C-374GUAAGGU C AUCGAUA UAUCGAU CUGAUGAGGCCGUUAGGCCGAA
ACCUUAC

3' NCR

HCV.3-118UUUUUUU U UUUUUUU MAAAM CUGAUGAGGCCGUUAGGCCGM

HCV.3-145GGUGGCU C CAUCUUA UAAGAUG CUGAUGAGGCCGUUAGGCCGM
AGCCACC

HCV.3-149GCUCCAU C UUAGCCC GGGCUAA CUGAUGAGGCCGUUAGGCCGM
AUGGAGC

HCV.3-151UCCAUCU U AGCCCUA UAGGGCU CUGAUGAGGCCGUUAGGCCGM
AGAUGGA

HCV.3-152CCAUCUU A GCCCUAG CUAGGGC CUGAUGAGGCCGUUAGGCCGM
MGAUGG

HCV.3-158UAGCCCU A GUCACGG CCGUGAC CUGAUGAGGCCGUUAGGCCGAA
AGGGCUA

NCV.3-161CCCUAGU C ACGGCUA UAGCCGU CUGAUGAGGCCGUUACGCCGM

HCV.3168CACGGCU A GCUGUGA UCACAGC CUGAUGAGGCCGUUAGGCCGM
AGCCGUG

HCV.3-18lGMAGGU C CGUGAGC GCUCACG CUGAUGAGGCCGUUAGGCCGAA
ACCUUUC

Table V: HCV Hammerhead Ribozyme and Target Sequence No. Name Nt. Hammerhead Substrate S Pos. Ribozyme lO 5 HCV-165165 UCCGGUGCUGAUGAGXCGAA ACUCACCGGUGAGUA CACCGGA

AAUGCCU

AAGUUCC

No. Name Nt. Hammerhead Substrate Pos.Ribozyme S

53 HCV-7737?3 CGCCCCC CUGAUGAGX CGAA AGGGGGGCCCCCCU AGGGGGCG

No. Name Nt. Hammerhead Substrate Pos. Ribozyme CUGAUGAG

1$

CUGAUGAG

CUGAUGAG

No. Name Nt. Hammerhead Substrate Pos. Ribozyme ZO

WO 99/55$47 PCT/US99/09027 No. Name Nt. Hammerhead Substrate Pos.Ribozyme CUGAUGAG

GGCAACC

IS

AACACCU

CUGAUGAG

ZO

AACGCGG

AAGGGCA

SS
No. Name Nt. hammerhead Substrate Pos. Ribozyme CUGAUGAG

152 HCV-2738273$ CCAGCAGCUGAUGAGXCGAA AGCAGGAUCCUGCUC CUGCUGG

CAAUACU

ZO

AAUGUCC

1?3 HCV-31393139 UUGGACGCUGAUGAGXCGAA AAUGGCCGGCCAUUA CGUCCAA

No. Name Nt. Hammerhead Substrate Pos.Ribozyme CUGAUGAG

lO 184 HCV-32903290AGGUGAU CUGAUGAGX CGAA AUCUUGGCCAAGAU CAUCACCU

CUGAUGAG

AAGUGGU

AAAGACC

$7 No.Name Nt. Hammerhead Substrate Pos.Ribozyme lO 214HCV-37613761GCACCGG CUGAUGAGX CGAA AUGACGUACGUCAUU CCGGUGC

1$

ZO

CUGAUGAG

2$ 227HCV-39083908CCUUCGC CUGAUGAGX CGAA ACCCCCCGGGGGGUU GCGAAGG

AAGUGCC

No. Name Nt. Hammerhead Substrate Pos. Ribozyme CUGAUGAG

1$

AAGGGGG

CUGAUGAG

WO 99/55847 PCTlUS99/09027 $9 No. Name Nt. Hammerhead Substrate Pos.Ribozyme $

1$

CUGAUGAG

AAGCAGA

296 HCV-558355$3ACCACGG CUGAUGAGXCGAA AGCAGCGCGCUGCU CCCGUGGU

WO 99/55$47 PCT/US99/09027 No.Name Nt. Hammerhead Substrate Pos.Ribozyme CUGAUGAG

' 303HCV-57675767GAUGUUG CUGAUGAGX CGAA ACAGGAGCUCCUGUU CAACAUC

AACAUCU

IS

CUGAUGAG

AAGGUCA

322HCV-59$15981GCAAGUU CUGAUGAGX CGAA ACCAGGUACCUGGUU
AACUUGC

WO 99/5584? PCT/US99/09027 No. Name Nt. Hammerhead Substrate Pos.Ribozyme S

GGCACGU

j~ 334 HCV-64136413UUUGCAU CUGAUGAGX CGAA AUGCCGUACGGCAU CAUGCAAA

CUGAUGAG

AAAUGCC

CUGAUGAG

AACCAAU

No.Name Nt. Hammerhead Substrate Pos.Ribozyme S

CUGAUGAG

No. Name Nt. Hammerhead Substrate Pos.Ribozyme IS

CUGAUGAG

ZO

AAUGUCC

AACGCGU

AACUUCU

414 HCV-?8537853CUUCUUC CUGAUGAGXCGAA ACGGAUAUAUCCGU AGAAGAAG

AAUUUGG

No.Name Nt. I3ammerhead Substrate Pos.Ribozyme 422HCV-8075$075AUACGAUCUGAUGAGX CGAA AGGCGAGCUCGCCUU AUCGUAU

lO 929HCV-80788078GGAAUACCUGAUGAGX CGAA AUAAGGCGCCUUAUC GUAUUCC

ZO AAAGAAA

q33HCV-83578357GCGACUUCUGAUGAGX CGAA AUGGCCUAGGCCAUA
AAGUCGC

CAUCGGG

CUGAUGAG

No. Name Nt. Hammerhead Substrate Pos.Ribozyme IS

CUGAUGAG

CAGCUGG

No.Name Nt. Hammerhead Substrate Pos.Ribozyme 1~ 484HCV-93299329AAAGUAGCUGAUGAGX CGAA AGUAGGCGCCUACUC CUACUUU

Where "X" represents stem II region of a HH ribozyme (Hertel et al., 1992 Nucleic Acids Res. 20:
3252). The length of stem II may be 2 base-pairs.

Table VI: Additional HCV Hammerhead (HIS Ribozyme and Target Sequence Pos. Ribozyme Substrate AUCGGGG

AUGGUGG

AUCUAUG

AGUGAUC

l~ AGUUCCU

ACAGUAG

AGACAGU

AAGACAG

IS ACGCUUU

AGACGCU

ACGCCAU

AACGCCA

ACUAACG

ACACUCA

AUGGCUC

ACCCGGU

AGGACCC

AAGGACC

AAAGGAC

AUCCAAG

AUCUCCA

AGGCCUU

AUUCGUG

AGGAUUC

AGGUUUA

ACGUUUG

AGGUGUU

Pos. Ribozyme Substrate AUCUGAC

ACGAUCU

ACUCCAC

AACUCCA

AAACUCC

ACACGUA

AGGUUGC

ACCUCCG

ACCCAGA

AGGGUAU

AGGUCGG

AGAGCAA

AAGAGCA

AAAGAGC

AGAAAGA

AGAGAAA

AUAGAGA

AGAUAGA

AAGAUAG

AGAGGAA

ACAGCAG

ACAGGAC

AUGGUCA

AGCUGGG

AAGCUGG

AGCGGAA

AAGCGGA

AUAAGCG

Pos. Ribozyme Substrate AUGCGUU

ACAGCCC

ACAUGGU

AGCAGUC

AGUUGGA

AUGCUUG

IO AUGCAUG

AGCGCUA

AGUGAGC

AGCGUGG

AUGCUGG

AGUGGGG

AUUGUCG

AGCGGCC

AGGUCCC

AGGAAAA

ACGAGGA

AGACGAG

ACUGGGA

AACAACU

AGGUGAA

AAGGUGA

AGAAGGU

AGGCGAG

ACCGGCG

ACUGUCU

AUUGCAG

AGCAAUU

AUUGAGC

Pos. Ribozyme Substrate CUGAUGAG

CUGAUGAG

CACGACA

Pos. Ribozyme Substrate AAGGACG

AGAAGGA

AAGAAGG

AUUCUCU

AGCUGGA

AUGAGCU

1~ AUGUGCC

AUUCAUU

AGGGAUU

ACCCGGU

AACCCGG

AGAACCC

AAGAACC

ACAGUGC

AACAGUG

AGAACAG

ACUUGUG

AACUUGU

AGUUGAA

AGCUGCA

AUAGGUG

AGGCUCG

AGGCCUC

ACACUGG

ACAGUAC

AACAGUA

AAACAGU

AGCAGCA

Pos. Ribozyme Substrate AAGCAGC

AGAAGCA

ACCCAGU

AACCCAG

AUCCGUG

AGCAAUC

1~ AAGCAAU

AAAGCAA

AGGUGUU

ACACCUA

AUACACC

ACUAUAC

AGUCAAC

AUGGGUA

AGCCUGU

AGUGCCA

ACAGUGC

AGUUGAC

AAGUUGA

AAGAUGG

AAAGAUG

ACCUUAA

AACCUUA

ACAUCCU

AGUCCAG

AGUGUCU

AAGUGUC

ACAGGGA

AACAGGG

Pos. Ribozyme Substrate AGGAACA

AAGGAAC

AGGGUGG

AGCCGGU

ACAGAGC

ACCAGUG

IU AACCAGU

AUCAAAC

ACUGCAC

ACAGGUA

ACCGUAC

AUACCGU

ACCCUAU

ACCGCUG

ACAACCG

AGACAAC

AGGAGAC

AAGGAGA

AUCACAA

AUACUCC

AUAUACU

ACACGAU

AAGCAAC

AAAGCAA

AAAAGCA

AGGAAAA

AAGGAAA

AGAAGGA

Pos. Ribozyme Substrate 1~

CUGAUGAG

CUGAUGAG

CUGAUGAG

CUGAUGAG

Pos. Ribozyme Substrate ACAAGGU

AGUGUGG

ACACUUU

AACACUU

AGGAACA

AGCCUGG

1~ AUGAGCC

AAAGUAU

AUAAAGU

AGCUCUG

AUUAGCU

AGAUUAG

AAGAUUA

AUGUCAA

AAUGUCA

AGUUUGG

AGCAGGA

AUGGCGA

AAUGGCG

ACCGAGA

AGCGGAC

AGCACCA

ACGGCAU

AGUACGG

AAGUACG

ACAAAGU

AGCGCGU

AGCCCCU

AAGCCCC

Pos. Ribozyme Substrate AUAAGCC

AAUAAGC

ACAUGCA

ACUUUCC

ACCUGUC

ACGUACC

1~ ACGUACG

AGACGUA

AUGGUCA

AGAUGGU

AAGAUGG

ACUGCCA

AAGACGA

AGAAGAC

AGUAUCU

AAGUAUC

AUCGGCC

AUGCUAU

AGGCCGU

AGUAGGC

ACCAAGU

AUGCAAC

AACAAUG

AGUAACA

ACCUGGU

AUUGUGU

AGAUUGU

AAGAUUG

Pos. Ribozyme Substrate AAUGGUG

CUGAUGAG

1~

CUGAUGAG

WO 99/55847 PC'T/US99/090Z7 Pos. Ribozyme Substrate CUGAUGAG

1~

CUGAUGAG

Pos. Ribozyme Substrate AACUGAC

l~

CUGAUGAG

CUGAUGAG

Pos. Ribozyme Substrate Pos. Ribozyme Substrate CUGAUGAG

1~

CUGAUGAG

Pos. Ribozyme Substrate AGGUUUA

AGCCUAU

ACGGCUC

AACGGCU

AUCUCAU

AGGGUGA

1~ AUGUGUG

AUGGGAU

AUUUGGU

AAUUUGG

AUGAAUU

ACAUGCA

AGCUGCA

ACCACAC

AUGACCA

ACCCACA

AUGAUCC

AAUGAUC

AAAUGAU

ACUUCCC

AGGACUU

AGAGGAC

AACUCCC

AGGCGCA

AGGUGUG

AGGGAGG

AAGGGAG

AUGUAAG

Pos. R,ibozyme Substrate 1~

CUGAUGAG

CUGAUGAG

AACUCGC

WO 99/55$47 PCT/(JS99/09027 Pos. Ribozyme Substrate AAUGAGG

CACGCCA

AAGGAUG

Pos. Ribozyme Substrate AAGACCU

CUGAUGAG

AAAAACG

AAACCUG

AACGCGU

Pos. Ribozyme Substrate 1~

CAGCAGA

AACGUAG

CUGAUGAG

Pos. Ribozyme Substrate CUGAUGAG

1~

CUGAUGAG

Pos. Ribozyme Substrate CUGAUGAG

AAGGAGA

AAGGCUA

GGCCAAA

AACCACA

CUGAUGAG

Pos. Ribozyme Substrate CUGAUGAG

1~

CUGAUGAG

IS 8123 CGUCGUACUGAUGAGX CGAA AGAGCCAUGGCUCUU.UACGACG

Pos. Ribozyme Substrate AACAGUC

AAUCUAC

AAAAGGG

Pos. Ribozyme Substrate 1~

WO 99/55847 PC'f/US99/09027 Pos. Ribozyme Substrate AACGACU

I~ CUGAUGAG

AAUAGGG

CUGAUGAG

AACUGGG

AAACUCA

Pos. Ribozyme Substrate CUGAUGAG

Where "X" represents stem II region of a HH ribozyme (Hertel et al., 1992 Nucleic Acids Res. 20:
3252). The length of stem II may be 2 base-pairs.

Table VII: HCV Hairpin (I~) Ribozyme and Target Sequence Pos. Ribozyme Substrate Sequence CCCCCA AGAA ACCAGAGAAACAX CCCCCGAUUGGGGG
GGGG GUACAUUACCUGGUA

AGAA GUACAUUACCUGGUA
GUAG

GCAC GUACAUUACCUGGUA

1~ GGUU GUACAUUACCUGGUA

GUAC GUACAUUACCUGGUA

GUAG GUACAUUACCUGGUA

GCGG GUACAUUACCUGGUA

GACC GUACAUUACCUGGUA

GUUC GUACAUUACCUGGUA

GCGA GUACAUUACCUGGUA

GAGC GUACAUUACCUGGUA

GCGG GUACAUUACCUGGUA

GGGA GUACAUUACCUGGUA

GUGG GUACAUUACCUGGUA

GCAC GUACAUUACCUGGUA

GCGA GUACAUUACCUGGUA

GAAU X

GGGC GUACAUUACCUGGUA

GGGC GUACAUUACCUGGUA

GCAG GUACAUUACCUGGUA

GGGA GUACAUUACCUGGUA

GAAG GUACAUUACCUGGUA

GUCA GUACAUUACCUGGUA

GGAG GUACAUUACCUGGUA

GCCC GUACAUUACCUGGUA

AGAA GUACAUUACCUGGUA
GCCG

Pos. Ribozyme Substrate Sequence GAAA
ACCAGAGAAACA

GCAG

GAUC

GGGA

GUUG

GGAG

1~ GCUU

GGCC

GGAU

GCCA X

GUCC

GUGC

GGAC

GGCC

GCAG

GUAA
ACCAGAGAAACA
X

GUAC

GGGC

GUCG

GUCU

GCAC

GCGU

GUGG

GUCC X

GAGC

GGCU

GCGG

GCAG

Pos. Ribozyme Substrate Sequence GCAG

GGGA

S GGUA

GAGC

GCUG

GCCA GGAC

GGCA

GCAU X

GCCU

GCUC

GCAC

GCCA

GCGG

GGAG

GGAG

GCAC

GGAG

GAGA
ACCAGAGAAACA
X

GACC X

GUCC

GGCA

GAGA

GUGA

AGAA
GUCC

GGCG

GGCU X

GACG

GAGC

Pos. Ribozyme Substrate Sequence GCAU

GCGC

GUCA

GUAG

GGGG

GGUC

IO GUGG
ACCAGAGAAACA

GAGC

GCCC

GGUA

AGAA
GCAU

AGAA
GGGG

GGGG

GGCA

GCGU

GAUG

GUAC

GCAA
ACCAGAGAAACA

GUUG

GUCU

GCGC

GAGC

GURU

GUUG X

4?24 GAAAUCAGAR ACCAGAGAAACAX GUACAUUACCUGGUAAGACAGUCGAUUUC
GUCU

GAAA
ACCAGAGAAACA

GUUC

GAAG

GGCG

Pos. Ribozyme Substrate Sequence GGCA

GGAA
ACCAGAGAAACA

GUAU

GGGG

GCUC

GACA

1~ GCCG

GCAA
ACCAGAGAAACA

GGCC

GCCG

GCAU

GCUC

GCCU

GCGG

GAGU

2~ 5710 AAUGCCAGAA ACCAGAGAAACAXGUACAUUACCUGGUAUCAC UGAUGGCAUU
GUGA

AGAA
GUGA

GGUG

GACU

GCCA

GCAC

AGAR
GAAG

GAGG

GGUU

GAGU

GGAG

GAGU

GCUG

GUCC

Pos. Ribozyme Substrate Sequence GGAG GUACAUUACCUGGUA

AGAR GUACAUUACCUGGUA
GUCA

6328 AGCUUGAGA.A ACCAGAGAAACAX CUCCAGUC
GGAG GUACAUUACCUGGUA CAAGCU

GGAG GUACAUUACCUGGUA

GGUG GUACAUUACCUGGUA

GUUU GUACAUUACCUGGUA

lO GCCA GUACAUUACCUGGUA

GGGA GUACAUUACCUGGUA

GCAC GUACAUUACCUGGUA

GCAC GUACAUUACCUGGUA

GUGA X

GGUU GUACAUUACCUGGUA

GUGA GUACAUUACCUGGUA

GGCC GUACAUUACCUGGUA

GGGG GUACAUUACCUGGUA

GCGU GUACAUUACCUGGUA

GGUC GUACAUUACCUGGUA

GAUA GUACAUUACCUGGUA

GGGC X

GCAA
ACCAGAGAAACA
X

GUAU GUACAUUACCUGGUA

GUCC GUACAUUACCUGGUA

AGAA GUACAUUACCUGGUA
GAAG

GCCG GUACAUUACCUGGUA

GGAG GUACAUUACCUGGUA

GACG GUACAUUACCUGGUA

GCCG GUACAUUACCUGGUA

GUCG GUACAUUACCUGGUA

GGAG GUACAUUACCUGGUA

Pos. Ribozyme Substrate Sequence GAUC

GAGG

S GAUU

GGGU

GACG

GCAG

1~ GGGC

GCUU

GAGA

GUCA

GCUU

GAUL

GGUC

GGCU

GGGA

GUAC

GGUG

AGAA
GCGG

GCUC

_ GCAC

GCAG

GGCC

GGUC

GACA

GUUC

GACA

GAGG

GUAC

Pos. Ribozyme Substrate Sequence GUAG

GGGA

GGGA

GGAC

GUGA

GGCU

lO GGCA

GGGU

GGUA

Where "X" represents stem IV region of a HI' ribozyme (Beczal-Herranz et al., 1993, EMBO.J. 12, 15 2567). The length of stem IV may be 2 base-pairs.

Table VIII: Additional HCV Conserved Hammerhead ribozyme and target sequence Nos. Name* Pos.T Riboryme Substrate S 1 HCV.C-4$278 UUGGUGUCUGAUGAGX CGAA ACGUUUGCAAACGUAACACCAA

2 HCV.C-60290 UGUGGGCCUGAUGAGX CGAA ACGGUUGCAACCGUCGCCCACA

3 HCV.C-175405 AGGUUGUCUGAUGAGX CGAA ACCGCUCGAGCGGUCACAACCU

9 HCV.3-1189418 AAAAAAA X CGAA AAAAAAAUUUUUUUUUUUUUUU
CUGAUGAG

HCV.3-1459495 UAAGAUGCUGAUGAGX CGAA AGCCACCGGUGGCUCCAUCUUA

6 HCV.3-1499449 GGGCUAA X CGAA AUGGAGCGCUCCAUCUUAGCCC
CUGAUGAG

7 HCV.3-1519451 UAGGGCUCUGAUGAGX CGAA AGAUGGAUCCAUCUUAGCCCUA

8 HCV.3-1529452 CUAGGGCCUGAUGAGX CGAA AAGAUGGCCAUCUUAGCCCUAG

9 HCV.3-1589458 CCGUGACCUGAUGAGX CGAA AGGGCUAUAGCCCUAGUCACGG

IS 10 HCV.3-1619961 UAGCCGUCUGAUGAGX CGAA ACUAGGGCCCUAGUCACGGCUA

11 HCV.3-1689468 UCACAGCCUGAUGAGX CGAA AGCCGUGCACGGCUAGCUGUGA

12 HCV.3-1819481 GCUCACGCUGAUGAGX CGAA ACCUUUCGAAAGGUCCGUGAGC

Where "X" represents stem II region of a HH ribozyme (Hertel et al., 1992 Nucleic Acids Res. 20:
3252). The length of stem II may be 2 base-pairs.
Core Reference Sequence for Nos. 1-3 = HPCCOPR (Acc#L38318) 1-600 by *-Nucleotide 231 (8 nucleotide upstream of the initiator ATG) has been designated as "1" for the purpose of numbering ribozyme sites in the core protein coding region.
3'-NCR Reference Sequence for Nos. 4-12= D85S16 (Acc#D8SS16) 9301-9535 by *- Nucleotide 9301 has been designated as "1" for the purpose of numbering ribozyme sites in the 3'NCR.
t- position number reflects the reference sequence from HPCCOPR.

ro a~ ~r ro U ro ro ~ ro ~ U
C0 0.1 ~ ro P7 00 W al frla1 !t1W ~ C'J CU'J
~ U U U CU7 N U ro ro U U ro U ~ '~U'iU7U U
ro ~ p C7 U tT ~ U b~ ro ro U tn ~ ~ ~ U U
tr U U ~ CT U U U U b~ U
t0 ro U U ro b ro CT bi tT V U ' :y ~ b U U U U b~ U H ~ ~ U U
ro U U ro rO U ro ro ~ Nro ro ~ ~ C~.7 CT N ~ tr~~ U W 0 ~ U' C7 ~
3 ~ U U U ro b~ U ro U U ~ U U
rd ro ro ro r0 G~ N b~ C7 U U ~ C7 C7 CT b~ CT tT CT O~ b~ U b~ b~
O. y U U U U U U U U U CT b~ V
ca ~ a~ tr~rn tn a~ a~ a~ ro ro V U
U U U U U U U U ro ~
C7 tn CT tn CT CT CT b~ ~ tT CT b U U
D ro ro ro ro ro b ro O~ U U b U
~ ~ ~ ~ ~ ~ ~ U U U ~
U U U U U U U U b U ro ro ro ro ro ro ro ro ~ CT tr ~
~ U U U U U U U U ro N t0 ~ ro ~C c~ ~ ~ ~ c~ c7 ~ c~ ~ c~ c~ ro r~ ro ro ro ro ro c0 ro [~ r.~ ~ V ~ b' U U U U U U U U b b~
C~ b~ kn b~ b~ o~ O~ O~ ~ ~ ~ ro d' a~
cr o~ a ~ ~ tr tn U U U V
p D D D ~ ~ ~ D D U ~' ~ rt ~' FC r.CrC FC FC ~ r~ ~C U U ~' b' tn U
to ~ c7 c~ c~ c~ ~ ~ ", ~, ~, ~ ,~ ro r0 D ~ ~ ~ ~ ~ ~ ~ U ~ U b' U ~
Q" b ~ ro ~ ~ ~ % ~ ~ ro ~ ro U U b~ ~ ro U CT U ~ U U b~
G~ U ro U U U ~ ro ro ~ U ~ ~ U ~
'..)U ro b~ U ~ U U o, v~ m U
C/~ N ro U CT U ~ ~ tT ro ~ CT ~ ~ U

M M ~- ~ N N M r- N e- ~ h~ f~ O Cp O O O O O O O O M O O O O ~ '-r N M ~ tn O CflL17N O ~ ~ Op f~ N
.'nr'~"~ N ~- ~- i- ~ ~ e- e- e- oO O N M ~ (D
p O O O O O O O O ~- O r- e- O O O

_ U~ ~ O
~"".G O 00 0~ o co t~ o ~ o o C m n o U U
o a M M v ~t m f~ ~n M ~ ~ 0 0 0 ~ f~.~ f~-1~ 1~ h Q M M ~"'I~ h f~
w z ~ ~ ~ ~ ~ ~ ~ ~ p 1 > ~ r- r- ~- e- ~- ~ N N ~ i- ~ ~-.. ~ N
C

y .~ v_-~. ;,_~ .~ y- ,~ - - _ w _ ...':~.w. .._.
O O p O O O O

~ CL'~ ~' ~ Q_'Q' v7 O .-~-~ O
N

U U

ro ro aT sT

~ c7 c~ c~

U U

U U

U U

C~ c.7 U

U U

U U

U U

ro ro ro ro ro ro ~ :S

ro ro tr~~

U U

ro U

D ro U U
v CT U
<T ro U ~

ro tT

G U ~

C/~ ~ CT

O Q

O O
iii ; ~

_ U

b N

(0 G ed ~ ~ C

. rn N N
a~o0~0~ ~ ~ N U
.v 0 N (~O .ilk N U ~' q) ~ ~ 'o m v~

a.
N C ~ O ~ ~
- - w C
v o U ~ ~
O O ~ L ~ '~ a~
O CV Q Q >
O
.C

O .~ O II II
U ~ 00 ~ C7~n m a a I I
I

° ~ o N

Claims (50)

Claims

1. An enzymatic nucleic acid molecule which specifically cleaves RNA
derived from hepatitis C virus (HCV), wherein said enzymatic nucleic acid molecule is in a hammerhead motif, wherein the binding arms of said enzymatic nucleic acid molecule comprises sequences complementary to any of substrate sequences defined in tables IV-VI
and VIII.

2. An enzymatic nucleic acid molecule which specifically cleaves RNA
derived from hepatitis C virus (HCV), wherein said enzymatic nucleic acid molecule is in a hairpin motif, wherein the binding arms of said enzymatic nucleic acid molecule comprises sequences complementary to any of substrate sequences defined in table VII.

3. The enzymatic nucleic acid molecule of claim 1, wherein said enzymatic nucleic acid molecule comprises a stem II region of length greater than or equal to 2 base pairs.

4. The enzymatic nucleic acid molecule of claims 1 or 2, wherein said nucleic acid comprises between 12 and 100 bases complementary to said RNA.

5. The enzymatic nucleic acid molecule of claim 1 or 2, wherein said nucleic acid comprises between 14 and 24 bases complementary to said mRNA.

6. The enzymatic nucleic acid of claim 2, wherein said enzymatic nucleic acid molecule comprises a stem II region of length between three and seven base-pairs.

7. The enzymatic nucleic acid molecule of claim 2, wherein said enzymatic nucleic acid molecule consists essentially of any ribozyme sequence defined in Table VII.

8. The enzymatic nucleic acid molecule of claim 1, wherein said enzymatic nucleic acid molecule consists essentially of any ribozyme sequence defined in Tables IV-VI and VIII.

9. A pharmaceutical composition comprising the enzymatic nucleic acid molecule of claims 1 or 2.

10. A mammalian cell including an enzymatic nucleic acid molecule of any of claims 1 or 2.

11. The mammalian cell of claim 10, wherein said mammalian cell is a human cell.

12. An expression vector comprising nucleic acid sequence encoding at least one enzymatic nucleic acid molecule of claims 1 or 2, in a manner which allows expression of that enzymatic nucleic acid molecule.

13. A mammalian cell including an expression vector of claim 12.

14. The mammalian cell of claim 13, wherein said mammalian cell is a human cell.

15. A method for treatment of cirrhosis, liver failure or hepatocellular carcinoma comprising the step of administering to a patient the enzymatic nucleic acid molecule of claims 1 or 2 under conditions suitable for said treatment.

16. A method for treatment of cirrhosis, liver failure and/or hepatocellular carcinoma comprising the step of administering to a patient the expression vector of claims 1 or 2 under conditions suitable for said treatment.

17. A method of treatment of a patient having a condition associated with HCV
infection, comprising contacting cells of said patient with the nucleic acid molecule of claims 1 or 2, and further comprising the use of one or more drug therapies under conditions suitable for said treatment.

18. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least five ribose residues, and wherein said nucleic acid comprises phosphorothioate linkages at at least three of the 5' terminal nucleotides, and wherein said nucleic acid comprises a 2'-C-allyl modification at position No. 4 of said nucleic acid, and wherein said nucleic acid comprises at least ten 2'-O-methyl modifications, and wherein said nucleic acid comprises a 3'- end modification.

19. The enzymatic nucleic acid of claim 18, wherein said nucleic acid comprises a 3'-3' linked inverted abasic moiety at said 3' end.

20. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least five ribose residues, and wherein said nucleic acid molecule comprises phosphorothioate linkages at at least three of the 5' terminal nucleotides, and wherein said nucleic acid comprises a 2'-amino modification at position No. 4 and/or at position No. 7 of said nucleic acid molecule, wherein said nucleic acid molecule comprises at least ten 2'-O-methyl modifications, and wherein said nucleic acid comprises a 3'- end modification.

21. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises at least five ribose residues, and wherein said nucleic acid molecule comprises phosphorothioate linkages at at least three of the 5' terminal nucleotides, and wherein said nucleic acid molecule comprises an abasic substitution at position No. 4 and/or at position No. 7 of said nucleic acid molecule, wherein said nucleic acid comprises at least ten 2'-O-methyl modifications, and wherein said nucleic acid molecule comprises a 3'-end modification.

22. The enzymatic nucleic acid molecule of claim 1, wherein said nucleic acid molecule comprises of at least five ribose residues, and wherein said nucleic acid comprises phosphorothioate linkages at at least three of the 5' terminal nucleotides, and wherein said nucleic acid molecule comprises a 6-methyl uridine substitution at position No. 4 and/or at position No. 7 of said nucleic acid molecule, wherein said nucleic acid molecule comprises at least ten 2'-O-methyl modifications, and wherein said nucleic acid molecule comprises a 3' end modification.

23. A method for inhibiting HCV replication in a mammalian cell comprising the step of administering to said cell the enzymatic nucleic acid molecule of claims 1 or 2 under conditions suitable for said inhibition.

24. A method of cleaving a separate RNA molecule comprising, contacting the enzymatic nucleic acid molecule of claims 1 or 2 with said separate RNA
molecule under conditions suitable for the cleavage of said separate RNA molecule.

25. The method of claim 24, wherein said cleavage is carried out in the presence of a divalent cation.

26. The method of claim 25, wherein said divalent cation is Mg2+.

27. The nucleic acid molecule of claim 1 or 2, wherein said nucleic acid is chemically synthesized.

28. The expression vector of claim 12, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;
c) a gene encoding at least one said nucleic acid molecule; and wherein said gene is operably linked to said initiation region and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.

29. The expression vector of claim 12, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;
c) an open reading frame;
d) a gene encoding at least one said nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame; and wherein said gene is operably linked to said initiation region, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.

30. The expression vector of claim 12, wherein said vector comprises:
a) a transcription initiation region;
b) a transcription termination region;
c) an intron;
d) a gene encoding at least one said nucleic acid molecule; and wherein said gene is operably linked to said initiation region, said intron and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.

31. The expression vector of claim 12, wherein said vector comprises:

a) a transcription initiation region;
b) a transcription termination region;
c) an intron;
d) an open reading frame;
e) a gene encoding at least one said nucleic acid molecule, wherein said gene is operably linked to the 3'-end of said open reading frame; and wherein said gene is operably linked to said initiation region, said intron, said open reading frame and said termination region, in a manner which allows expression and/or delivery of said nucleic acid molecule.

32. An enzymatic nucleic acid molecule which specifically cleaves RNA
derived from hepatitis C virus (HCV), wherein said enzymatic nucleic acid molecule is a DNA enzyme.

33. The enzymatic nucleic acid molecule of any of claims 1, 2 or 32, wherein said enzymatic nucleic acid comprises at least one 2'-sugar modification.

34. The enzymatic nucleic acid molecule of any of claims 1, 2 or 32, wherein said enzymatic nucleic acid comprises at least one nucleic acid base modification.

35. The enzymatic nucleic acid molecule of any of claims 1, 2 or 32, wherein said enzymatic nucleic acid comprises at least one phosphorothioate modification.

36. The method of claim 17, wherein said drug therapies is type I interferon.

37. The method of claim 36, wherein said type I interferon and the enzymatic nucleic acid molecule is administered simultaneously.

38. The method of claim 36, wherein said type I interferon and enzymatic nucleic acid molecule is administered separately.

39. The method of claim 36, wherein said type I interferon is interferon alpha.

40. The method of claim 36, wherein said type I interferon is interferon beta.

41. The method of claim 36, wherein said type I interferon is interferon gamma.

42. The method of claim 36, wherein said type I interferon is consensus interferon.

43. A method of treatment of a patient having a condition associated with HCV
infection, comprising contacting cells of said patient with the nucleic acid molecule of claim 32, and further comprising the use of one or more drug therapies under conditions suitable for said treatment.

44. The method of claim 43, wherein said drug therapies is type I interferon.

45. The method of claim 44, wherein said type I interferon and the enzymatic nucleic acid molecule is administered simultaneously.

46. The method of claim 44, wherein said type I interferon and enzymatic nucleic acid molecule is administered separately.

47. The method of claim 44, wherein said type I interferon is interferon alpha.

48. The method of claim 44, wherein said type I interferon is interferon beta.

49. The method of claim 44, wherein said type I interferon is interferon gamma.

50. The method of claim 44, wherein said type I interferon is consensus interferon.